Literature DB >> 35121738

ROCK1 mechano-signaling dependency of human malignancies driven by TEAD/YAP activation.

Davide Esposito1, Ila Pant1, Yao Shen1, Rui F Qiao1, Xiaobao Yang2, Yiyang Bai1,3, Jian Jin2, Poulikos I Poulikakos1,4, Stuart A Aaronson5.   

Abstract

Rho family mechano-signaling through the actin cytoskeleton positively regulates physiological TEAD/YAP transcription, while the evolutionarily conserved Hippo tumor suppressor pathway antagonizes this transcription through YAP cytoplasmic localization/degradation. The mechanisms responsible for oncogenic dysregulation of these pathways, their prevalence in tumors, as well as how such dysregulation can be therapeutically targeted are not resolved. We demonstrate that p53 DNA contact mutants in human tumors, indirectly hyperactivate RhoA/ROCK1/actomyosin signaling, which is both necessary and sufficient to drive oncogenic TEAD/YAP transcription. Moreover, we demonstrate that recurrent lesions in the Hippo pathway depend on physiological levels of ROCK1/actomyosin signaling for oncogenic TEAD/YAP transcription. Finally, we show that ROCK inhibitors selectively antagonize proliferation and motility of human tumors with either mechanism. Thus, we identify a cancer driver paradigm and a precision medicine approach for selective targeting of human malignancies driven by TEAD/YAP transcription through mechanisms that either upregulate or depend on homeostatic RhoA mechano-signaling.
© 2022. The Author(s).

Entities:  

Mesh:

Substances:

Year:  2022        PMID: 35121738      PMCID: PMC8817028          DOI: 10.1038/s41467-022-28319-3

Source DB:  PubMed          Journal:  Nat Commun        ISSN: 2041-1723            Impact factor:   17.694


Introduction

The ability to selectively target oncogene or tumor suppressor pathways that afflict particular tumors or tumor types has led to significant increases in patient survival over the past two decades[1]. The great majority involve driver mutations that directly activate oncogenic signaling within the same pathway[2]. There remains a critical need to better understand oncogenic mechanisms that have not yet proven amenable to biologically targeted therapies. One such mechanism involves the evolutionarily conserved Hippo pathway, which plays an important role in organ size control and normal tissue homeostasis[3] through the actions of its core kinases, MST1/2 and LATS1/2, which negatively regulate TEA domain (TEAD) transcription through phosphorylation and cytosolic retention/degradation of TEAD co-activators, YAP and TAZ (hereafter designated as YAP)[4]. Recurrent tumor mutations in the Hippo pathway through loss of function (LOF) of LATS or NF2 or YAP amplification/over expression result in constitutive upregulation of TEAD/YAP transcription and acquisition of the transformed phenotype in culture[5] and in mouse genetic models in vivo[6]. While these findings have strongly implicated this pathway in human malignancy[7], there are as yet no targeted approaches available for Hippo pathway dysregulated tumors[8-10]. The p53 tumor suppressor gene is similarly highly conserved in evolution[11] and has a critical role in normal cellular homeostasis[12]. There is also evidence of crosstalk between p53 and Hippo pathways in various physiological contexts[13]. More than 50% of human tumors exhibit p53 LOF mutations, and around three-quarters of these are missense mutations[14], which have been reported to also confer a gain of function (GOF)[15]. Over the past 2 decades, numerous GOF mechanisms have been set forth with most implicating mutant p53 interactions with transcription factors ranging from p53 related family members to NF-Y, Sp1, Ets-1, SREBPs, VDR, or YAP[16-18]. Among these, Freed Pastor et al. reported that p53 missense mutants upregulated the activity of SREBPs, master transcriptional regulators of the mevalonate (MVA) pathway[19]. Geranylgeranyl pyrophosphate, an MVA pathway product, is known to increase membrane localization and activation of the Rho family[20], and a p53 missense mutant that increased SREBP activity was subsequently reported to upregulate TEAD/YAP transcription through a RhoA dependent mechanism[21]. However, activating mutations analogous to Ras oncogenic mutations in members of the Rho family of GTPases[22], are observed very infrequently in human tumors[23]. In the present study, we investigated the GOF mechanism through which certain p53 missense mutants induce the transformed phenotype and identify a paradigm for cancer driver mutations that act indirectly to hyperactivate wild-type RhoA mechano-signaling to levels required for oncogenic TEAD/YAP transcription. We also investigated the role of physiological RhoA/ROCK mechano-signaling in upregulating TEAD/YAP transcription and the proliferation of tumors with Hippo pathway genetic aberrations. Our findings provide proof of concept for the application of ROCK inhibitors, which have been clinically tested in humans for other indications[24], to selectively antagonize the growth and motility of a substantial fraction of human tumors harboring previously untargeted p53 missense or Hippo pathway mutations.

Results

One class of p53 missense mutants activates oncogenic TEAD/YAP transcription

We sought initially to determine whether TEAD/YAP activation initially reported for a p53 R280K missense mutation[21], was shared by other p53 GOF mutants. To do so, we screened different p53 missense mutants exogenously expressed in MCF10A immortalized human breast epithelial cells, which are wild-type for components of the Hippo pathway and p53, for the ability to activate a TEAD transcriptional reporter[25]. Those with hot spot as well as less common mutations of the class that specifically impairs DNA contact with the promoters of p53 wild type (WT) target genes in 10-15% of tumors[21], increased TEAD reporter activity comparably to overexpressed YAP (Fig. 1a). In marked contrast, neither R175H nor G245S p53 hot spot conformational mutants, which represent around 10% of p53 missense mutations[26], had any effect (Fig. 1a). P53 protein levels observed with exogenous expression of the tested mutants were similar and comparable to endogenous expression levels of these mutants in human tumors (Supplementary Fig. 1a). These findings argued for at least 2 classes of p53 GOF missense mutations with DNA contact mutants specifically responsible for upregulating TEAD/YAP transcription.
Fig. 1

P53 DNA contact mutations drive TEAD/YAP dependent transcription/transformation in human tumors through MVA pathway activation.

a TEAD reporter activity of MCF10A cells stably expressing empty vector (EV) control, YAP WT, p53 R248Q, p53 R248W, p53 R273H, p53 R273C, p53 RS241F, p53 R175H, or p53 G245S. b TEAD reporter activity of MCF10A cells stably expressing EV control, YAP WT or p53 R273H in the presence or in the absence of dnTEAD4 stable expression. c Representative image from n = 2 biologically independent replicates showing anchorage-independent growth in soft agar of MCF10A cells stably expressing EV control, YAP WT or p53 R273H in the presence or in the absence of dnTEAD4 stable expression. d TEAD reporter activity of human tumor lines containing hot spot p53 DNA contact (in blue), conformational (in red), or null (in gray) mutations as specified in Supplementary Table 1. 293T (wt p53) and H2052 cells (wt p53 and NF2; LATS2 LOFs) served as negative and positive controls, respectively. e TEAD reporter activity of indicated tumor lines stably expressing empty vector control (Ctr), dominant negative TEAD4 (dnTEAD4) or p53 shRNA (shp53). f Representative plates from n = 2 biologically independent replicates showing 2D colony formation by indicated tumor lines stably expressing empty vector control (Ctr), dnTEAD4 or shp53 for 14 days. g mRNA expression levels of MVA pathway genes, HMGCR and SQLE, by real time PCR in MCF10A cells stably expressing EV control, YAP WT, p53 R273H or p53 R175H. h mRNA expression of Mevalonate (MVA) pathway genes, HMGCR and SQLE, by real time PCR in the indicated cell lines stably expressing Scramble shRNA (shScr) or shp53. i ChIP analysis on HMGCR promoter in MCF10A cells stably overexpressing either p53 R273H or p53 R175H. ChIP was performed with p53 or control immunoglobulin G (IgG) antibody and quantified by real-time PCR on the indicated promoters. Acetyl choline receptor (AchR) promoter was used as a negative control. p values were derived using two tailed t-tests from means± SD of n = 3 biologically independent replicates.*p  <  0.05, **p  <  0.01, ***p  <  0.001, ****p  <  0.0001. Source data with actual calculated p values are provided as Source data file.

P53 DNA contact mutations drive TEAD/YAP dependent transcription/transformation in human tumors through MVA pathway activation.

a TEAD reporter activity of MCF10A cells stably expressing empty vector (EV) control, YAP WT, p53 R248Q, p53 R248W, p53 R273H, p53 R273C, p53 RS241F, p53 R175H, or p53 G245S. b TEAD reporter activity of MCF10A cells stably expressing EV control, YAP WT or p53 R273H in the presence or in the absence of dnTEAD4 stable expression. c Representative image from n = 2 biologically independent replicates showing anchorage-independent growth in soft agar of MCF10A cells stably expressing EV control, YAP WT or p53 R273H in the presence or in the absence of dnTEAD4 stable expression. d TEAD reporter activity of human tumor lines containing hot spot p53 DNA contact (in blue), conformational (in red), or null (in gray) mutations as specified in Supplementary Table 1. 293T (wt p53) and H2052 cells (wt p53 and NF2; LATS2 LOFs) served as negative and positive controls, respectively. e TEAD reporter activity of indicated tumor lines stably expressing empty vector control (Ctr), dominant negative TEAD4 (dnTEAD4) or p53 shRNA (shp53). f Representative plates from n = 2 biologically independent replicates showing 2D colony formation by indicated tumor lines stably expressing empty vector control (Ctr), dnTEAD4 or shp53 for 14 days. g mRNA expression levels of MVA pathway genes, HMGCR and SQLE, by real time PCR in MCF10A cells stably expressing EV control, YAP WT, p53 R273H or p53 R175H. h mRNA expression of Mevalonate (MVA) pathway genes, HMGCR and SQLE, by real time PCR in the indicated cell lines stably expressing Scramble shRNA (shScr) or shp53. i ChIP analysis on HMGCR promoter in MCF10A cells stably overexpressing either p53 R273H or p53 R175H. ChIP was performed with p53 or control immunoglobulin G (IgG) antibody and quantified by real-time PCR on the indicated promoters. Acetyl choline receptor (AchR) promoter was used as a negative control. p values were derived using two tailed t-tests from means± SD of n = 3 biologically independent replicates.*p  <  0.05, **p  <  0.01, ***p  <  0.001, ****p  <  0.0001. Source data with actual calculated p values are provided as Source data file. Figure 1b shows that lentivirally transduced dnTEAD4 markedly inhibited TEAD reporter activity of MCF10A cells exogenously expressing YAP WT or p53 R273H, a representative p53 DNA contact mutant. These transformants like those exogenously expressing a prototype p53 conformational mutant, p53R175H, formed readily detectable colonies in a 3D soft agar assay, while vector control MCF10A cells failed to do so (Fig. 1c). At comparable dnTEAD4 expression levels (Supplementary Fig. 1b), MCF10A YAPWT and MCF10A p53 R273H cells formed few if any agar colonies but there was no detectable inhibition of colony formation by MCF10A R175H cells. All of these findings strongly argued that TEAD/YAP transcriptional activation by p53 DNA contact mutants was responsible for their transforming GOF. Analysis of human tumors with endogenous p53 DNA contact, conformational or null mutations (Supplementary Table 1) for upregulated TEAD/YAP transcription revealed high levels in those harboring p53 DNA contact mutations, comparable to H2052 mesothelioma cells with LOF mutations in NF2 and LATS2[25] (Fig. 1d). In marked contrast, tumors with endogenous mutations that altered p53 conformation or with null mutations were negative for TEAD reporter activity (Fig. 1d and Supplementary Table 1). Expression levels of endogenous TEAD/YAP target genes, CTGF and CYR61[27], exhibited this same pattern (Supplementary Fig. 1c). The high levels of TEAD dependent transcription in human tumors harboring endogenous p53 DNA contact mutants were inhibited by shp53 comparably to exogenously expressed dnTEAD4, further establishing that mutant p53 was responsible (Fig. 1e). p53 knockdown markedly inhibited proliferation of human tumors with all p53 missense mutations tested and as a specificity control, had no effect on colony formation by H1299 tumor cells (Fig. 1f) lacking detectable P53 (Supplementary Fig. 1d). Of note, dnTEAD4 antagonized colony formation only of those tumors with endogenous p53 DNA contact mutations. These results indicated that upregulated TEAD/YAP transcription was required for their proliferation and confirmed that endogenous p53 conformational mutants must possess a different GOF mechanism (Fig. 1f). The response to shp53 or dnTEAD4 transduction of MDA-MB-468 tumor cells harboring a representative p53 DNA contact mutant was characterized as a G1 arrest (Supplementary Fig. 1e). This was despite the fact that p53 DNA contact mutant tumor cells are known to harbor other potent endogenous oncogenic drivers (Supplementary Table 1). Thus, both in a human immortalized cell model and in human tumors, TEAD/YAP transcriptional activation by exogenous or endogenous p53 DNA contact mutants, respectively, was both necessary and sufficient to explain their transforming GOF. Among various reported GOF mechanisms for p53 missense mutants[16-18], biochemical studies have implicated direct interactions with YAP[28] or upregulation of SREBPs target genes[19], master transcriptional regulators of the mevalonate (MVA) and fatty acid biosynthesis pathways[29]. We observed no detectable p53 protein interactions with YAP by co-IP in tumor cells endogenously expressing a p53 DNA contact mutant (Supplementary Fig. 2a). In contrast, exogenous expression of p53 R273H led to marked elevation in HMGCR and SQLE transcript levels in parental MCF10A cells, while neither p53 R175H nor YAP WT had any effect (Fig. 1g). P53 knockdown also resulted in downregulation of MVA pathway genes, HMGCR and SQLE, in human tumor cells harboring a p53 DNA contact mutant (Fig. 1h) but was without effects in those with a p53 conformational mutant (Fig. 1h). As previously reported[19], ChIP analysis revealed p53 R273H binding to the promoter of the MVA pathway gene, HMGCR, in MCF10A cells exogenously expressing this p53 DNA contact mutant (Fig. 1i). In contrast, we observed no significant binding of p53 R175H, a hot spot conformational mutant, to this same promoter (Fig. 1i). Similar results were obtained when we analyzed human tumor lines with endogenous p53 DNA contact or conformational mutations (Supplementary Fig. 2b). All of these findings indicated that the ability of p53 DNA contact but not conformational mutants to upregulate MVA pathway gene expression, correlated with their selective ability to bind to MVA pathway promoters and to upregulate TEAD/YAP transcription whether exogenously expressed in the MCF10A model or endogenously expressed in human tumor cells.

RhoA/ROCK/actomyosin inhibitors antagonize oncogenic TEAD/YAP transcription induced by p53 DNA contact mutants

The MVA pathway utilizes acetyl-CoA to produce sterols and isoprenoids that are essential for prenylation, membrane tethering, and activation of proteins involved in cell proliferation and cell motility[20]. To gain further insights into the mechanism by which this GOF by p53 DNA contact mutations led to upregulation of TEAD/YAP transcription, we utilized Simvastatin, which inhibits HMGCR, the enzyme that catalyzes the production of MVA, and GGTI-298, which blocks the last step of protein prenylation and association to the membrane, as pharmacological probes[19-21]. Simvastatin and GGTI-298 each antagonized TEAD reporter activity in human tumors with endogenous p53 DNA contact mutation in a dose-dependent manner, consistent with the MVA pathway acting downstream of p53 DNA contact mutants to activate this transcription[19] (Supplementary Fig. 3a, b). However, both inhibitors antagonized proliferation of tumor lines with p53 DNA contact or conformational mutations and immortalized MCF10A cells to variable extents (Supplementary Fig. 3c, d). These results are in line with previous studies indicating that both inhibitors exert pleiotropic effects, among which include induction of apoptosis and inhibition of proliferation in various tumor types[30-32]. The Rho family of small GTPases is known to be activated by the MVA pathway through lipidation, which targets them to the cell membrane where they influence different aspects of cytoskeletal contractility[33,34]. There is also evidence that RhoA promotes YAP nuclear accumulation to increase TEAD/YAP transcription[21], but there are reports that other Rho family members, Cdc42 and Rac1 do so as well[35-37]. We observed that MVA treatment or exogenous RhoA expression markedly stimulated TEAD reporter activity in MCF10A cells (Fig. 2a), while Rac1 or Cdc42 had relatively little effect (Fig. 2a). As controls, exogenous expression of RhoA, Rac1 or Cdc42 increased phosphorylation specifically of their respective endogenous downstream effectors, Cofilin, PAK1/2, or PAK4/5 comparably to MVA induced phosphorylation of all three targets (Fig. 2b). Figure 2C shows that only RhoA among the Rho family members promoted actin polymerization as measured by an increased F/G actin ratio compared to that in untreated MCF10A cells (Fig. 2c). As controls, Latruculin B, an inhibitor of actin polymerization[38], and Phalloidin, which stabilizes actin polymers[39], exerted their expected negative and positive effects, respectively, on actin polymerization (Fig. 2c). Further, exogenously expressed dnRhoA, but neither dnRac1 nor dnCdc42, blocked TEAD reporter activity induced by MVA (Supplementary Fig. 4a). As controls, dnRhoA, dnRac1, and dnCdc42 each inhibited phosphorylation of their respective endogenous downstream effectors with little if any cross inhibition (Supplementary Fig. 4b). Thus, while MVA activated all three Rho family members consistent with evidence that MVA targets their membrane localization through increased post-translational lipidation[40], RhoA alone was both necessary and sufficient for upregulation of TEAD/YAP transcription.
Fig. 2

p53 DNA contact mutants increase TEAD/YAP transcription and induce the transformed phenotype through MVA pathway activation of RhoA/ROCK signaling.

a, b TEAD reporter activity (a) and immunoblots of whole-cell lysates (b) from MCF10A cells transfected with EV control untreated or treated with MVA 0.5 mM for 24 h or transfected with RhoA, Rac1, or Cdc42. Lysates probed with indicated antibodies; β-actin as loading control. c Immunoblots of F-actin and G-actin fractions extracted from MCF10A cells transfected with EV control, RhoA, Rac1, or Cdc42. F/ G-actin ratio representative of n = 2 biologically independent replicates. d Immunoblots of whole-cell lysates from MCF10A cells transfected with RhoA or stably expressing EV control, p53 R273H, or p53 R175H probed with the indicated antibodies. e Immunoblots of F-actin and G-actin fractions extracted from MCF10A cells transfected with RhoA or stably expressing EV control, p53 R273H, or p53 R175H. F/G-actin ratio shown representative of n = 2 biologically independent replicates. f–h TEAD reporter activity of p53 R273H expressing MCF10A cells treated with increasing concentrations of H-1152 (f), Latrunculin B (g) or Blebbistatin (h) for 24 h. i Immunoblots of F-actin and G-actin fractions extracted from p53 R273H MCF10A cells either untreated (Ctr) or treated with indicated concentrations of H-1152, or 1 μM Latrunculin B or 50 μM Blebbistatin for 24 h. F/G-actin ratio shown representative of n = 2 biologically independent replicates. j Representative images from n = 2 biologically independent replicates showing anchorage-independent growth of MCF10A EV control, p53 R273H or p53 cells; treated with DMSO or 1 μM H-1152. k TEAD reporter activity of hot spot p53 DNA contact mutation harboring tumor lines treated with increasing concentrations of H-1152 for 24 h. l Representative plates from n = 2 biologically independent replicates showing 2D colony formation. Cell lines treated with DMSO or increasing concentrations of H-1152. m In vitro migration measured by wound healing assay. Cell lines treated with DMSO or 1 μM H-1152 for 48 h. p values were derived using two tailed t-tests from means± SD of n = 3 biologically independent replicates. *p  <  0.05, **p  <  0.01, ***p  <  0.001, ****p  <  0.0001. Source data with actual calculated p values are provided as Source data file.

p53 DNA contact mutants increase TEAD/YAP transcription and induce the transformed phenotype through MVA pathway activation of RhoA/ROCK signaling.

a, b TEAD reporter activity (a) and immunoblots of whole-cell lysates (b) from MCF10A cells transfected with EV control untreated or treated with MVA 0.5 mM for 24 h or transfected with RhoA, Rac1, or Cdc42. Lysates probed with indicated antibodies; β-actin as loading control. c Immunoblots of F-actin and G-actin fractions extracted from MCF10A cells transfected with EV control, RhoA, Rac1, or Cdc42. F/ G-actin ratio representative of n = 2 biologically independent replicates. d Immunoblots of whole-cell lysates from MCF10A cells transfected with RhoA or stably expressing EV control, p53 R273H, or p53 R175H probed with the indicated antibodies. e Immunoblots of F-actin and G-actin fractions extracted from MCF10A cells transfected with RhoA or stably expressing EV control, p53 R273H, or p53 R175H. F/G-actin ratio shown representative of n = 2 biologically independent replicates. f–h TEAD reporter activity of p53 R273H expressing MCF10A cells treated with increasing concentrations of H-1152 (f), Latrunculin B (g) or Blebbistatin (h) for 24 h. i Immunoblots of F-actin and G-actin fractions extracted from p53 R273H MCF10A cells either untreated (Ctr) or treated with indicated concentrations of H-1152, or 1 μM Latrunculin B or 50 μM Blebbistatin for 24 h. F/G-actin ratio shown representative of n = 2 biologically independent replicates. j Representative images from n = 2 biologically independent replicates showing anchorage-independent growth of MCF10A EV control, p53 R273H or p53 cells; treated with DMSO or 1 μM H-1152. k TEAD reporter activity of hot spot p53 DNA contact mutation harboring tumor lines treated with increasing concentrations of H-1152 for 24 h. l Representative plates from n = 2 biologically independent replicates showing 2D colony formation. Cell lines treated with DMSO or increasing concentrations of H-1152. m In vitro migration measured by wound healing assay. Cell lines treated with DMSO or 1 μM H-1152 for 48 h. p values were derived using two tailed t-tests from means± SD of n = 3 biologically independent replicates. *p  <  0.05, **p  <  0.01, ***p  <  0.001, ****p  <  0.0001. Source data with actual calculated p values are provided as Source data file. Rho associated kinases 1 and 2 (ROCK1/2) are among several RhoA targets[41]. We observed that p53 R273H but not p53 R175H caused increased phosphorylation of ROCK downstream effectors, Cofilin and Myosin Light Chain-2 (MLC2), at levels comparable to those in RhoA exogenously expressing MCF10A cells (Fig. 2d). Moreover, p53 knockdown in MDA-MB-468 cells harboring a representative endogenous p53 DNA contact mutant reduced pCofilin and pMLC2 levels but had no detectable effect on phosphorylation of these same ROCK downstream effectors in HCC1395 cells harboring a p53 conformational mutant (Supplementary Fig. 4c). Of note, in MCF10A cells, p53 R273H increased actin polymerization comparably to RhoA, while p53 R175H had no effect (Fig. 2e). There are several known pharmacological inhibitors of ROCK1 and ROCK2, which signal to the cytoskeleton[42]. We observed that the ROCK1/2 dual inhibitor, H-1152, markedly antagonized TEAD reporter activity in p53 R273H MCF10A cells in a concentration dependent manner (Fig. 2f). Structurally unrelated ROCK dual inhibitors including Y-27632, GSK429286, CAY10622, and SAR407899 also antagonized this transcription (Supplementary Fig. 5a–c), further supporting that ROCK1/2 were the critical RhoA effectors of TEAD/YAP transcription. As with ROCK1/2 inhibition (Fig. 2f), Latrunculin B (Fig. 2g) or Blebbistatin, which antagonizes actomyosin contraction by inhibiting the ATPase function of myosin[43] (Fig. 2h), antagonized TEAD reporter activity in MCF10A cells expressing p53 R273H in a concentration dependent manner associated with marked reduction in the F/G actin ratio (Fig. 2i). Further, H-1152 markedly inhibited agar colony formation by p53 R273H MCF10A cells but had no effect under the same conditions on agar growth of MCF10A cells exogenously expressing p53 R175H (Fig. 2j). These results strongly argued that p53 DNA contact mutants specifically upregulated TEAD/YAP transcription and induced the transformed phenotype through MVA pathway hyperactivation of RhoA/ROCK/actomyosin signaling. H-1152 similarly inhibited elevated TEAD reporter levels in human tumors harboring different endogenous p53 DNA contact mutations (Fig. 2k) and markedly antagonized their proliferation in 2D culture in a concentration dependent manner (Fig. 2l). The specificity of this targeting was shown by the lack of any detectable growth inhibition of tumor cells with p53 conformational or null mutations at concentrations at least 5-10-fold higher (Fig. 2l). As a control, H-1152 reduced phosphorylation levels of ROCK targets, Cofilin and MLC2, similarly in both MDA-MB-468 and HCC1395 cells, confirming target engagement of the ROCK inhibitor in both cases (Supplementayr Fig. 6). Activated TEAD/YAP transcription has also been reported to increase cell motility[3], and H-1152 specifically impaired the in vitro migration of MDA-MB-468 but not HCC1395 breast tumor cells with endogenous p53 DNA contact or conformational mutations, respectively (Fig. 2m). Of note, there was no effect of H-1152 treatment on p53 protein levels in either tumor (Supplementary Fig. 6), excluding selective degradation of p53 DNA contact mutant protein as a possible mechanism. At concentrations of H-1152 and the upstream MVA pathway inhibitor, Simvastatin, at which neither alone inhibited proliferation, the combination cooperated to selectively antagonize proliferation of tumor cells with endogenous p53 DNA contact mutations (Supplementary Fig. 7), supporting that the two inhibitors biochemically target different components within the same pathway.

Recurrent Hippo pathway lesions are dependent on physiological ROCK signaling to drive oncogenic TEAD/YAP transcription

We reasoned that if RhoA/ROCK signaling were required for oncogenic TEAD/YAP transcription driven by Hippo pathway lesions, pharmacological inhibitors of RhoA/ROCK signaling might also antagonize Hippo pathway dysregulated tumors, which as yet have no targeted therapies. To investigate this possibility, we generated constitutive shRNA knockdown lines for NF2 or LATS1/2 and exogenously expressed YAP WT in a common background of wild type MCF10A cells (Supplementary Fig. 8). Each of these genetic manipulations resulted in elevated levels of TEAD reporter activity compared to control MCF10A cells (Fig. 3a). Of note, H-1152 markedly antagonized TEAD reporter activity in each case (Fig. 3a). However, whereas RhoA/ROCK mechano-signaling was upregulated in p53 R273H MCF10A cells, the levels of phosphorylation of ROCK downstream effectors, pMLC2 and pCofilin (Fig. 3b) and of actin polymerization (Fig. 3c), in response to Hippo pathway dysregulation were indistinguishable from those in control MCF10A cells. These results indicated that dysregulation of Hippo pathway function resulting from YAP exogenous overexpression or knockdown of NF2 or LATS1/2 did not affect physiological RhoA/ROCK mechano-signaling levels.
Fig. 3

ROCK inhibition antagonizes TEAD/YAP transcription and the transformed phenotype of Hippo pathway deregulated tumors.

a TEAD reporter activity of MCF10A cells expressing shScr, p53 R273H, YAP WT, NF2 shRNA (shNF2), or LATS1 and LATS2 shRNAs (shLATS1/2) either untreated (Ctr) or treated with 1 μM H-1152 for 24 h. b Western blot analysis of whole-cell lysates from MCF10A cells stably expressing EV control, p53 R273H, YAP WT, shNF2 or shLATS1/2 untreated or treated with 1 μM H-1152 for 24 h and probed with the indicated antibodies. β-actin was used as a loading control. c Western blot analyses of Triton-insoluble (F-actin) and Triton-soluble (G-actin) fractions extracted from the same cells as in (a). Fractions were probed with β-actin antibody. Ratio between F- and G-actin is shown representative of n = 2 biologically independent replicates. d Western blot analyses of Triton-insoluble (F-actin) and Triton-soluble (G-actin) fractions extracted from same cells as in (a) untreated or treated with 1 μM H-1152 for 24 h. Fractions were probed with β-actin antibody. Ratio between F- and G-actin is shown representative of n = 2 biologically independent replicates. e In vitro migration measured by wound healing assay of the indicated cell lines untreated or treated with 1 μM H-1152 for 48 h. f Representative plates from n = 2 biologically independent replicates showing anchorage-independent growth in agar of the same cells as in (a) untreated or treated with 1 μM H-1152 every 4 days for 21 days. g TEAD reporter activity of the indicated tumor lines in response to increasing concentrations of H-1152 for 24 h. h Representative plates from n = 2 biologically independent replicates showing 2D colony formation by the indicated cell lines treated with DMSO or 1 μM H-1152 every 2 days for 14 days. I In vitro migration measured by wound healing assay of the indicated cell lines treated with DMSO or 1 μM H-1152 for 48 h. p values were derived using two-tailed t-tests from means± SD of n = 3 independent experiments. *p  <  0.05, **p  <  0.01, ***p  <  0.001, ****p  <  0.0001. Source data with actual calculated p values are provided as Source data file.

ROCK inhibition antagonizes TEAD/YAP transcription and the transformed phenotype of Hippo pathway deregulated tumors.

a TEAD reporter activity of MCF10A cells expressing shScr, p53 R273H, YAP WT, NF2 shRNA (shNF2), or LATS1 and LATS2 shRNAs (shLATS1/2) either untreated (Ctr) or treated with 1 μM H-1152 for 24 h. b Western blot analysis of whole-cell lysates from MCF10A cells stably expressing EV control, p53 R273H, YAP WT, shNF2 or shLATS1/2 untreated or treated with 1 μM H-1152 for 24 h and probed with the indicated antibodies. β-actin was used as a loading control. c Western blot analyses of Triton-insoluble (F-actin) and Triton-soluble (G-actin) fractions extracted from the same cells as in (a). Fractions were probed with β-actin antibody. Ratio between F- and G-actin is shown representative of n = 2 biologically independent replicates. d Western blot analyses of Triton-insoluble (F-actin) and Triton-soluble (G-actin) fractions extracted from same cells as in (a) untreated or treated with 1 μM H-1152 for 24 h. Fractions were probed with β-actin antibody. Ratio between F- and G-actin is shown representative of n = 2 biologically independent replicates. e In vitro migration measured by wound healing assay of the indicated cell lines untreated or treated with 1 μM H-1152 for 48 h. f Representative plates from n = 2 biologically independent replicates showing anchorage-independent growth in agar of the same cells as in (a) untreated or treated with 1 μM H-1152 every 4 days for 21 days. g TEAD reporter activity of the indicated tumor lines in response to increasing concentrations of H-1152 for 24 h. h Representative plates from n = 2 biologically independent replicates showing 2D colony formation by the indicated cell lines treated with DMSO or 1 μM H-1152 every 2 days for 14 days. I In vitro migration measured by wound healing assay of the indicated cell lines treated with DMSO or 1 μM H-1152 for 48 h. p values were derived using two-tailed t-tests from means± SD of n = 3 independent experiments. *p  <  0.05, **p  <  0.01, ***p  <  0.001, ****p  <  0.0001. Source data with actual calculated p values are provided as Source data file. H-1152 treatment reduced basal phosphorylation levels of ROCK downstream effectors (Fig. 3b) as well as basal levels of actin polymerization in each case (Fig. 3d). H-1152 treatment also markedly antagonized both motility (Fig. 3e) and agar colony formation by MCF10A cells expressing YAP WT, shNF2 or shLATS1/2 (Fig. 3f) but had no effect on agar growth of MCF10A cells expressing HRAS V12G (Fig. 3f), an oncogene that does not upregulate TEAD/YAP transcription[25]. All of these findings demonstrated the dependence of both upregulated TEAD/YAP transcription and the transformed phenotype induced by Hippo pathway tumor aberrations on physiological ROCK signaling as well as the ability of ROCK inhibitors to selectively antagonize these effects. The ability of ROCK inhibitors to antagonize TEAD/YAP transcription and agar growth in MCF10A cells expressing shNF2 or shLATS1/2 suggested that YAP phosphorylation by LATS1/2 was not required. In fact, TEAD reporter activity in MCF10A cells expressing YAP 5SA, which lacks LATS inhibitory phosphorylation sites[44] was completely resistant to serum withdrawal, a known Hippo pathway activator[45] (Supplementary Fig 9a). In contrast, H-1152 antagonized TEAD reporter activity (Supplementary Fig. 9b) as well as both motility (Supplementary Fig. 9c) and agar colony formation by these same cells (Supplementary Fig. 9d). Of note, serum withdrawal increased endogenous YAP S127 phosphorylation as previously reported[44], while neither ROCK inhibition nor p53 R273H upregulation of RhoA/ROCK mechano-signaling affected phosphorylation of this major LATS site (Supplementary Fig. 9e). These results indicated biochemically that ROCK inhibition was independent of LATS or any other kinase that phosphorylated this site. In WT MCF10A parental cells, serum withdrawal resulted in greater than 75% reduction in TEAD reporter activity within 4 h, while H-1152 treatment comparably reduced reporter activity only by 24 h (Supplementary Fig. 9f). It is well documented that Hippo pathway activation causes YAP to shift from the nucleus to the cytosol[4]. Confocal microscopy revealed that serum withdrawal caused this marked shift within 4 h, while H-1152 treatment did not detectably alter the YAP nuclear-cytosolic ratio even by 48 h (Supplementary Fig. 9g). In the presence of the ROCK inhibitor, Hippo pathway activation shifted YAP to the cytosol indicating its dominance in inducing YAP cytoplasmic re-localization (Supplementary Fig. 9g). Of note, under conditions in which serum withdrawal or ROCK inhibition antagonized TEAD reporter activity, each caused disruption of the TEAD-YAP complex as measured by co-immunoprecipitation of YAP with anti-panTEAD (Supplementary Fig. 9h). All of these findings established that Hippo pathway activation and ROCK inhibition antagonized TEAD/YAP transcription in WT cells by disruption of TEAD/YAP interactions through different mechanisms. We next tested the ability of H-1152 to antagonize elevated TEAD/YAP transcription in human tumors with endogenous lesions in Hippo pathway core components, NF2 and/or LATS1/2 (H2052, H2373, MSTO-211H mesotheliomas, MDA-MB-157 breast carcinoma and Snu387 hepatocellular carcinoma), YAP amplification (SF268 glioma) or both Hippo pathway and p53 DNA contact mutations (MDA-MB-231 breast carcinoma). In each case, these tumors were dependent on TEAD/YAP transcriptional activity for proliferation (Supplementary Fig. 10a, b and[25]). Moreover, the ROCK inhibitor markedly antagonized TEAD reporter activity (Fig. 3g), 2D colony formation (Fig. 3h), and in vitro migration of human tumors with endogenous lesions in the Hippo pathway (Fig. 3i) at a concentration (1 μM) that also selectively antagonized human tumors with p53 DNA contact mutations (see Fig. 2). That this growth inhibition was not dependent on YAP phosphorylation by LATS- was confirmed by the absence of any alteration in pYAPS127 levels induced by H-1152 treatment of these tumors (Supplementary Fig. 11).

ROCK1 is the ROCK isoform that drives oncogenic TEAD/YAP transcription

The specific knockout of ROCK1 or ROCK2 is lethal at different stages of mouse development, although both are thought to have similar substrates[42,46]. However, there is also evidence for their having different biochemical functions[47]. We observed that shRNA knockdown of ROCK1 inhibited TEAD reporter activity in NF2 mutant mesothelioma H2373 cells (Fig. 4a) and NF2 and p53 DNA contact mutant MDA-MB-231 cells (Fig. 4b), whereas ROCK2 knockdown lacked these effects (Fig. 4a, b and Supplementary Fig. 12a) As controls, expression levels of ROCK1 and ROCK2 were similar in each of these cells (Supplementary Fig. 12b). Similarly, while the ROCK1/2 dual inhibitor, H-1152, potently inhibited the TEAD reporter in both tumor lines, KD025, a selective ROCK2 inhibitor[48], failed to do so even at much higher concentrations (Fig. 4c, d). Furthermore, shROCK1 and H-1152 but neither shROCK2 nor KD025 decreased the F/G actin ratio (Fig. 4e, f). These results indicated that ROCK1 was the ROCK isoform responsible for upregulating both actomyosin cytoskeletal contractility and TEAD/YAP transcription. Finally, shROCK1 but neither shROCK2 nor KD025 antagonized the proliferation of H2373 cells and MDA-MB-231 cells with endogenous NF2 or NF2 and p53 DNA contact mutations, respectively (Fig. 4g, h). Under the same conditions, none of these interventions altered colony formation by WT p53 MCF10A or HCC1395, which harbors a p53 conformational mutant (Fig. 4g, h). Mining of RNAseq data of patient tumor samples with endogenous p53 DNA contact or conformational mutations revealed no statistically significant differences in ROCK1 or ROCK2 expression levels in a TCGA dataset of triple-negative breast cancer (TNBC)s, a subtype with a high frequency of p53 missense mutations[49](Supplementary Fig. 13a). Similarly, ROCK1 and ROCK2 levels, respectively, were comparable in tumor samples with Hippo pathway mutations or wild type for Hippo pathway components in a TCGA mesothelioma dataset, in which mutations in Hippo pathway core components genes are commonly found[50] (Supplementary Fig. 13b). Thus, all of these findings established that ROCK1/actomyosin signaling itself rather than differences at the level of ROCK RNA expression was the critical effector of oncogenic TEAD/YAP transcription in tumors with recurrent p53 DNA contact and/or Hippo pathway lesions.
Fig. 4

ROCK1 signaling through the actin cytoskeleton is required for TEAD/YAP transcriptional activation and the transformed phenotype of human tumors with p53 DNA contact and/or Hippo pathway mutations.

a, b TEAD reporter activity of H2373 cells (a) or MDA-MB-231 cells (b) stably expressing shScr, shROCK1, shROCK2 or shROCK1/2. c, d TEAD reporter activity of H2373 cells (c) or MDA-MB-231 cells (d) untreated or treated with increasing concentrations of the ROCK dual inhibitor, H-1152 or the ROCK2 specific inhibitor, KD025 for 24 h. e, f Western blot analyses of Triton-insoluble (F-actin) and Triton-soluble (G-actin) fractions extracted from the indicated tumor cells stably expressing shScr, shROCK1, shROCK2, shROCK1/2 or treated with the indicated inhibitors for 24 h. Fractions were probed with β-actin antibody. Ratio between F- and G-actin is shown representative of n = 2 biologically independent replicates. g Representative plates from n = 2 biologically independent replicates showing 2D colony formation by the indicated cell lines stably expressing shScr, shROCK1, shROCK2, shROCK1/2 for 14 days. h Representative plates from n = 2 biologically independent replicates showing 2D colony formation by the indicated cell lines treated with DMSO or increasing concentrations of KD025 every 2 days for 14 days. p values were derived using two-tailed t-tests from means± SD of n = 3 independent experiments. *p  <  0.05, **p  <  0.01, ***p  <  0.001, ****p  <  0.0001. Source data with actual calculated p values are provided as Source data file.

ROCK1 signaling through the actin cytoskeleton is required for TEAD/YAP transcriptional activation and the transformed phenotype of human tumors with p53 DNA contact and/or Hippo pathway mutations.

a, b TEAD reporter activity of H2373 cells (a) or MDA-MB-231 cells (b) stably expressing shScr, shROCK1, shROCK2 or shROCK1/2. c, d TEAD reporter activity of H2373 cells (c) or MDA-MB-231 cells (d) untreated or treated with increasing concentrations of the ROCK dual inhibitor, H-1152 or the ROCK2 specific inhibitor, KD025 for 24 h. e, f Western blot analyses of Triton-insoluble (F-actin) and Triton-soluble (G-actin) fractions extracted from the indicated tumor cells stably expressing shScr, shROCK1, shROCK2, shROCK1/2 or treated with the indicated inhibitors for 24 h. Fractions were probed with β-actin antibody. Ratio between F- and G-actin is shown representative of n = 2 biologically independent replicates. g Representative plates from n = 2 biologically independent replicates showing 2D colony formation by the indicated cell lines stably expressing shScr, shROCK1, shROCK2, shROCK1/2 for 14 days. h Representative plates from n = 2 biologically independent replicates showing 2D colony formation by the indicated cell lines treated with DMSO or increasing concentrations of KD025 every 2 days for 14 days. p values were derived using two-tailed t-tests from means± SD of n = 3 independent experiments. *p  <  0.05, **p  <  0.01, ***p  <  0.001, ****p  <  0.0001. Source data with actual calculated p values are provided as Source data file.

ROCK inhibitors selectively antagonize oncogenic TEAD/YAP transcription in vivo

As an in vivo test of the ability of ROCK inhibitors to selectively antagonize TEAD/YAP activated tumors, we utilized mouse xenograft models. H-1152 markedly inhibited the growth in vivo of TEAD/YAP-driven MDA-MB-468 and MDA-MB-231 breast tumors harboring endogenous p53 DNA contact or both NF2 and p53 DNA contact mutations, respectively (Fig. 5a). Under the same conditions, the ROCK inhibitor had little if any effect on in vivo growth of HCC1395 breast tumor cells harboring a p53 conformational mutant and lacking detectably elevated TEAD/YAP transcription (Fig. 5b). Tumors responsive to H-1152 inhibition exhibited reduced Ki67 staining, a marker of cell proliferation, but showed no obvious increase in Caspase 3, a marker of apoptosis (Supplementary Fig. 14). The absence of adverse effects of H-1152 treatment on body weight indicated that targeting of TEAD/YAP transcriptionally activated human tumors by the ROCK inhibitor was without obvious in vivo toxicity in this pre-clinical in vivo model (Fig. 5c). We also monitored ROCK signaling inhibition in vivo in response to H-1152 treatment and observed reduced pCofilin immunostaining in tumor sections (Fig. 5d).
Fig. 5

ROCK inhibition selectively antagonizes in vivo growth of TEAD/YAP driven human tumors.

a–c Tumor cell growth following orthotopic inoculation in immunocompromised mice of MDA-MB-468, MDA-MB-231 (a) or HCC1395 cells (b) followed by daily dosing of H-1152 (25 mg/kg) after tumors reached a volume of 100 mm3. n = 5 mice per group were used. p values are indicated in the figure calculated using two tailed t-test for n = 5 biologically independent mice per group. Body weight of each mouse at the beginning and at the end of the treatment is also shown (c). d Immunostaining of tumor sections from (a, b) with antibodies directed against pCofilin as described in the Methods. Scale bar: 100 µM. n = 5 biologically independent mice per group. e Model depicting inhibition of TEAD/YAP transcription in physiological conditions, activated by p53 DNA contact mutations or Hippo pathway alterations by ROCK inhibitiors.*p  <  0.05, **p  <  0.01. Source data with actual calculated p values are provided as Source data file.

ROCK inhibition selectively antagonizes in vivo growth of TEAD/YAP driven human tumors.

a–c Tumor cell growth following orthotopic inoculation in immunocompromised mice of MDA-MB-468, MDA-MB-231 (a) or HCC1395 cells (b) followed by daily dosing of H-1152 (25 mg/kg) after tumors reached a volume of 100 mm3. n = 5 mice per group were used. p values are indicated in the figure calculated using two tailed t-test for n = 5 biologically independent mice per group. Body weight of each mouse at the beginning and at the end of the treatment is also shown (c). d Immunostaining of tumor sections from (a, b) with antibodies directed against pCofilin as described in the Methods. Scale bar: 100 µM. n = 5 biologically independent mice per group. e Model depicting inhibition of TEAD/YAP transcription in physiological conditions, activated by p53 DNA contact mutations or Hippo pathway alterations by ROCK inhibitiors.*p  <  0.05, **p  <  0.01. Source data with actual calculated p values are provided as Source data file.

Tumor samples with p53 DNA contact mutations or Hippo pathway aberrations exhibit a TEAD/YAP transcriptional signature

We performed a gene set enrichment analysis (GSEA)[51] searching for statistical associations between p53 DNA contact mutations or Hippo pathway mutations and TEAD/YAP transcriptional activation in clinical tumor samples. For this purpose, we applied a well-established TEAD/YAP conserved gene signature[52] to a TCGA RNAseq datasets of TNBCs and mesothelioma. By GSEA, there was a significant TEAD/YAP conserved signature enrichment in TNBCs with p53 DNA contact mutations compared to those with p53 conformational mutations (Supplementary Fig. 15a), as well as in mesothelioma patients with Hippo pathway mutations (Supplementary Fig. 15b).

Discussion

Cancer driver genes including those encoding autocrine growth factors, their receptors, and critical downstream effectors such as Ras and Raf share a common signaling pathway to confer a growth advantage[2]. In some cases, recurrent driver mutations can either activate or cause loss of function of cancer genes within a common pathway as is the case with Wnt or p53 signaling[53,54]. The present studies establish a paradigm in which a cancer driver mutation in a given pathway indirectly causes an imbalance in normal homeostasis in a different pathway to drive oncogenesis. We showed that this was the case for p53 DNA contact mutations, which through a gain of function that upregulates the MVA pathway, indirectly hyperactivate RhoA/ROCK1/actomyosin mechano-signaling to drive oncogenic TEAD/YAP transcription. p53 knockdown antagonized upregulated TEAD/YAP transcription, cell proliferation and motility in human tumors with this class of endogenous p53 missense mutations. Moreover, dnTEAD4 or pharmacological inhibitors of RhoA/ROCK1 mechano-signaling antagonized both upregulated TEAD/YAP transcription and the transformed phenotype in human tumors harboring these p53 missense mutations or in MCF10A cells exogenously expressing such mutants. While hot spot p53 conformational mutants also induced the transformed phenotype, and knockdown of their endogenous expression antagonized tumor cell proliferation, these missense mutants did not activate TEAD/YAP transcription in tumors or when exogenously expressed in MCF10A cells and thus, must utilize a different GOF mechanism(s). Our findings that a specific class of p53 missense mutations drives oncogenic TEAD/YAP transcription provides a PCR based molecular approach for their detection in tumor tissues or liquid biopsy. Mutations analogous to those that activate Ras oncogenes confer transforming properties to Rho family members in culture[23], but such mutations are very rare in human tumors[55]. Recurrent RhoA mutations at other sites have been identified at high frequency in a subset of human gastric carcinomas[56]. However, these mutations have recently been reported to exert biological effects primarily through activation of FAK signaling[57]. Thus, hyperactivation of wild type RhoA mechano-signaling and upregulation of TEAD/YAP transcription by p53 DNA contact mutations appears to be the most frequent mechanism activating RhoA oncogenic function in human malignancies. Our present studies support a model in which RhoA mechano-signaling and the Hippo tumor suppressor pathways crosstalk to counteract one another in regulating physiological levels of TEAD/YAP transcription (Fig. 5e). In MCF10A breast epithelial cells with physiological TEAD/YAP transcription, hyperactivation of RhoA/ROCK signaling by exogenous expression of p53 DNA contact mutants overcame physiological Hippo pathway negative regulation to induce transforming levels of TEAD/YAP transcription. In contrast, NF2 or LATS1/2 knockdown or YAP overexpression, which modeled recurrent human tumor lesions in the Hippo pathway[3], altered this homeostatic balance in the MCF10A model without detectably altering physiological RhoA mechano-signaling. Yet, the imbalance created by Hippo pathway aberrations resulted in increased TEAD/YAP transcription to levels sufficient to induce the transformed phenotype (Fig. 5e). Our findings that small molecule inhibitors or shRNAs directed against different components of the RhoA mechano-signaling pathway effectively antagonized TEAD/YAP transcription and the transformed phenotype induced by Hippo pathway aberrations argue strongly that physiological RhoA mechano-signaling levels were required as well (Fig. 5e). Moreover, both genetic and pharmacological evidence established that ROCK1 was the isoform specifically responsible for signaling to the actomyosin cytoskeleton to upregulate TEAD/YAP transcription and the transformed phenotype in human tumors with Hippo pathway lesions or p53 DNA contact mutations. In the MCF10A model, we showed that Hippo pathway activation induced by serum withdrawal led to YAP phosphorylation and its rapid translocation to the cytosol associated with concomitant reduction in TEAD/YAP transcription and loss of TEAD/YAP interactions. RhoA/ROCK mechano-signaling inhibition antagonized TEAD/YAP transcription more slowly with YAP nuclear retention in the absence of detectable alteration in YAP phosphorylation but also with loss of TEAD/YAP interactions. Molecules including angiomotins[58], NF2[59,60], and certain members of the SWI/SNF complex[61] have been reported to bind YAP or F-actin to free YAP to serve as a transcription co-activator of TEAD[4] or to alter YAP nucleocytoplasmic shuttling[4,62]. Further exploration of RhoA/ROCK mechano-signaling could aid in elucidating how YAP activity is regulated by this signaling and potentially identify therapeutic targets in tumors with p53 DNA contact mutations or Hippo pathway aberrations driven by hyperactive RhoA mechano-signaling or dependent on physiological levels of this signaling, respectively, Identifying cancer drivers that can be pharmacologically targeted is critical for precision oncology. Generally, this has involved the application of small molecule inhibitors directed against either the mutated component within an oncogenic signaling pathway or regulators/effectors in the same pathway. In this regard, Freed-Pastor et al. reported that statins inhibited the growth of tumor cells harboring a p53 missense mutant that increased SREBP target gene expression[19]. However, a recent report indicates that statin induced GGPP depletion blocks micropinocytosis leading to amino acid starvation in cells with various oncogenic aberrations[63]. We observed that statins or GGTI inhibitors at high concentrations required to antagonize the growth of tumor cells with endogenous p53 DNA contact mutations were growth inhibitory to variable extents for tumor cells with p53 conformational mutations as well. A recent study reported that HDAC6/Hsp90 dependent accumulation of p53 missense mutants is sustained by RhoA geranylgeranylation downstream of the MVA pathway and that statins or GGTI inhibitors increased the degradation of these mutants[64]. We did not observe any detectable effects of ROCK inhibitors on P53 protein levels in tumors with endogenous p53 DNA contact or conformational mutations, excluding this as either the mechanism of action of ROCK inhibitors or the basis for the selective sensitivity of tumors with oncogenic TEAD/YAP transcription due to p53 DNA contact mutations. The fact that statins and GGTI inhibitors act upstream of RhoA/ROCK signaling and, thus, have more widespread biochemical effects also appears likely to explain their relative lack of specificity compared to ROCK inhibitors in tumor growth inhibition. As yet, there are no clinically approved targeted therapies for tumors driven by elevated TEAD/YAP transcription[10], although agents including verteporfins[65] and tankyrase inhibitors[25,66] have been reported to antagonize this transcription. Efforts to target TEAD/YAP interactions or destabilize TEAD[67,68], also offer possible therapeutic strategies for TEAD/YAP activated tumors but are at an early stage. Anticancer therapies targeting p53 missense mutants by inducing a more wild type-like conformation, are being pursued as well[69].ROCK inhibitors are presently in the clinic and approved for certain non-cancer indications[70]. In our studies, ROCK inhibitors with different structures and relative activities against other kinases antagonized upregulated TEAD/YAP transcription. Thus, any potential toxicity of these agents would very likely not be due to off target effects. Potential on target effects such as hypotension were observed in a hypertensive rat model[71]. In the mouse, we did not observe any obvious toxicity at a ROCK inhibitor concentration that selectively antagonized the growth of TEAD/YAP driven tumors, providing a therapeutic window for clinical application of ROCK inhibitors as oncology agents[55]. There are also reports that ROCK inhibitors may affect tumor immune functions[72,73]. Thus, our present findings argue strongly for continued efforts to exploit the potential of ROCK inhibitors for selective targeting of human malignancies driven by oncogenic TEAD/YAP transcription.

Methods

Cell culture and treatments

HEK293T, MDA-MB-231, MDA-MB-468, MDA-MB-157, U373MG, U251MG, SK-LMS-1, U138MG, LN229, M059J, M059K, and BT-549 cells were grown in Dulbecco’s Modified Eagle’s Medium (DMEM) (Sigma-Aldrich, St. Louis, MO) supplemented with 10% fetal bovine serum (FBS) (Sigma-Aldrich), 50 units/ml of penicillin/streptomycin. H2052, H2373, MSTO-211H, Snu387, PC-9, HCC193, SF295, SK-BR-3, HCC1395, HCC1954, H1299, HCC1937 and HCC1806 cells were grown in RPMI-1640 (Thermo Fisher Scientific, Waltham, MA) medium supplemented with 10% FBS and 50 units/ml of penicillin/streptomycin. SK-MEL-2 cells were grown in Eagle’s Minimum Essential Medium (MEM) (Sigma-Aldrich) supplemented with 1% non-essential amino acids (NEAA), 10% Fetal Bovine Serum (FBS) (Sigma-Aldrich), 50 units/ml of penicillin/streptomycin. MCF10A cells were grown in DMEM/F12 medium supplemented with, 5% horse serum, 10 μg/ml insulin, 100 ng/ml cholera toxin, 0.5 mg/ml hydrocortisone, 20 ng/ml EGF, and 50 units/ml of penicillin/streptomycin. All cells were cultured at 37 °C and 90% humidity in a 5% CO2 incubator. DMSO (0.1%) was used as a control in all experiments in which chemicals were solubilized in DMSO. Latrunculin B (Sigma, L5288) and Blebbistatin (Cayman Chemical, 13013). ROCK inhibitors were as follows: SAR407899 (Cayman Chemical, 21717) Y-27632 (Tocris Bioscience, 1254), GSK429286A (Cayman Chemical, 15262), CAY10622 (Cayman Chemical, 13687) and KD025 (Selleckchem, S7936). H-1152 (Tocris Bioscience, 2414) was dissolved in water. All the other inhibitors were dissolved in DMSO to yield 10 mM stock, and treatments were as indicated.

Synthesis of H-1152

To a stirring solution of tert-butyl (S)-3-methyl-1,4-diazepane-1-carboxylate (443 mg, 2.0 mmol, 1 eq.) and potassium carbonate (828 mg, 3.0 mmol, 3 eq.) in acetonitrile (30 mL) was added 4-methylisoquinoline-5-sulfonyl chloride (500 mg, 2.0 mmol, 1 eq.) at 0oC. The resulting mixture was stirred overnight at room temperature. The progress of the reaction was monitored by TLC. After removal of the solvent, the residue was purified by flash chromatography on silica gel with eluent (MeOH/CH2Cl2, 0–10%) to yield desired the sulfonamide as white solid. To a stirring solution of the above solid in methanol (20 mL) was added hydrogen chloride in dioxane (5 mL, 4.0 M) at 0 °C and the resulting mixture was stirred overnight at room temperature. The mixture was concentrated and the resulting crystals were harvested in diethyl ether to provide the desired product H-1152 di-HCl salt as white solid (380 mg, 58% yield over two steps). Purity: >95% (determined by 1H NMR). 1H NMR (600 MHz, MeOD) δ 9.79 (s, 1H), 8.74 (d, J = 8.1 Hz, 1H), 8.67 (s, 1H), 8.58 (d, J = 7.1 Hz, 1H), 8.13 (t, J = 7.8 Hz, 1H), 4.63–4.60 (m, 1H), 3.86–3.81 (m, 2H), 3.67 (dd, J = 14.2, 4.6 Hz, 1H), 3.53 (d, J = 13.8 Hz, 1H), 3.43–3.38 (m, 2H), 3.27 (s, 3H), 2.30–2.28 (m, 1H), 2.18–2.15 (m, 1H), 1.34 (d, J = 6.6 Hz, 3H). 1H NMR (600 MHz, CDCl3) δ 9.17 (s, 1H), 8.57 (s, 1H), 8.20 (d, J = 7.7 Hz, 1H), 8.08 (d, J = 7.2 Hz, 1H), 7.63 (s, 1H), 4.39 (s, 1H), 3.87 (d, J = 14.6 Hz, 1H), 3.68 (d, J = 15.4 Hz, 1H), 3.55 (s, 2H), 3.48 (d, J = 7.1 Hz, 1H), 3.33 (s, 1H), 3.03 (s, 3H), 2.44–2.40 (m, 2H), 1.51 (d, J = 6.9 Hz, 3H). 1H NMR (600 MHz, DMSO) δ 9.55 (s, 1H), 8.65 (s, 1H), 8.57 (d, J = 8.0 Hz, 1H), 8.26 (d, J = 7.3 Hz, 1H), 7.93 (dd, J = 14.5, 6.8 Hz, 1H), 4.46 (s, 1H), 4.25 (s, 1H), 3.79–3.72 (m, 1H), 3.64–3.61 (m, 1H), 3.56–3.50 (m, 1H), 3.39–3.22 (m, 3H), 3.04 (s, 3H), 2.11–1.99 (m, 2H), 1.24 (d, J = 6.5 Hz, 3H). 13C NMR (151 MHz, DMSO) δ 147.89, 138.70, 136.96, 136.22, 133.81, 133.56, 130.91, 129.70, 127.93, 51.85, 50.04, 45.48, 43.97, 39.79, 39.66, 39.52, 39.38, 39.24, 39.10, 38.96, 38.60, 27.04, 21.19, 16.64. HRMS (m/z) for C16H22N3O2S+ [M + H]+ calculated 320.1427; found: 320.1428. As indicated above, H-1152 synthesized by us was similar in purity to H-1152 from Tocris. Both showed comparable potency in antagonizing TEAD reporter activity (Supplementary Fig. 16a) and in selectively inhibiting colony formation by MDA-MB-231 containing an endogenous p53R273H DNA contact mutation, while neither detectably inhibited the proliferation of MCF10A immortalized breast epithelial cells containing wtp53 (Supplementary Fig. 16b). We, therefore, utilized H-1152 synthesized by us in the experiments reported here.

Constructs and lentiviral or retroviral transduction

pQCXIH-Myc-YAP was purchased from Addgene (#33091) and pQCXIH vector control was generated by re-ligating backbone after removal of YAP. dnTEAD4 was cloned from pSPORT6 vector (Dharmacon Lafayette, CO, USA) into NSPI-CMV-MCS lentiviral vector using Nhe1 and BamH1 restriction site containing primers: Forward: TAAGCAGCTAGCGCCACCTTGGAGGGCACGGCCGGCAC and Reverse: ACTATGGGATCCTCA TTCTTTCACCAGCCTGTGGATGTGGTGCTGAGC. Site directed mutagenesis was used to generate Y429H (TAC— > CAC) dominant negative (dn) mutation in TEAD4 gene[25]. TEAD reporter plasmid was generated with 10 copies of GT-IIC (GTGGAATGT) motif cloned at ClaI and NheI restriction sites within NV-luciferase vector[25]. Shp53.1 and shp53.2 were cloned in the pLKO.1 backbone with sequences as followed: shp53.1: GTCCAGATGAAGCTCCCAGAA; shp53.2 CACCATCCACTACAACTACAT; shScr CCTAAGGTTAAGTCGCCCTCG. All the other shRNAs were obtained from Sigma (MISSION® shRNA library). Mutant p53 constructs containing a substitution of single amino acids, were generated by PCR site-directed mutagenesis using the QuickChange® Lightning Site-Directed Mutagenesis Kit (Agilent Technology, Agilent Technology, Milano, Italy) with WT-p53 cDNA as template as previously described[74]. Primers were as follows: R175H (g524a):Forward: ATGGTGGGGGCAGTGCCTCACAACCTC, Reverse GAGGTTGTGAGGCACTGCCCCCACCAT; G245S (g733a): Forward CCTCCGGTTCATGCTGCCCATGCAGGAAC, Reverse GTTCCTGCATGGGCAGCATGAACCGGAGG; R248Q (g743a): Forward GAGGATGGGCCTCTGGTTCATGCCGCC, Reverse GGCGGCATGAACCAGAGGCCCATCCTC; R273H (g818a): Forward AGGACAGGCACAAACATGCACCTCAAAGCTGTTC, Reverse GAACAGCTTTGAGGTGCATGTTTGTGCCTGTCCTG; R273C (c817t) Forward 5′-GGACAGGCACAAACACACACCTCAAAGCTGTTC-3′, Reverse 5′-GAACAGCTTTGAGGTGTGTGTTTGTGCCTGTCC-3′; R248Q (g743a) Forward: 5′-GAGGATGGGCCTCTGGTTCATGCCGCC-3′, Reverse: 5′-GGCGGCATGAACCAGAGGCCCATCCTC-3′; S241F (c722t) Forward: 5′-CCGCCCATGCAGAAACTGTTACACATGTAGTTGTA-3′, Reverse: 5′-TACAACTACATGTGTAACAGTTTCTGCATGGGCGG-3′. All constructs were verified by DNA sequencing. To generate retroviral stocks, HEK293T cells were co-transfected with the appropriate retroviral expression vector and pCL-ampho packaging plasmid. For lentiviral stocks, HEK293T cells were co-transfected with the appropriate lentiviral expression vector, pCMVΔR8.74 packaging vector and pMD2 VSVG envelope vector. Titers for each virus stock were determined by colony formation following marker selection of a common assay cell, HT1080, making it possible to compare results using similar amounts of virus in different experiments. Retroviral and lentiviral infections were carried out on all cell lines in the presence of 8 μg/ml polybrene (Sigma). Cells were selected for antibiotic resistance by treatment with 2 μg/ml puromycin or 100 μg/ml hygromycin) and expanded to mass populations.

Reporter assays

Cells were plated at 2 × 104 cells/well in 24 well plates and treated or genetically manipulated as described. Firefly and renilla luciferase activities were assayed with the dual luciferase assay system (Promega, Madison WI, USA), as directed, and firefly luciferase activity was normalized to renilla luciferase activity. Firefly and renilla luminescence were measured with a TD-20e Luminometer (Turner).

Anchorage-independent growth assay

Growth in soft agar was determined by seeding 2.5 × 103 MCF10A cells in 1 ml of growth media containing 0.3% agar (BD 214050) on top of 1 ml of 0.48% agar in 35-mm dishes. Cells were fed every 4 days for 3 weeks with 0.2 mL of growth medium. Colonies were stained with 1% crystal violet in ethanol and experiments were conducted in triplicate with representative results shown.

RNA extraction and cDNA synthesis

Total RNA was extracted from cells using QIAshredder (Qiagen, Valencia, CA, USA) and RNeasy Mini kit (Qiagen) according to the manufacturer’s instructions. First-Strand cDNA synthesis was performed using Superscript II reverse transcriptase (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions.

Quantitative real-time PCR analysis

Quantitative PCR was carried out using the ViiA™ 7 Real-Time PCR System (Life Technologies) and the FastStart SYBR Green Master mix (Roche, 04673492001). PCR was performed in 384 well plates with 10 µl under the following conditions: 95 °C for 15 min, followed by 40 cycles of 94 °C for 15 s, 61 °C for 30 s, and 72 °C for 30 s. Specificity was verified by a dissociation curve. Results were analyzed with ViiA7 RUO software (Life Technologies). Gene expression levels were normalized to GAPDH expression. Primer sequences are provided in Supplementary Table 2.

Cell proliferation assay

For clonogenic assays, cells were plated in triplicate at 1 × 103 cells in 6-well plates. Cells were treated or genetically manipulated as described. After 10 to 14 days, colonies were stained with 1% crystal violet in ethanol and photographed.

Western blot analysis

Cells were harvested in EBC lysis buffer (50 mM Tris-HCl at pH 7.5, 150 mM NaCl, 5 mM EDTA, 0.5% NP-40), supplemented with Complete Mini Protease and Phosphatase Inhibitor Cocktails (Roche, Indianapolis, IN, USA). Cells were lysed and 30–80 µg protein subjected to SDS-PAGE followed by transfer onto an Immobilon-FL PVDF membrane (Millipore, Billerica, MA, USA) and incubation with the indicated antibodies. Detection was carried out with an Odyssey Infrared Imaging System (LI-COR Biosciences, Lincoln, NE, USA) with IR dye-tagged secondary antibodies (Alexa Fluor 750 goat anti rabbit IgG; Alexa Fluor 750 goat anti mouse IgG, Alexa Fluor 680 goat anti rabbit IgG, Alexa Fluor 680 goat anti mouse IgG from Invitrogen, 1:10,000 dilution). The following antibodies were utilized: p53 (1801; Mount Sinai School of Medicine Hybridoma Center, New York, NY, USA, 1:1000 dilution), YAP, CTGF, MYC, MLC2, RhoA, pan-Rac, Cdc42, ROCK1, ROCK2, GAPDH (Santa Cruz, Dallas, TX, USA, 1:1000 dilution), p-YAP, p-Cofilin, p-MLC2, Cofilin, pPAK1/2, pPAK4/5, PAK2, PAK4, (Cell Signaling, Danvers, MA, USA, 1:1000 dilution), TEAD4, (Thermo Scientific, Waltham, MA, USA, 1:1000 dilution), mouse anti-α-tubulin (1:10,000 dilution), mouse anti-β-actin (Sigma, Saint Louis, MO, USA, 1:10,000 dilution).

Immunoprecipitation analysis

Cells were harvested in RIPA lysis buffer (50 mM Tris-Cl; pH 8.0, 5 mM EDTA, 1% Triton X-100, 0.1% sodium deoxycholate, 0.1% SDS, 150 mM NaCl) supplemented with Complete Mini Protease and Phosphotase Inhibitor Cocktails. 800 μg proteins were incubated with 10 μg of antibody overnight at 4 °C. Anti-mouse or anti-rabbit IgG (Santa Cruz, Dallas, TX, USA) was used as a negative control. The following antibodies were utilized: p53 (1801; Mount Sinai School of Medicine Hybridoma Center, New York, NY, USA), YAP (Santa Cruz, Dallas, TX, USA) TEAD4 and pan-TEAD (Cell Signaling, Danvers, MA, USA). Immunoprecipitated complexes were captured by 2 h incubation at 4 °C with Dynabeads Protein A/G B (Invitrogen, Carlsbad, CA, USA), followed by three washes in lysis buffer. Immunoprecipitated complexes were eluted by boiling for 5 min with Laemmli buffer (150 mM Tris-Cl; pH 6.8, 20% glycerol, 4% SDS, 0.002% bromophenol blue, 2% 2-mercaptoethanol) with 10% of the total lysates run on the same gel for comparative immunoblot analysis.

Chromatin immunoprecipitation

Around 5 × 106 cells were collected by centrifugation, crosslinked for 10 min at room temperature with 1% formaldehyde in PBS and neutralized by the addition of 125 mM glycine for 5 min. Cells were washed twice in PBS and lysed with 0.6 ml SDS lysis buffer (1% SDS, 10 mM EDTA (pH 8.0), 50 mM Tris (pH 8.0)) supplemented with protease inhibitors (Roche; 04693124001). Samples were then sonicated to generate an average of 500 bp DNA fragments using Bioruptor (Diagenode, Denville, NJ, USA) on high setting (30 s on and off), and insoluble material was removed by centrifugation. A total of 200 μg of cleared samples were diluted 10-fold in ChIP dilution buffer (16.7 mM Tris (pH 8.0), 1.2 mM EDTA (pH 8.0), 167 mM NaCl, 1.1% Triton X-100) and incubated with 10 μg of p53 (DO-1) monoclonal antibody (Santa Cruz; sc-126) or 10 μg of normal IgG (Santa Cruz; sc-2025) overnight at 4 °C. In all, 20 μg of samples without primary antibody were saved as 10% input controls. Immunoprecipitated complexes were captured by 2 h incubation at 4 °C with Dynabeads Protein A (Invitrogen; 100.02D), followed by 5 min washes: once with low salt wash buffer (150 mM NaCl, 50 mM Tris (pH 8.0), 5 mM EDTA (pH 8.0), 1% NP-40, 0.5% sodium deoxycholate, 0.1% SDS), once with high salt wash buffer (500 mM NaCl, 50 mM Tris (pH 8.0), 5 mM EDTA (pH 8.0), 1% NP-40, 0.5% sodium deoxycholate, 0.1% SDS), four times with LiCl wash buffer (500 mM LiCl, 50 mM Tris (pH 8.5), 1% NP-40, 0.5% sodium deoxycholate) and twice with TE buffer (100 mM Tris (pH 8.0), 100 mM EDTA (pH 8.0)). Immunoprecipitated complexes and 10% input controls were eluted in two sequential 10 min incubations with 75 μl fresh elution buffer (50 mM Tris (pH 8.0), 10 mM EDTA (pH 8.0), 1% SDS) at 65 °C. DNA-protein crosslinks were reversed by the addition of 200 mM NaCl and incubation at 65 °C overnight. DNA was purified with QIAquick PCR Purification Kit (Qiagen; 28104), resuspended in 50 μl H2O and quantified by real-time PCR with FastStartSYBR Green Master (Roche; 04673492001) on the Stratagene MxPro3005 system, using 2 μl DNA in a 15 μl reaction mixture. All reactions were performed in duplicate with primers described in Supplementary Table 2. Promoter occupancy was calculated with the ‘percent input method’, using the formula: % of input=100 × 2^[Ctadjusted input − Ctenriched], where input Ct is adjusted from 10 to 100% by: Ctadjusted input = Ct10% input − log2 10.

F-/G-actin fractionation

G-actin and F-actin were isolated using the G-actin/F-actin in vivo assay kit (#BK037, Cytoskeleton Inc., Denver, CO) according to the manufacturer’s instructions. Briefly, cells were lysed in pre-warmed lysis/F-actin stabilizing buffer supplemented with protease inhibitor and ATP. The cell lysate was centrifuged for 5 min. at 350 × g to remove cell debris. The cell lysate (100 μl) was centrifuged at 100,000 × g for 1 h at 37 °C to pellet F-actin with G-actin remaining in the supernatant. F-actin in the pellet was resuspended in 100 μl of F-actin destabilizing buffer on ice for 1 h with frequent pipetting. Equal volumes of G-actin and F-actin fractions were mixed with 5× SDS sample buffer and run on SDS-PAGE. Western blot was performed using anti-actin antibody provided in the kit and F-/G-actin ratios were determined by densitometry using Image StudioTM Lite Software (Li-Cor). For all F-/G-actin fractionation experiments, 1 μM Latrunculin B treatment for 24 h served as positive control for F-actin dissociation and 10 μM Phalloidin treatment for 30 min as a positive control for F-actin stabilization[39].

Confocal microscopy

50,000 MCF10A cells were plated on sterile coverslips and allowed to attach overnight. Cells were fixed using paraformaldehyde for 10 min followed by permeabilization with methanol for 5 min. After an hour of incubation in 5% BSA in PBS and 0.01% triton-x100, cells were incubated with YAP primary antibody (Santa Cruz, Dallas, TX, USA) overnight at 4 degree C. Excess antibody was washed off with PBS followed by secondary antibody incubation at room temperature for an hour. After washing off secondary antibody with PBS, the cells were mounted in DAPI vector shield. Imaging was performed using a Leica TCS SP8 microscope. Signal intensity was quantified for 100 cells per experimental condition using Image J software and plotted as a ratio of nuclear versus cytoplasmic signal intensity.

Tumor xenograft assay

For in vivo experiments, 5 × 106 MDA-MB-231, MDA-MB-468 or HCC1935 cells were inoculated orthotopically into the fat pads of the fifth mammary glands of 6-week-old immunocompromised female SCID mice. The tumor volume was measured with a caliper twice per week, using the formula volume = length × width2/2. When tumors reached 100 mm3, mice were split into two groups (5 mice each group) and either treated with vehicle control (PBS) or 25 mg/kg H-1152 twice daily for 31 days. All mouse experiments were approved by the Icahn School of Medicine at Mount Sinai Animal Care and Use Committee (Protocol no. LA12-00037). Maximal tumor burden permitted by Mount Sinai’s IACUC is 10% of mouse body weight or tumor diameter of 10 mm in any dimension. We confirm that tumors did not exceed maximum approved tumor size or burden.

Immunohistochemistry

Paraffin-embedded tissue sections were subjected to HE staining and immunodetection of different proteins using antibodies as indicated. For immunohistochemistry, sections were incubated with primary antibodies Caspase3 or Ki67 (Cell Signaling, Danvers, MA, USA;1:200 dilution) overnight at 4 °C, followed by Dako EnVision+System-HRP Labelled Polymer anti rabbit (Dako) for 1 h at room temperature. Sections were counterstained with hematoxylin, and visualized by light microscopy.

Wound healing assay

Cells were plated on 96-well Image-lock plates (Essen Bioscience) and analyzed for confluency as a monolayer via light microscopy before initiation of a scratch wound. Scratches were made using a 96-pin tool (Woundmaker) as per the protocol. Data processing and analysis of migration were performed using the IncuCyte 96-well Kinetic Cell Migration and Invasion Assay software module. Data were then exported to Excel for further analysis. Wound width is defined as the area of the wound at any time t, as determined by the processing software. Wound confluence is expressed as a percentage of the scratch wound that is filled with cells at any given time t, when compared with the initial scratch. Wound closure was monitored at 60-min intervals for at least 48 h. Videomicroscopy was performed with a ×10 objective. Experiments were performed in triplicate at 37 °C.

Flow cytometry

30,000 cells (control empty vector and shP53 MDA-MB-468 cells) were processed for FACS 24 h after plating. Cell pellets were washed with phosphate-buffered saline and fixed/permeabilized with 70% ice-cold ethanol. Pellets were washed with phosphate-buffered saline, resuspended in 50 μg/ml ribonuclease A and 62.5 μg/ml propidium iodide and run on BD FACSCanto™ II Cell Analyzer. Data analysis was performed with FloJo 10.4.2 software. Using the FSC/SSC gating, debris was removed by gating on the main cell population (Supplementary Fig. 1e). Positivity threshold for each cell line was defined on the basis of the control (empty vector) sample. Identical positivity threshold was applied to all samples.

Bioinformatic analyses

The public data sets TCGA-Breast Invasive Carcinoma and TCGA-Mesothelioma[75] were used for bioinformatic analyses. Gene Set Enrichment Analysis (GSEA) (https://www.gsea-msigdb.org/gsea/index.jsp) was used to assess whether the TEAD/YAP conserved gene signature[52] was enriched. The samples are separated into 2 groups based on the mutation status of p53 for TNBC and the following genes: NF2, LATS1, LATS2, YAP1 and WWTR1 for Mesothelioma. The gene expression boxplots use the DESeq2 VST normalized read counts.

Statistics and reproducibility

All data analysis was performed using GraphPad Prism version 6 for Macintosh OS X (GraphPad Software, CA). All p-values were determined from n = 3 biologically independent replicates using two-tailed t-tests, and statistical significance was set at p = 0.05 (*p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001). The actual calculated p values for all data are provided in the source data file. All western blots were performed with n = 2 biologically independent replicates and representative data are shown.
  75 in total

Review 1.  The Hippo signaling pathway in stem cell biology and cancer.

Authors:  Jung-Soon Mo; Hyun Woo Park; Kun-Liang Guan
Journal:  EMBO Rep       Date:  2014-05-12       Impact factor: 8.807

Review 2.  Statins as Anticancer Agents in the Era of Precision Medicine.

Authors:  Jenna E van Leeuwen; Mohamad Elbaz; Emily Branchard; Joseph Longo; Linda Z Penn
Journal:  Clin Cancer Res       Date:  2020-09-04       Impact factor: 12.531

Review 3.  The interplay between cell signalling and the mevalonate pathway in cancer.

Authors:  Peter J Mullen; Rosemary Yu; Joseph Longo; Michael C Archer; Linda Z Penn
Journal:  Nat Rev Cancer       Date:  2016-08-26       Impact factor: 60.716

Review 4.  Applications for ROCK kinase inhibition.

Authors:  Michael F Olson
Journal:  Curr Opin Cell Biol       Date:  2008-02-20       Impact factor: 8.382

5.  Tankyrase Inhibitors Target YAP by Stabilizing Angiomotin Family Proteins.

Authors:  Wenqi Wang; Nan Li; Xu Li; My Kim Tran; Xin Han; Junjie Chen
Journal:  Cell Rep       Date:  2015-10-08       Impact factor: 9.423

Review 6.  A compendium of mutational cancer driver genes.

Authors:  Francisco Martínez-Jiménez; Ferran Muiños; Inés Sentís; Jordi Deu-Pons; Iker Reyes-Salazar; Claudia Arnedo-Pac; Loris Mularoni; Oriol Pich; Jose Bonet; Hanna Kranas; Abel Gonzalez-Perez; Nuria Lopez-Bigas
Journal:  Nat Rev Cancer       Date:  2020-08-10       Impact factor: 60.716

7.  Cardiovascular effects of a novel potent and highly selective azaindole-based inhibitor of Rho-kinase.

Authors:  R Kast; H Schirok; S Figueroa-Pérez; J Mittendorf; M J Gnoth; H Apeler; J Lenz; J K Franz; A Knorr; J Hütter; M Lobell; K Zimmermann; K Münter; K H Augstein; H Ehmke; J P Stasch
Journal:  Br J Pharmacol       Date:  2007-10-15       Impact factor: 8.739

Review 8.  Activated Rho GTPases in Cancer-The Beginning of a New Paradigm.

Authors:  Pontus Aspenström
Journal:  Int J Mol Sci       Date:  2018-12-08       Impact factor: 5.923

9.  Effects of cytochalasin D and latrunculin B on mechanical properties of cells.

Authors:  T Wakatsuki; B Schwab; N C Thompson; E L Elson
Journal:  J Cell Sci       Date:  2001-03       Impact factor: 5.285

Review 10.  Targeting Oncogenic Mutant p53 for Cancer Therapy.

Authors:  Alejandro Parrales; Tomoo Iwakuma
Journal:  Front Oncol       Date:  2015-12-21       Impact factor: 6.244

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.