Literature DB >> 33137097

Aequorea's secrets revealed: New fluorescent proteins with unique properties for bioimaging and biosensing.

Gerard G Lambert1, Hadrien Depernet2, Guillaume Gotthard2, Darrin T Schultz3,4, Isabelle Navizet5, Talley Lambert6,7, Stephen R Adams8, Albertina Torreblanca-Zanca1, Meihua Chu1, Daphne S Bindels9, Vincent Levesque10, Jennifer Nero Moffatt10, Anya Salih11, Antoine Royant2,12, Nathan C Shaner1.   

Abstract

Using mRNA sequencing and de novo transcriptome assembly, we identified, cloned, and characterized 9 previously undiscovered fluorescent protein (FP) homologs from Aequorea victoria and a related Aequorea species, with most sequences highly divergent from A. victoria green fluorescent protein (avGFP). Among these FPs are the brightest green fluorescent protein (GFP) homolog yet characterized and a reversibly photochromic FP that responds to UV and blue light. Beyond green emitters, Aequorea species express purple- and blue-pigmented chromoproteins (CPs) with absorbances ranging from green to far-red, including 2 that are photoconvertible. X-ray crystallography revealed that Aequorea CPs contain a chemically novel chromophore with an unexpected crosslink to the main polypeptide chain. Because of the unique attributes of several of these newly discovered FPs, we expect that Aequorea will, once again, give rise to an entirely new generation of useful probes for bioimaging and biosensing.

Entities:  

Mesh:

Substances:

Year:  2020        PMID: 33137097      PMCID: PMC7660908          DOI: 10.1371/journal.pbio.3000936

Source DB:  PubMed          Journal:  PLoS Biol        ISSN: 1544-9173            Impact factor:   8.029


Introduction

EGFP and other engineered variants of avGFP [1] have truly transformed biological imaging, allowing researchers to probe living cells in ways that were previously unthinkable [2-4]. The seemingly impossible task of producing a bright avGFP variant with an emission peak beyond yellow-green [5] drove many groups to explore other marine organisms as potential sources of fluorescent proteins (FPs) emitting at longer wavelengths. About 5 years after avGFP was cloned, FPs were discovered in corals [6,7], and since that time, FPs cloned from jellies, corals, and many other marine organisms have been reported (e.g., [8-10], among many others). Despite this abundance of reported wild-type FPs, most FPs in widespread use as imaging tools are derived from only a handful of these organisms. Numerous avGFP variants with blue, cyan, green, and yellow-green emission remain the workhorses of live-cell imaging, and derivatives of red-emitting FPs from the soft coral Discosoma sp. [6,11,12] and the sea anemone Entacmaea quadricolor [10,13-15] make up the majority of commonly used FPs emitting at longer wavelengths. With the practical limitations of these particular FP scaffolds becoming more apparent as live-cell microscopy grows more complex and demanding, our group has focused on identifying, characterizing, and engineering FPs with low homology to these traditional choices. Our ongoing efforts include cloning new FPs from diverse sources as well as investigating previously un- or under-characterized FPs to identify new scaffolds with improved and/or novel spectral properties from which to launch new engineering efforts. While searching for organisms expressing new and unusual FPs at Heron Island, a research station in the southern Great Barrier Reef, we collected a single individual of an unknown Aequorea species that we later determined was most similar to A. australis. This serendipitous encounter with a familiar genus led us to discover several novel FP homologs from 2 Aequorea species. Several of these proteins offer unique starting points for probe engineering.

Results and Discussion

The cyan-blue coloration of the radial canals of the A. cf. australis specimen we collected (Figs 1Α, S1, and S2, and Figs K–N in S1 Text) suggested the potential presence of red-absorbing chromoproteins (CPs) and led us to reconstruct the transcriptome of the animal. In addition to transcripts encoding an FP clearly homologous to A. victoria green fluorescent protein (avGFP), as we expected, the A. cf. australis transcriptome also contains several transcripts encoding other, much more divergent avGFP homologs. Characterization of the recombinant proteins revealed that these avGFP homologs include a green-emitting FP that appears to be the brightest FP discovered to date, 2 long-wavelength-absorbing CPs, and a reversibly photochromic FP (Figs 1Β and 2; Table 1).
Fig 1

Photographs of Aequorea individuals from this study and purified fluorescent proteins cloned from these samples.

(A) White-light (i) and fluorescence (400-nm LED illumination) (ii) photographs of A. victoria and white-light photographs of A. cf. australis (iii, iv). The blue coloration of A. cf. australis is shown in the higher magnification image of one of its tentacle bulbs (iv). (B) Purified recombinant proteins from Aequorea species, shown under white light and 480-nm LED without emission filters. Protein concentrations were adjusted to display similar optical density as judged by eye and were between 0.5 and 2 mg/ml for all samples.

Fig 2

Absorbance and emission spectra (where measurable) for FP homologs in this study.

Proteins from each species were designated AvicFP or AausFP and numbered in order of discovery, with chromoproteins retaining the “FP” nomenclature for consistency. For photoswitchable and photoconvertible proteins, pre-illumination absorbance spectra are shown as dotted lines, and post-illumination absorbance spectra as solid lines. Emission spectra are shown as green solid lines. The emission spectra for AvicFP2 and AvicFP3 were measured using 460-nm excitation prior to photoconversion. The emission spectrum of AausFP4 was measured using 440-nm excitation after photoswitching to the blue-absorbing state. Red arrows indicate peaks that increase or decrease upon photoconversion or switching. For ease of display, spectra are normalized to the maximum visible absorbance for non-photoactive proteins, and to the pre- (for AvicFP2) or post-illumination (for AvicFP3 and AausFP4) maximum for photoactive proteins. All plots share the same x-axis scale as shown for AausGFP. The data underlying this figure may be found at FPbase (https://www.fpbase.org). FP, fluorescent protein.

Table 1

Photophysical properties of fluorescent proteins described in this study derived from A. victoria and A. cf. australis.

ProteinλabsaλembεcφdBrightnessepKafPhotostabilityg
avGFPh398/477i50341 (6.5)/15 (2.2)0.75 (0.01)91/324.8j (0.1)ND
AvicFP148150364 (3.7)0.63 (0.03)1184.9 (0.1)ND
AvicFP2k48051559 (1.2)0.04 (0.01)6NDmND
588l41 (3.2)
AvicFP3k480520ND<0.001lNDND
580ND
AvicFP4500512121 (2.1)0.10 (0.01)36NDND
AausGFPm398/47750329 (1.6)/22 (1.3)0.73 (0.01)62/474.8i (0.1)ND
AausFP1504510170 (6.0)0.97 (0.05)4854.4 (0.1)129 ± 4 (N = 20) 218 ± 9 (N = 23)
AausFP260952 (2.3)<6.0ND
AausFP358759 (1.7)<6.5ND
AausFP4n338/477—/51042 (1.9)/3 (0.1)—/<0.001NDND
47751369 (2.4)<0.001
mAvicFP148050365 (0.04)0.63 (0.01)1264.9 (0.1)131 ± 3 (N = 20) 121 ± 8 (N = 20)
mEGFPo488507560.601006.0100 ± 4 (N = 31) 100 ± 4 (N = 13)
mNeonGreenp5065171160.802745.7ND

The commonly used protein mEGFP and the bright monomeric FP mNeonGreen are included for comparison. Values reported for photophysical parameters are the mean of at least 3 independent measurements on independently prepared samples; values in parentheses are standard deviation of the mean unless otherwise noted below. A dash indicates no measurable emission or negligible brightness.

aPeak absorbance wavelength (nm).

bPeak emission wavelength (nm).

cMolar extinction coefficient (mM−1cm−1).

dFluorescence quantum yield.

eBrightness (ε × φ), percent normalized to mEGFP.

fFor FPs with a quantum yield ≥ 0.10, the reported pKa is the pH at which fluorescence emission is 50% of maximal brightness; for AausFP2 and AausFP3, the pKa was determined only approximately and represents the pH at which the long-wavelength absorbance peak is 50% of its maximal value.

gMean photobleaching half-times in live cells, corrected for molecular brightness and scaled to the half-time measured for mEGFP in this study (mEGFP = 100%); half-times under widefield (upper value) or laser scanning confocal (lower value) illumination (see Methods and S1 Text) are shown ± the standard error of the mean, with the number of individual cells sampled given in parentheses.

hMeasured in this study using the avGFP peptide sequence from the A. victoria individual sequenced.

iavGFP displays two absorbance peaks whose ratio is largely insensitive to pH changes over much of the physiological range but is somewhat sensitive to protein concentration; values separated by slashes in all columns represent those for these two distinct peaks, respectively.

jFluorescence pKa value determined by exciting the 477-nm absorbance peak.

kValues given are for pre- (upper value) and post-photoconverted (lower value) forms of AvicFP2 and AvicFP3.

lFluorescence quantum yields less than 0.001 were not determined, even in cases with a measurable emission peak.

mAausGFP is the closest direct homolog to avGFP from A. cf. australis and displays a similar double-peaked absorbance; values separated by slashes represent those from each peak, respectively.

nAausFP4 is reversibly photoswitchable between a UV-absorbing form and a blue-absorbing form; the UV-absorbing form has a small amount of residual blue absorbance; values of photophysical parameters UV and blue absorbance peaks are separated by slashes.

oValues from [2] are shown in the table and were re-verified in this study.

pValues from [35] are shown in the table and were re-verified in this study.

avGFP, Aequorea victoria green fluorescent protein; FP, fluorescent protein; ND, not determined.

Photographs of Aequorea individuals from this study and purified fluorescent proteins cloned from these samples.

(A) White-light (i) and fluorescence (400-nm LED illumination) (ii) photographs of A. victoria and white-light photographs of A. cf. australis (iii, iv). The blue coloration of A. cf. australis is shown in the higher magnification image of one of its tentacle bulbs (iv). (B) Purified recombinant proteins from Aequorea species, shown under white light and 480-nm LED without emission filters. Protein concentrations were adjusted to display similar optical density as judged by eye and were between 0.5 and 2 mg/ml for all samples.

Absorbance and emission spectra (where measurable) for FP homologs in this study.

Proteins from each species were designated AvicFP or AausFP and numbered in order of discovery, with chromoproteins retaining the “FP” nomenclature for consistency. For photoswitchable and photoconvertible proteins, pre-illumination absorbance spectra are shown as dotted lines, and post-illumination absorbance spectra as solid lines. Emission spectra are shown as green solid lines. The emission spectra for AvicFP2 and AvicFP3 were measured using 460-nm excitation prior to photoconversion. The emission spectrum of AausFP4 was measured using 440-nm excitation after photoswitching to the blue-absorbing state. Red arrows indicate peaks that increase or decrease upon photoconversion or switching. For ease of display, spectra are normalized to the maximum visible absorbance for non-photoactive proteins, and to the pre- (for AvicFP2) or post-illumination (for AvicFP3 and AausFP4) maximum for photoactive proteins. All plots share the same x-axis scale as shown for AausGFP. The data underlying this figure may be found at FPbase (https://www.fpbase.org). FP, fluorescent protein. The commonly used protein mEGFP and the bright monomeric FP mNeonGreen are included for comparison. Values reported for photophysical parameters are the mean of at least 3 independent measurements on independently prepared samples; values in parentheses are standard deviation of the mean unless otherwise noted below. A dash indicates no measurable emission or negligible brightness. aPeak absorbance wavelength (nm). bPeak emission wavelength (nm). cMolar extinction coefficient (mM−1cm−1). dFluorescence quantum yield. eBrightness (ε × φ), percent normalized to mEGFP. fFor FPs with a quantum yield ≥ 0.10, the reported pKa is the pH at which fluorescence emission is 50% of maximal brightness; for AausFP2 and AausFP3, the pKa was determined only approximately and represents the pH at which the long-wavelength absorbance peak is 50% of its maximal value. gMean photobleaching half-times in live cells, corrected for molecular brightness and scaled to the half-time measured for mEGFP in this study (mEGFP = 100%); half-times under widefield (upper value) or laser scanning confocal (lower value) illumination (see Methods and S1 Text) are shown ± the standard error of the mean, with the number of individual cells sampled given in parentheses. hMeasured in this study using the avGFP peptide sequence from the A. victoria individual sequenced. iavGFP displays two absorbance peaks whose ratio is largely insensitive to pH changes over much of the physiological range but is somewhat sensitive to protein concentration; values separated by slashes in all columns represent those for these two distinct peaks, respectively. jFluorescence pKa value determined by exciting the 477-nm absorbance peak. kValues given are for pre- (upper value) and post-photoconverted (lower value) forms of AvicFP2 and AvicFP3. lFluorescence quantum yields less than 0.001 were not determined, even in cases with a measurable emission peak. mAausGFP is the closest direct homolog to avGFP from A. cf. australis and displays a similar double-peaked absorbance; values separated by slashes represent those from each peak, respectively. nAausFP4 is reversibly photoswitchable between a UV-absorbing form and a blue-absorbing form; the UV-absorbing form has a small amount of residual blue absorbance; values of photophysical parameters UV and blue absorbance peaks are separated by slashes. oValues from [2] are shown in the table and were re-verified in this study. pValues from [35] are shown in the table and were re-verified in this study. avGFP, Aequorea victoria green fluorescent protein; FP, fluorescent protein; ND, not determined. Intrigued by the diversity of optical properties in the A. cf. australis FP homologs, we next investigated a sample of A. victoria from the Crystal Jelly exhibit at the Birch Aquarium at Scripps to determine whether this species also contained multiple diverse FPs. As we suspected, the A. victoria individual we sequenced expressed avGFP as well as orthologs of the bright green-emitting FP and the unusual CPs that we first identified in A. cf. australis. Surprisingly, this A. victoria also expressed a fairly close homolog of avGFP with surprisingly EGFP-like properties: a fully anionic chromophore, low pKa, and much more efficient folding and maturation at 37°C than wild-type avGFP. We found that only 2 mutations—1 to speed maturation at 37°C and 1 to monomerize the protein—generated an FP with properties comparable to the commonly used avGFP variant mEGFP. A. victoria’s 2 CPs are distinct from those of A. cf. australis, undergoing an apparently unique mode of photoconversion from a green-emitting (green fluorescent protein [GFP]–like) state to a non-fluorescent, orange-red-absorbing state after exposure to blue light (Fig 2). While not characterized in depth during this study, this unusual property certainly warrants additional investigation of these CPs. The 3 broad classes of FP homolog found in this study—green-emitting FPs, long-wavelength-absorbing CPs, and a reversibly photoswitchable CP—are discussed below. A phylogenetic tree of the FP homologs from this study is shown in Fig 3, and a sequence alignment is shown in Fig A in S1 Text.
Fig 3

Phylogenetic tree for FPs cloned in this study, with Aequorea macrodactyla and Aldersladia magnificus green FPs included as outgroups.

Green-emitting FPs with avGFP-like properties, including AvicFP1, fall into 1 cluster of fairly closely related sequences, while the novel fluorescent (AausFP1 and AvicFP4) and non-fluorescent homologs form 2 additional families. The data underlying this figure (nucleotide sequences of the FPs from this study) may be found in GenBank, accession numbers MN114103 through MN114112. avGFP, Aequorea victoria green fluorescent protein; FP, fluorescent protein.

Phylogenetic tree for FPs cloned in this study, with Aequorea macrodactyla and Aldersladia magnificus green FPs included as outgroups.

Green-emitting FPs with avGFP-like properties, including AvicFP1, fall into 1 cluster of fairly closely related sequences, while the novel fluorescent (AausFP1 and AvicFP4) and non-fluorescent homologs form 2 additional families. The data underlying this figure (nucleotide sequences of the FPs from this study) may be found in GenBank, accession numbers MN114103 through MN114112. avGFP, Aequorea victoria green fluorescent protein; FP, fluorescent protein.

Multiple, diverse Aequorea GFPs

As expected, both Aequorea species abundantly express close homologs of avGFP. Both AausGFP (A. cf. australis GFP) and the avGFP sequence identified in this work possess optical and biochemical properties similar to Prasher et al.’s original avGFP clone [1], characterized by an excitation spectrum with 2 peaks at 398 and 477 nm and an emission peak at 503 nm. The extinction coefficient and quantum yield of the 2 proteins are similar, and in our hands match closely with the literature values for avGFP [2]. We were surprised to discover a second green-emitting FP in A. cf. australis, AausFP1, that shares only 53% amino acid identity with avGFP (Fig A in S1 Text). AausFP1 is to our knowledge the brightest FP discovered to date, with a nearly perfect quantum yield (0.97) and a peak extinction coefficient of 170,000 M−1cm−1, making it nearly 5-fold brighter than EGFP on a per-molecule basis. These already extraordinary properties are further bolstered by a low fluorescence pKa (4.4), unusually narrow excitation and emission peaks (see Fig 2; the emission peak of AausFP1 has a full width at half maximum [FWHM] of 19 nm, compared to 32 nm for EGFP), and higher photostability than mEGFP (see below). The ortholog of AausFP1 in A. victoria, AvicFP4, shares some of its unusual properties, such as narrow excitation and emission peaks (Fig 2), efficient folding at 37°C, and a fairly high extinction coefficient, but its low quantum yield (0.10) makes it the dimmest GFP found in A. victoria. AausFP1 was expressed at very low levels relative to other FPs in the A. cf. australis individual sequenced (see Table A in S1 Text) and would be rare or absent in most cDNA expression-cloning libraries. The transcriptomic approach used in this study is the only practical way to identify such unusual, low-abundance FPs, short of costly whole genome sequencing. Despite low expression in its native context, wild-type AausFP1 expresses and folds very efficiently in E. coli at 37°C without any modifications. Though brightly fluorescent, AausFP1 is largely insoluble in this context, and when purified, the soluble fraction of the protein runs as a high-molecular-weight aggregate on size exclusion chromatography (Fig BB in S1 Text). When expressed in mammalian cells, AausFP1 is excluded from the nucleus and only forms visible aggregates in the most highly expressing cells (Fig W in S1 Text), suggesting that it may form soluble but high-molecular-weight aggregates in this context as well. X-ray crystallography revealed a uniquely stabilized chromophore environment in AausFP1 that may be responsible for its unique properties (see Fig 4, Tables C–E in S1 Text, and Figs B, D, E, and G in S1 Text). Since AausFP1 crystallizes as a dimer, we speculate that it takes on this oligomeric state in its native context, perhaps stabilized by other interactions. It is possible that, as with other FPs such as dTomato [11], the dimer interface serves to stabilize the chromophore environment and may contribute to the unusually high brightness of AausFP1.
Fig 4

Expression of mAvicFP1-tagged proteins in mammalian cells.

mAvicFP1 fusions to (A) CytERM, (B) LifeAct, and (C) H2B. U2-OS cells display expected localization. Scale bar is 10 mm. The data underlying this figure (raw image data) may be found at https://doi.org/10.26300/4x48-y393.

Expression of mAvicFP1-tagged proteins in mammalian cells.

mAvicFP1 fusions to (A) CytERM, (B) LifeAct, and (C) H2B. U2-OS cells display expected localization. Scale bar is 10 mm. The data underlying this figure (raw image data) may be found at https://doi.org/10.26300/4x48-y393. AausFP1 photobleaches at similar rates to mEGFP on both widefield and confocal microscopy when instrument settings are identical, but because AausFP1 emits photons at a higher rate (due to its high quantum yield and extinction coefficient), its true photostability is somewhat higher than that of mEGFP (S1 Text and Figs Z and AA in S1 Text). Because it has a number of potentially useful properties, we consider AausFP1 the top candidate for future engineering among the FPs we have identified in this work. Apart from AausFP1, an unexpected find among the newly discovered A. victoria FP homologs was AvicFP1, a transcript with relatively low abundance (Table A in S1 Text) but with high homology to avGFP (80% amino acid identity; see Fig A in S1 Text). At neutral pH, AvicFP1 has a single absorbance peak at 481 nm, indicating that its chromophore exists in a fully anionic state. It is curious that AvicFP1 would appear to be a superior energy transfer acceptor for the photoprotein aequorin than avGFP based on their absorbance spectra (Fig 2). However, avGFP was expressed at the sites of luminescence (bell margin), while AvicFP1 was only detected in the body of the animal (Table A in S1 Text), indicating that it is unlikely to be the natural energy acceptor for aequorin. Unfortunately, investigation of the interactions between AvicFP1 and aequorin are beyond the scope of this study. The fluorescence pKa of AvicFP1 (4.9) is lower than that of EGFP (6.0). We speculate that the cysteine present in the first chromophore position is partly responsible for AvicFP1’s EGFP-like properties. The S65T substitution in avGFP was among the most critical early mutations introduced to generate an all-anionic chromophore, though S65C was reported at the same time [2,16]. Because of mutations derived from errors in the oligonucleotides used for synthetic gene assembly, we also identified 1 colony among the thousands of initial AvicFP1 clones that produced a much larger proportion of mature FP in E. coli incubated at 37°C. This clone contained a single point mutation leading to the substitution F64L, generating a variant with optical and biochemical properties indistinguishable from those of the wild-type protein. The F64L mutation is another of those originally identified for improving the folding of avGFP to ultimately produce EGFP [2,17]. Essentially all of the side chains that participate in the weak dimer interface of avGFP are conserved in AvicFP1. We hypothesized that mutations sufficient to monomerize avGFP variants (i.e., A206K [18]) would also produce a monomeric variant of AvicFP1. Using the organized smooth endoplasmic reticulum (OSER) assay to test for oligomeric behavior in cells [19], we found that the mutant AvicFP1-F64L/A206K displays monomeric behavior equivalent to mEGFP, widely considered the “gold standard” of monomeric FPs [19] (OSER data are summarized in Table B in S1 Text). Fusions to LifeAct [20] and histone 2B (H2B) displayed the expected localization and dynamics (Fig 5, S1 Movie and S2 Movie). Additionally, cells expressing H2B-mAvicFP1 and imaged at 2-minute intervals for 72 hours at 37°C showed no significant increase in doubling time (see Fig Y in S1 Text and S1 Data). We therefore decided that this variant merited an official name: mAvicFP1 (monomeric A. victoria fluorescent protein 1).
Fig 5

The AausFP1 chromophore environment.

(A) 2Fobs − Fcalc electron-density map contoured at a 1.5 σ level superimposed over the model of the chromophore and the neighboring residues in the structure of AausFP1. (B) Dihedral angle definition around the chromophore methylene bridge. The data underlying this figure may be found in PDB 6S67.

The AausFP1 chromophore environment.

(A) 2Fobs − Fcalc electron-density map contoured at a 1.5 σ level superimposed over the model of the chromophore and the neighboring residues in the structure of AausFP1. (B) Dihedral angle definition around the chromophore methylene bridge. The data underlying this figure may be found in PDB 6S67. Originally, avGFP was identified as a partner to the photoprotein aequorin, and this association ultimately led to cloning the cDNA that encodes it. We speculate that other green-emitting FPs were not identified at the same time as avGFP because the brightest visible fluorescence in A. victoria is around the bell margin, while AvicFP1 appears to be expressed exclusively in other tissues (Fig A in S1 Text). The optical properties of mAvicFP1 are superficially similar to those of mEGFP, and these FPs have similar brightness. In our hands, mAvicFP1’s photostability under widefield and confocal illumination is somewhat higher than that of mEGFP (Figs Z and AA in S1 Text and S1 Data), its monomeric character is comparable, and its toxicity (as measured by the rate of cell division when expressing an H2B fusion; see S1 Text and Fig Y in S1 Text) appears to be lower that of mEGFP. However, the primary differentiating property of mAvicFP1 is its low pKa, which may offer advantages when labeling proteins in acidic compartments. Others have also reported that mAvicFP1 spontaneously “blinks” under high illumination intensity, making it highly useful for single-molecule localization microscopy with a single excitation wavelength [21].

Unusual Aequorea CPs

In the context of the broad phenotypic diversity of hydrozoan FP homologs now known [22-25], the presence of green- and red-absorbing CPs in Aequorea species is not surprising. However, the properties of Aequorea CPs differ in surprising ways from those previously cloned from other organisms. Every Aequorea CP displays a broad absorbance spectrum (Fig 2) that lacks the well-defined sharp peak and short-wavelength shoulder typical of most FPs and CPs, suggesting that these proteins contain an unusual chromophore and/or chromophore environment. Also, none of the Aequorea CPs has any measurable red fluorescence emission, even on our most sensitive instruments. All CPs described here migrate as high-molecular-weight, apparently soluble aggregates or high-order oligomers on a gel filtration column when expressed in E. coli (see Fig BB in S1 Text). AausFP2 has a distinctive cyan-blue pigmented appearance when expressed in E. coli, with a broad absorbance spectrum peaking at 610 nm. A. cf. australis expresses a second CP, AausFP3, that displays a similarly symmetrical, shoulder-less absorbance peak, but with a maximum absorbance at 590 nm. X-ray crystallography analysis of AausFP2 (Tables B and C in S1 Text) revealed a conserved dimer interface geometry containing many conserved residues between AausFP1 and AausFP2. We suspect that despite AausFP2’s behavior in gel filtration experiments, the native oligomeric state of AausFP2 may be a dimer. The amino acid residues making up the dimer interface in the AausFP2 crystal structure are also largely conserved across the other Aequorea CPs (Fig A in S1 Text), suggesting that if this is the native oligomeric state of AausFP2, then they are all likely to be dimers. The X-ray crystal structure of AausFP2 further revealed a chemically novel chromophore in which the side chain of a neighboring cysteine is covalently linked to the methylene bridge of a twisted GFP-like chromophore (Fig 6; Tables D, E, and G in S1 Text; Figs F and H in S1 Text). This amino acid, Cys62, is conserved in all Aequorea CPs. The C62S mutant of AausFP2 appears yellow and has a major absorbance peak characteristic of a GFP-type chromophore (Fig I in S1 Text), strongly suggesting that this conserved cysteine is necessary for formation of the red-shifted chromophore. The peak absorbance wavelength of alkali-denatured Aequorea CPs displays a 20- to 30-nm red-shift relative to that expected for a GFP-type chromophore [2], which is abolished by addition of β-mercaptoethanol (Fig CC in S1 Text), providing additional evidence for the role of this unusual bond. Quantum mechanical calculations indicate that both the presence of a sulfur atom and a twisted chromophore are required to produce long-wavelength absorbance (see S1 Text, Fig J in S1 Text, and Table F in S1 Text).
Fig 6

2Fobs − Fcalc electron-density map contoured at a 2.0 σ level superimposed over the model of the chromophore and the 3 covalently bonded residues in the structure of AausFP2.

The data underlying this figure may be found in PDB 6S68.

2Fobs − Fcalc electron-density map contoured at a 2.0 σ level superimposed over the model of the chromophore and the 3 covalently bonded residues in the structure of AausFP2.

The data underlying this figure may be found in PDB 6S68. Because of its broad absorbance reaching into the far-red and near-infrared regions of the spectrum, its relatively high extinction coefficient, and its efficient folding at 37°C, AausFP2 or its derivatives could ultimately prove very useful as photoacoustic tomography probes for deep tissue imaging. Unlike their orthologs in A. cf. australis, which mature fully to their long-wavelength forms in the dark, the A. victoria CPs mature very slowly in the absence of blue light. When expressed in total darkness, AvicFP2 has peak absorbance in the blue region, and is weakly green fluorescent, suggesting an avGFP-type chromophore. Upon blue light exposure, AvicFP2 converts into a purple-blue CP with peak absorbance at 588 nm. In light of the quantum mechanical calculations presented (Fig J in S1 Text and Table F in S1 Text), this dramatic absorbance shift suggests that the light-induced change in AvicFP2 represents either the bonding of the Cys62 side chain to the methylene bridge of the chromophore or twisting of the chromophore from a planar to non-planar conformation. AvicFP3 is highly homologous to AvicFP2 (96% amino acid identity; see Fig A in S1 Text), and is similarly green fluorescent when expressed and purified in the dark. Like AvicFP2, AvicFP3 converts to a green-absorbing CP when exposed to blue light, but appears to mature more efficiently than AvicFP2 in the absence of light (see pre-conversion absorbance spectrum; Fig 2). We anticipate that these proteins, if they can be engineered into monomers that mature efficiently at 37°C, could be useful as photoactivatable Förster resonance energy transfer (FRET) quenchers.

A reversibly photochromic CP

The final FP homolog we identified in A. cf. australis is AausFP4, a very weakly fluorescent (quantum yield < 0.001) green-emitting CP with photochromic behavior strikingly similar to that of the engineered avGFP variant Dreiklang [26]. When expressed and/or stored in the dark, AausFP4 reaches an equilibrium state with a major absorbance peak at 338 nm, indicating that the chromophore is neutral and missing at least 1 double bond relative to a mature GFP-type chromophore. With exposure to UV light, AausFP4 fully converts to an anionic GFP-like state with 477-nm peak absorbance. This transformation is reversible by exposure to bright blue light or by storage in the dark. Together, these properties suggest a mechanism similar to that of Dreiklang, in which a structural water molecule can reversibly hydrate the imidazolinone ring of the chromophore via 2 different photochemical reactions triggered by different wavelengths of light [26]. A key difference between AausFP4 and Dreiklang is the absence of an approximately 400-nm absorbance peak in the “on” state, accompanied by off-switching mediated by blue rather than violet light. While AausFP4 is likely to be dimeric and/or aggregating like its closest relatives (AausFP2 and AausFP3), it may prove to be a useful starting material from which to engineer a new lineage of reversibly photoswitchable FPs or CPs. AausFP4 also likely represents, to our knowledge, the first naturally occurring example of Dreiklang-type photoswitching to be discovered.

Conclusion

We have identified several new Aequorea FPs with the potential to further diversify the landscape of fluorescent probes and biosensors. AausFP1, the brightest fluorescent protein currently known, will serve as the parent of an entirely new lineage of super-bright FP variants. As a parallel scaffold to avGFP derivatives in many ways, mAvicFP1 may be quickly adaptable to existing probes and biosensors. AausFP4 is the first natural example of Dreiklang-type photochromism and may help generate other useful variations on this mechanism. Four highly unusual Aequorea CPs provide truly novel engineering opportunities, including generating new far-red-emitting FPs, improved dark FRET acceptors, and photoacoustic probes, among many other potential uses. The discovery and understanding of these new fluorescent proteins in Aequorea were made possible through a highly collaborative and interdisciplinary approach involving field collection work, basic molecular biology, next-generation sequencing and bioinformatics, protein engineering, microscopy, X-ray crystallography, and phylogenetics. We are optimistic that more studies with this kind of holistic approach will help elucidate many of the mysteries still hiding in the natural world. In the time that has elapsed since Osamu Shimomura’s first sampling of A. victoria in Friday Harbor, it has become clear that there is an urgent need to explore and understand as much of the molecular biodiversity that exists in the world as possible before many organisms go extinct or become too rare to sample.

Materials and methods

Chemicals and other reagents

Unless otherwise noted, bacterial growth medium components were purchased from Fisher Scientific, antibiotics were purchased from Gold Biotechnology, and other chemicals were purchased from Sigma-Aldrich.

Sample collection and RNA extraction

A single specimen of A. cf. australis was collected near Heron Island (Queensland, Australia) and processed on-site at the Heron Island Research Station (University of Queensland) (see “Ethics statement” for permit and collection details). A single individual of A. victoria was obtained from the aquaculture collections of the Birch Aquarium at Scripps. The animals being kept in the exhibit tank at this time were originally obtained from the Aquarium of the Pacific (Long Beach, CA), where they have been bred in captivity for many generations. Notably, the A. victoria jellies are fed a diet of crustaceans, and so any hydrozoan-like FP transcripts identified must come from the jelly itself rather than from contamination of the mRNA sequencing (mRNA-Seq) library with prey-derived mRNAs. Live samples were photographed and then anaesthetized with MgCl2 prior to being dissected. The bell margin, bell, and mouth were dissected separately, and total RNA was extracted using RNeasy Plus Mini Kit (Qiagen) following the manufacturer’s instructions. For A. cf. australis, the purified samples were combined and dried in a GenTegra RNA tube for transport back to the US. For A. victoria, samples from the 3 body regions were kept separate.

Next-generation sequencing

Total RNA samples were used as input to generate Illumina-compatible mRNA-Seq libraries at the Scripps Research Institute Next Generation Sequencing Core facility. Total RNA underwent polyA selection prior to Illumina TruSeq library prep. Libraries were run on 1 NextSeq flowcell and generated between 25 and 35 million 150-bp paired-end reads per sample. Transcriptomes for individual samples as well as the aggregate A. victoria transcriptome were assembled using Trinity [27,28] either on a custom workstation in the lab or using the public Galaxy bioinformatics server [29]. Read mapping was performed using Bowtie 2 alignment [30] and RSEM [31] for cross-sample comparison. Additional details on transcript verification are included in S1 Text and Figs O–W in S1 Text.

Species identification

The identity of A. cf. australis was established using phylogenetic analysis; see detailed methods and results in S1 Text, S1 Fig and S2 Fig. The identity of A. victoria was verified by the presence of an assembled transcript encoding avGFP, as well as its well-characterized morphology.

Protein tree

Protein sequences were aligned with Clustal Omega [32], and a Bayesian tree was created using a burn-in of 3,000 iterations, run length of 30,000 iterations, and 4 chains with MrBayes software [33].

Cloning and mutagenesis

Candidate FP-encoding transcripts were identified by BLAST homology searching using avGFP as the query against the assembled transcriptome databases as well as intermediate assembly files created by the Trinity workflow. Searching through intermediate assembly files allowed us to identify potential alternative transcript sequences and those that were (possibly incorrectly) collapsed into single contigs by Trinity. Putative FP-encoding transcripts were validated against raw read data and reconstructed as necessary (see below for detailed methods, results, and discussion). Sequence alignments were performed using Clustal Omega [32]. For each avGFP homolog identified, the coding region was identified and a synthetic gene was designed to produce the encoded polypeptide sequence using codons optimized for both human and Escherichia coli expression using an in-house BioXp 3200 instrument (SGI-DNA, La Jolla, CA) or ordered as a gBlock double-stranded gene fragment (Integrated DNA Technologies, San Diego, CA). Both PCR-amplified and synthetic cDNAs contained additional nucleotides at the 5′ end (GAAAACCTGTACTTCCAGGGT) and 3′ end (CGTTTGATCCGGCTGC). Fragments encoding FPs were inserted using Gibson assembly [34] into the vector pNCST (modified from [35]) that had been PCR-amplified with the oligos pNCST-vec-F and pNCST-vec-R (Table H in S1 Text). The pNCST plasmid contains a synthetic promoter that drives high-level constitutive expression in most E. coli strains. This plasmid encodes an N-terminal 6xHis tag and linker followed by a TEV protease cleavage site just before the start codon of the inserted gene. Site-directed mutagenesis of AvicFP1 was performed by generating 2 fragments of the FP coding sequence by standard PCR with Phusion polymerase (New England Biolabs) and primers as listed in Table H in S1 Text. Mutations were placed in the overlapping sequence between fragments to facilitate Gibson assembly of full-length mutant sequences in a 1-step insertion into the pNCST vector. Plasmids encoding AausFP1, mAvicFP1, and fusions of mAvicFP1 to H2B, LifeAct, and CytERM driven by a CMV promoter for mammalian expression were generated by Gibson assembly of the PCR-amplified FP sequence with the corresponding PCR-amplified fragment of pC1-mNeonGreen, pmNeonGreen-H2B-N-6, pmNeonGreen-LifeAct, and pmNeonGreen-CytERM [35].

Recombinant protein purification

Sequence-verified plasmids were transformed into NEB5a strain E. coli (New England Biolabs) (because the promoter in the pNCST vector is semi-constitutive in most strains of E. coli, we find it convenient to use a single strain for cloning and expression), plated on LB/agar supplemented with carbenicillin (100 μg/ml), and incubated overnight at 37°C. For proteins that matured efficiently at 37°C (AvicFP-F64L, mAvicFP1, AvicFP4, AausFP1, AausFP2, EGFP, mEGFP, and mNeonGreen), colonies were picked and inoculated directly into a 200-ml baffled wide-mouth flask containing 50 ml of 2xYT broth and 100 μg/ml carbenicillin, and incubated overnight at 37°C with shaking at 250 rpm. For proteins requiring multiple days at room temperature to mature (avGFP, AvicFP1, AvicFP2, AvicFP3, AausFP3, and AausFP4), a single colony was resuspended in 10 ml of 2xYT medium, and 100 μl of this suspension was plated on 5 100-mm petri dishes containing LB/agar and 100 μg/ml carbenicillin. After overnight incubation at 37°C to initially establish colonies, plates were then incubated at room temperature for several days in the dark. Bacteria containing the recombinant protein were recovered by centrifuging liquid cultures in 50-ml conical tubes at 4,500g for 10 minutes. For proteins expressed on LB/agar plates, a razor blade was gently glided over the surface of the agar, harvesting the colonies on the blade, and then wiped into 2-ml microcentrifuge tubes and gently centrifuged to the bottom of the tube. Four milliliters of the lysis reagent B-PER (Thermo 78248) was added for every gram of E. coli pellet. Tubes were gently vortexed until the pellets were completely dissolved, taking care not to form bubbles from the detergent component of the B-PER. The resulting suspension was then incubated on a gentle rocker for 15 minutes and then centrifuged at >20,000g for 10 minutes to pellet insoluble debris. Note that we find that there is a strong correlation between true protein solubility and extraction efficiency in B-PER that is not true of other extraction methods such as sonication, which can solubilize aggregated FPs more readily. Meanwhile, we prepared a purification column by adding 1–2 ml of Ni-NTA resin slurry (Expedeon) into a 15-ml gravity column (Bio-Rad), allowing the storage buffer to drip through. The column was equilibrated with 10 bed volumes of wash buffer (150 mM Tris [pH 7.5], 300 mM NaCl, 5 mM imidazole) and then capped at the bottom. After centrifugation, the lysate was directly added to the prepared Ni-NTA column. The column was then capped at the top and the lysate-resin slurry was tumbled end-over-end for 30 minutes at 4°C. The top/bottom caps were removed, and the liquid was allowed to drip through by gravity flow. The column was then washed 3 times with 3 column volumes of wash buffer. Finally, the protein was eluted from the column by gradual addition of elution buffer (50 mM Tris [pH 7.5], 150 mM NaCl, 200 mM imidazole). Clear liquid was allowed to drip through, and only the fluorescent/colorful fraction was collected. The proteins were then concentrated further using a 3-kD MWCO column (Amicon/Millipore) until the volume of protein solution was <150 μl. Meanwhile, 2× desalting columns (Pierce) were prepared for each protein by equilibrating in 50 mM Tris (pH 8.5)/150 mM NaCl according to the manufacturer’s instructions. Then 150 μl of protein solution was loaded onto the equilibrated desalting column and centrifuged at 1,500 rpm for 1 minute in a microcentrifuge. The collected protein was then passed through a second equilibrated desalting column to ensure complete buffer exchange.

Mammalian cell imaging

Experiments performed in Dr. Shaner’s lab

U2-OS cells (HTB-96, ATCC) were grown in a 35-mm glass bottom dish (P35G-1.5-14-C, MatTek) or on coverslips (25CIRCLE #1.5, Fisherbrand) with DMEM (105666–016, Gibco) supplemented with 10% (v/v) FBS (10437–028, Gibco) under 5% humidified CO2 atmosphere at 37°C. Polyethylenimine (PEI) in double-distilled H2O (1 mg/ml (pH 7.3), 23966, Polysciences) was used as the transfection reagent. The transfection mixture was prepared in Opti-MEM (31985047, Thermo Fisher Scientific) with 4.5 μg of PEI and 500 ng of plasmid. For static images, a coverslip was placed in an Attofluor cell chamber (A7816, Invitrogen), and FluoroBrite DMEM (A18967-01, Gibco) was added. For time series, culture medium in glass bottom dishes was replaced with FluoroBrite DMEM (A18967-01, Gibco) supplemented with GlutaMAX (35050–061, Gibco) and 10% (v/v) FBS (10437–028, Gibco). Confocal images and time series were acquired on a Leica TCS SP8 system using a 488-nm argon laser for excitation. The sample was placed in an incubation chamber with a controlled environment at 37°C and 5% humidified CO2 (Okolab). For LifeAct-mAvicFP1, a 63×/1.40 oil objective (HC PL APO CS2 63×/1.40 Oil, 15506350) was used with an emission bandwidth of 500–550 nm detected with a Leica HyD. For time series, a bandwidth of 500–600 nm was used, and images were acquired at 4.6-second intervals (4× line averaging, pinhole at 510 nm, 1 A.U.). For single images of H2B-mAvicFP1, CytERM-mAvicFP1, and CytERM-mEGFP (Addgene 62237), a 20× 0.75 NA air objective (HC PL APO 20×/0.75 CS2, 15506517) was used with an emission bandwidth of 500–550 nm detected with a HyD. For time series of these constructs, a bandwidth of 500–600 nm was used, and images were acquired at 3-minute intervals (4× line averaging, pinhole at 510 nm, 1 A.U.).

Experiments performed at Harvard Medical School

U2-OS cells were grown on #1.5 35-mm glass bottom dishes (MatTek) in McCoy’s 5A medium supplemented with GlutaMAX (Thermo Fisher) and 10% fetal bovine serum (Thermo Fisher) and transfected with 0.5 μg of pCytERM-mAvicFP1 and pCytERM-mEGFP plasmid DNA using fuGENE (Promega) 24 hours prior to imaging. Before imaging, the growth medium was replaced with FluoroBrite DMEM supplemented with 5% FBS (Thermo Fisher). Image acquisition was performed in a full environmental enclosure (37°C, 5% CO2; Okolab) on a Nikon Ti-E microscope with Perfect Focus System, a Spectral Borealis-modified spinning disc confocal (Yokogawa X1), and an Orca Flash v3 sCMOS camera (Hamamatsu). OSER data were acquired with a 40× Plan Fluor 1.3 NA objective lens, and live time-lapse imaging was acquired with a 100× Plan Apo VC 1.4 NA objective (162-nm and 65-nm pixel size, respectively). Green fluorescence was excited with a 491-nm solid state laser (Cobolt) and a Di01-T405/488/568/647 (Semrock) dichroic; emission was selected with an ET525/50m filter (Chroma). Hardware was controlled with MetaMorph (v7.8.13). For time-lapse experiments, single-plane images were acquired every second. For OSER acquisition, a uniform grid of images was acquired covering the entire coverslip. Images were processed with Fiji [36]. OSER assay analysis was conducted as previously described [19].

Cell division assay

U2-OS cells were grown and transfected as described above with plasmids encoding an N-terminal fusion of H2B to either mEGFP [18], AausFP1, or mAvicFP1, all with identical linker sequences. Prior to imaging, cells were stained with SiR-Hoechst (Cytoskeleton) following the manufacturer’s instructions and maintaining a low concentration of stain in the medium throughout imaging. Cells were imaged on a Leica TCS SP8 system with an Okolab environmental chamber, as described above, starting 12–24 hours post-transfection. Images were collected every 2 minutes for >72 hours using 488-nm excitation with green emission to detect the H2B fusions, and with 633-nm excitation and far-red emission for the SiR-Hoechst stain to detect all DNA. For analysis, cells were selected from those expressing H2B and that underwent 1 cell division in the first half of the experiment. Control cells were selected from those neighboring the selected H2B-FP-expressing cells. The interval between cell divisions, defined as the time between visible chromosome separation, was recorded for the 2 daughter cells of each original cell.

Photostability assay

U2-OS cells were grown and transfected as described above with plasmids encoding full-length untagged mEGFP, AausFP1, or mAvicFP1. Cells were imaged on a Leica SP8 laser scanning confocal microscope with a 63×/1.40 oil objective (HC PL APO CS2 63×/1.40 Oil, 15506350) at 37°C and humidified 5% CO2, as described above, with 488-nm argon laser illumination and an emission bandwidth of 500–700 nm detected with a photomultiplier tube. The pinhole was set to 2 A. U. at 510 nm to illuminate a thicker optical section of the cytoplasm at high intensity, at least partly accounting for diffusion of FP molecules in and out of the focal plane. For widefield photobleaching, cells were imaged on a Nikon Ti-E microscope with a 40×/0.95 PL APO air objective, Perfect Focus System, a Spectra X light source (Lumencor) set to 470/24-nm bandpass excitation, 495-nm dichroic, 520/35-nm emission filter, and an Orca Flash v4 camera (Hamamatsu). Cells were imaged approximately 48 hours after transfection, with focusing using white light or very low power fluorescence excitation (≥1% imaging intensity for ≥5 seconds) to prevent pre-bleaching of the FPs. The full-power light intensity at the sample plane was measured using a power meter (model 843-R, Newport), and the illumination spectrum at the objective was measured using a mini spectrometer fitted with a fiber optic input (Hamamatsu). For confocal bleaching, the light intensity measured at the objective was 250 μW. For widefield bleaching, the intensity at the objective was 10.3 mW. Cells were imaged for 8–10 minutes with continuous illumination (widefield) or continuous laser scanning (confocal). This was sufficient time to achieve >90% loss in fluorescence in most cases. Image stacks were processed with Fiji [36], first by registering them with the StackReg plugin [37] to eliminate any artifacts caused by drift. A region of interest (ROI) was defined in the cytoplasm of each cell as well as a background region. We then measured the mean intensity of each ROI over the image stack and interpolated to determine the time value corresponding to 50% of the initial fluorescence signal for each cell. Photobleaching half-times were then scaled by a correction factor that corresponds to the per-molecule brightness of each FP under the specific illumination condition. For confocal bleaching, the correction factor corresponds to the molar extinction coefficient at 488 nm. For widefield bleaching, the correction factor depends on both the absorbance spectrum of the FP and the illumination spectrum at the objective: where ϕ is the quantum yield, I(λ) is the illumination intensity, and A(λ) is the absorbance of the FP. In both cases, the correction factor normalizes the photobleaching half-times to those that would be observed if the excitation were tuned to produce equal photon output per FP molecule at time 0. These experiments and the analysis of the resulting data are discussed in more detail in S1 Text.

Quantum yield and extinction coefficient determination

Purified green-emitting FPs were characterized as previously described [38] to determine quantum yield. Briefly, FPs that had been buffer-exchanged into 50 mM Tris-HCl (pH 8.5)/150 mM NaCl were diluted into the same buffer until the baselined peak absorbance was ≤0.05 as measured by a UV-2700 UV-Vis spectrophotometer (Shimadzu). Sample and standard (fluorescein in 0.1 M NaOH, quantum yield 0.95 [39]) absorbance were matched within 10% at 480 nm, the excitation wavelength used for fluorescence emission spectra. Immediately after measuring the absorbance spectrum, the cuvette containing the sample was transferred to a Fluorolog-3 fluorimeter (Jobin Yvon), and the emission spectrum was taken from 460 nm to 700 nm in 1-nm steps, with excitation at 480 nm and a slit width of 2 nm for both excitation and emission. Emission spectra were interpolated under the region in which scattered excitation light bleeds through into the emission path. Quantum yield was calculated by dividing the area under the sample emission curve by its absorbance at 480 nm and dividing by the same ratio for the standard, then multiplying by 0.95, the quantum yield of the standard. Extinction coefficients for all FPs and CPs in this study were measured using the accepted standard method of measuring FP extinction coefficients, with alkali denaturation (addition of 2 M NaOH to the FP sample to a final concentration of 1 M NaOH) as previously described [38]. This method relies on the denatured chromophore absorbance and extinction coefficient to be invariant between FPs with chemically identical chromophores, and allows calculation of the extinction coefficient of the natively folded protein by comparing the peak height between native and denatured absorbance spectra. We performed this assay with the following modifications: (1) In order to avoid calculating erroneously large values of FP extinction coefficients from alkali denaturation measurements, several absorbance spectra were taken for each sample. Beginning immediately after addition of NaOH, multiple absorbance spectra were taken over several minutes to determine both the point at which the protein was fully denatured and the point at which it reached maximum absorbance at approximately 447 nm. The maximum measured value of the peak absorbance of fully denatured protein was used in extinction coefficient calculations. (2) For CPs containing the novel cysteine-linked chromophore, the peak absorbance of alkali-denatured protein is red-shifted 20–30 nm relative to the known 447-nm peak of GFP-type chromophores [2]. Because the extinction coefficient of this species is unknown, we also measured absorbance spectra for alkali-denatured CPs with the addition of 1 mM β-mercaptoethanol, which is expected to break the bond between the sulfur atom of the cysteine side chain and the methylene bridge of the chromophore, producing a GFP-type denatured chromophore. The maximum absorbance value of reduced, denatured chromophore was used in calculation of the extinction coefficient, which should be considered an estimate for Aequorea CPs pending much deeper investigation into the biochemical properties of their unique chromophore.

pKa determination

Purified proteins were concentrated and desalted as described above into 20 mM Tris-HCl (pH 8). A solution of 50 mM Tris-HCl, 50 mM citric acid, 50 mM glycine, and 150 mM NaCl (final concentrations after pH adjustment) was prepared and split into 2 master stocks that were adjusted to pH 3 and pH 12 with HCl and NaOH, respectively. These stocks were then used to prepare buffers at pH 3, 4, 5, 6, 6.5, 7, 7.25, 7.5, 7.75, 8, 9, 10, 11, and 12 by mixing at different ratios. Each sample was then diluted (2 μl of sample + 198 μl of buffer) into each pH buffer, and its emission or absorbance was measured using an Infinite M1000 PRO (Tecan) plate reader. The pKa was determined by interpolating the pH value at which the fluorescence or absorbance value was 50% of its maximum.

Size-exclusion chromatography and light scattering

Two milligrams of purified protein in 100 ul of running buffer was applied to a Shodex KW-802.5 column with guard column KW-G 6B (Showa Denko America, New York, NY) and run in 50 mM Na-HEPES/150 mM NaCl (pH 7.35) at a flow rate of 0.5 ml/minute using an Agilent 1100 Series HPLC system controlled by ChemStation software (Agilent Technologies, Santa Clara, CA). Protein elution was dually monitored with 280-nm absorbance and at the absorbance maxima for each fluorescent protein. In-line light scattering was performed by a Wyatt Heleos system running ASTRA software (Wyatt Technology, Goleta, CA). Clinical-grade cetuximab used as a molecular weight standard was obtained from the UCSD Moores Cancer Center pharmacy.

Protein crystallogenesis

AausFP1 and AausFP2 were first expressed and purified as aforementioned. The His-tag was cleaved off using either TEV for AausFP1 (1/100 protease/protein ratio, overnight incubation at room temperature) or proteinase K for AausFP2 (1/50 protease/protein ratio, 1-hour incubation at room temperature). The protein solution was run through an additional His-Trap column to remove cleaved tag and uncleaved protein. A final purification step consisted of a gel filtration column (Superdex 75-10/300 GL, GE Healthcare, Chicago, IL). Fractions were analyzed using 15% SDS-PAGE gels, pooled and concentrated to 40 and 51 mg/ml for AausFP1 and AausFP2, respectively, using an Amicon Ultra centrifugal filter with a molecular weight cutoff of 30 kDa (Merck, Darmstadt, Germany). Initial crystallization hits were obtained using the HTX lab platform of the EMBL Grenoble Outstation, and then manually optimized. AausFP1 was crystallized with the hanging drop method using 0.7–1.3 M trisodium citrate, 0.2 M sodium chloride in 0.1M Tris buffer (pH 6.5–8.0). AausFP2 was crystallized with the hanging drop method using 14%–24% PEG 3350 trisodium citrate and 0.2 M sodium chloride in 0.1 M HEPES buffer (pH 7.3–8.2).

Diffraction data collection

Diffraction data for AausFP1 were collected on beamline BL13-XALOC at the ALBA synchrotron in Barcelona (Spain) [40] from a crystal flash-cooled at 100 K in its mother liquor supplemented with 20% (v/v) glycerol for cryoprotection. Diffraction data for AausFP2 were collected on beamline ID30B of the European Synchrotron Radiation Facility in Grenoble (France) [41] from a crystal flash-cooled at 100 K without addition of any cryoprotectant. Diffraction data were integrated and reduced using XDS and XSCALE [42]. Data collection and reduction statistics are given in Table C in S1 Text.

Structure determination

A BLAST search (https://blast.ncbi.nlm.nih.gov/) identified the fluorescent protein phiYFPv from the jellyfish genus Phialidium as the closest homolog of both AausFP1 and AausFP2 (sequence identities of 61% and 50%, respectively) with a known structure (PDB entry code 4HE4 [43]). The structures of AausFP1 and AausFP2 were solved by the molecular replacement method using the 4HE4 coordinates as a search model with the program PHASER [44]. The model was progressively and interactively modified in COOT [45] and refined with REFMAC5 [46]. The asymmetrical units contain 4 molecules for AausFP1 and 1 molecule for AausFP2. Analysis of the interaction interfaces with PISA [47] strongly suggests that the AausFP1 tetramer consists of a dimer of a physiological dimer (interface areas of 1,210 Å2 versus 360 Å2 for the third and fourth largest areas), while the AausFP2 monomer forms a physiological dimer with a symmetry-related molecule (interface area of 1,290 Å2 versus 540 Å2 for the second largest area). Structure refinement statistics are given in Table C in S1 Text.

Calculation of AausFP2 absorption maxima

Eight models of the minimal part of the chromophore were constructed, modeling only the 2 conjugated cycles of the chromophore. H atoms replaced in all models the 2 alpha carbon atoms linking the chromophore to the rest of the protein. 3D coordinates for all heavy atoms of the chromophore were taken from the crystallographic structures without optimization, leading to 2 groups of models, one with the conformation of the EGFP structure and one with the conformation of the AausFP2 structure. The corresponding sets of models were labeled EGFP and AausFP2. The main difference between the 2 sets of models is the dihedral angle between the 2 cycles, i.e., −2° (almost planar) for EGFP and −53° (twisted) for AausFP2. In each set of models, the phenol moiety was presented in its protonated form (neutral chromophore) or phenolate form (anionic chromophore). Moreover, in the AausFP2 set, the carbon between the 2 cycles of chromophore is linked to a protein’s cysteine through a thioether bond, whereas this carbon is simply protonated in the case of EGFP. Therefore, in the models, this carbon was linked either to a mercapto group (–SH) or simply protonated. Structures were protonated and the position of H atoms were optimized at the B3LYP/6-31+g(d,p) level of theory with the Gaussian G09 program.

Software

The web-based data-plotting software PlotsOfData [48] was used to generate Figs Y, Z, and AA in S1 Text.

Ethics statement

All scientific collection in the field was performed under permit G17/39943.1 granted to Dr. Anya Salih, Western Sydney University, by the Great Barrier Reef Marine Park Authority. A specimen of A. cf. australis was collected within the Scientific Research Zone surrounding Heron Island (Queensland, Australia) using a hand-held net and was transported back to the lab in seawater. Live samples were kept in fresh running seawater for minimal amounts of time after collection.

Raw cell division and photobleaching data and corresponding analysis for Fig Y, Z, and AA in S1 Text.

(XLSX) Click here for additional data file.

16S phylogenetic tree.

The 16S tree is inconclusive as to the phylogenetic position of both the transcriptomic 16S sequences and the reference-guided assembly 16S sequence. Several species are monophyletic in this tree and A. australis is in a large polytomy. See S1 Text for additional discussion. (PDF) Click here for additional data file.

COI phylogenetic tree.

The COI tree shows that the reference-corrected COI sequence (sample_COI) is sister to a large A. australis clade. See S1 Text for additional discussion. (PDF) Click here for additional data file.

Confocal imaging of H2B-mAvicFP1 expressed in U2-OS cells.

Scale bar is 10 mm. Timestamp is in hours:minutes. Images were taken at 3-minute intervals. Video playback is at 14 frames per second (total imaging duration 3 hours 9 minutes). Raw imaging data used to generate this movie are available at https://doi.org/10.26300/4x48-y393. (MOV) Click here for additional data file.

Confocal imaging of LifeAct-mAvicFP1 expressed in U2-OS cells.

Scale bar is 5 mm. Timestamp is in hours:minutes. Images were taken at 4.6-second intervals. Video playback is at 100 frames per second (total imaging duration 4 hours 35 minutes). Raw imaging data used to generate this movie are available at https://doi.org/10.26300/4x48-y393. (MOV) Click here for additional data file.

Supporting materials and methods, results, and discussion.

(PDF) Click here for additional data file. 8 Nov 2019 Dear Dr Shaner, Thank you for submitting your manuscript entitled "Aequorea victoria's secrets: diverse and unusual fluorescent protein genes beyond GFP" for consideration as a Research Article by PLOS Biology. Your manuscript has now been evaluated by the PLOS Biology editorial staff, as well as by an academic editor with relevant expertise, and I'm writing to let you know that we would like to send your submission out for external peer review. IMPORTANT: We note that you've submitted this as a regular Research Article, but we feel it would be better considered as a Methods and Resources paper. No re-formatting is required at this stage, but please select "Methods and Resources" as the article type when you submit your remaining metadata (see next paragraph). However, before we can send your manuscript to reviewers, we need you to complete your submission by providing the metadata that is required for full assessment. To this end, please login to Editorial Manager where you will find the paper in the 'Submissions Needing Revisions' folder on your homepage. Please click 'Revise Submission' from the Action Links and complete all additional questions in the submission questionnaire. Please re-submit your manuscript within two working days, i.e. by Nov 11 2019 11:59PM. Login to Editorial Manager here: https://www.editorialmanager.com/pbiology During resubmission, you will be invited to opt-in to posting your pre-review manuscript as a bioRxiv preprint. Visit http://journals.plos.org/plosbiology/s/preprints for full details. If you consent to posting your current manuscript as a preprint, please upload a single Preprint PDF when you re-submit. Once your full submission is complete, your paper will undergo a series of checks in preparation for peer review. Once your manuscript has passed all checks it will be sent out for review. Feel free to email us at plosbiology@plos.org if you have any queries relating to your submission. Kind regards, Roli Roberts Roland G Roberts, PhD, Senior Editor PLOS Biology 8 Jan 2020 Dear Dr Shaner, Thank you very much for submitting your manuscript "Aequorea victoria's secrets: diverse and unusual fluorescent protein genes beyond GFP" for consideration as a Methods and Resources paper at PLOS Biology. Your manuscript has been evaluated by the PLOS Biology editors, an Academic Editor with relevant expertise, and by four independent reviewers. Please accept our apologies for the delay incurred over the holiday period. IMPORTANT: You'll see that while reviewers #1, #2 and #3 are broadly positive about your study, they each make further requests for improvements. Reviewer #4 is less positive, but may not have been considering this paper as a candidate for our Methods and Resources section; however, after discussion with the Academic Editor, we ask that you do address the concerns and requests raised by reviewer #4. We would also echo reviewer #1's concerns about the unusual organisation of your manuscript, which we think our readers will find very unclear; please rectify this. In light of the reviews (below), we will not be able to accept the current version of the manuscript, but we would welcome re-submission of a much-revised version that takes into account all of the reviewers' comments. We cannot make any decision about publication until we have seen the revised manuscript and your response to the reviewers' comments. Your revised manuscript is also likely to be sent for further evaluation by the reviewers. We expect to receive your revised manuscript within 2 months. Please email us (plosbiology@plos.org) if you have any questions or concerns, or would like to request an extension. At this stage, your manuscript remains formally under active consideration at our journal; please notify us by email if you do not intend to submit a revision so that we may end consideration of the manuscript at PLOS Biology. **IMPORTANT - SUBMITTING YOUR REVISION** Your revisions should address the specific points made by each reviewer. Please submit the following files along with your revised manuscript: 1. A 'Response to Reviewers' file - this should detail your responses to the editorial requests, present a point-by-point response to all of the reviewers' comments, and indicate the changes made to the manuscript. *NOTE: In your point by point response to to the reviewers, please provide the full context of each review. Do not selectively quote paragraphs or sentences to reply to. The entire set of reviewer comments should be present in full and each specific point should be responded to individually, point by point. You should also cite any additional relevant literature that has been published since the original submission and mention any additional citations in your response. 2. In addition to a clean copy of the manuscript, please also upload a 'track-changes' version of your manuscript that specifies the edits made. This should be uploaded as a "Related" file type. *Re-submission Checklist* When you are ready to resubmit your revised manuscript, please refer to this re-submission checklist: https://plos.io/Biology_Checklist To submit a revised version of your manuscript, please go to https://www.editorialmanager.com/pbiology/ and log in as an Author. Click the link labelled 'Submissions Needing Revision' where you will find your submission record. Please make sure to read the following important policies and guidelines while preparing your revision: *Published Peer Review* Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out. Please see here for more details: https://blogs.plos.org/plos/2019/05/plos-journals-now-open-for-published-peer-review/ *PLOS Data Policy* Please note that as a condition of publication PLOS' data policy (http://journals.plos.org/plosbiology/s/data-availability) requires that you make available all data used to draw the conclusions arrived at in your manuscript. If you have not already done so, you must include any data used in your manuscript either in appropriate repositories, within the body of the manuscript, or as supporting information (N.B. this includes any numerical values that were used to generate graphs, histograms etc.). For an example see here: http://www.plosbiology.org/article/info%3Adoi%2F10.1371%2Fjournal.pbio.1001908#s5 *Blot and Gel Data Policy* We require the original, uncropped and minimally adjusted images supporting all blot and gel results reported in an article's figures or Supporting Information files. We will require these files before a manuscript can be accepted so please prepare them now, if you have not already uploaded them. Please carefully read our guidelines for how to prepare and upload this data: https://journals.plos.org/plosbiology/s/figures#loc-blot-and-gel-reporting-requirements *Protocols deposition* To enhance the reproducibility of your results, we recommend that if applicable you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosbiology/s/submission-guidelines#loc-materials-and-methods Thank you again for your submission to our journal. We hope that our editorial process has been constructive thus far, and we welcome your feedback at any time. Please don't hesitate to contact us if you have any questions or comments. Sincerely, Roli Roberts Roland G Roberts, PhD, Senior Editor PLOS Biology ***************************************************** REVIEWERS' COMMENTS: Reviewer #1: The manuscript by Lambert et al. notifies us of nature's profundity. The Aequorea victoria jelly fish species, which provided us with the avGFP, has proven to possess some additional novel fluorescent proteins (FPs). I agree to the last paragraph of the main text in that we now need to explore and understand as much of the molecular biodiversity of glowing creatures. I found the manuscript somehow disorganized. It was difficult to follow the logic in the Introduction, Results and Discussion. I'd recommend that the manuscript be rewritten more carefully. My comments are as follows. 1) None of supplementary data (figures and tables) are referred to in the main text. Also, the Introduction contains some results; Figures 2 and 3 are already referred to there. 2) Page 2, right, line 5. Please define "AausFP." It should be "A. cf. australis FP." 3) Figure 2. What were the concentrations of the protein samples? 4) Page 2, right, lines 19-. The low pKa of AvicFP1, which contains CYG, is explained by analogy to the S65C mutant of avGFP. I think, however, this portion is too speculative. 5) Page 3, left, line 27. I think that doubling time of H2B-mAvicFP1 should be provided. 6) Page 3. "It is somewhat ironic that,,," avGFP absorbs principally violet light (400 nm) for the green fluorescence whereas AvicFP1 absorbs blue light. I would rather discuss why avGFP is abundant in A. victoria. 7) Why aren't the two CPs from A. cf. australis called AausCP2 and AausCP3? 8) Figure 3. The dotted lines for unconverted spectra are very hard to see. 9) Figure 4. Hard to see. I would recommend that a relatively simple phylogenic tree be put. 10) Page 4, left, lines 10-. Why are the tandem-dimers and monomers hidden? 11) Page 5, right. About the photoconversion of AvicFP2 and AvicFP3. Could the authors identify the blue-absorption peaks for photoconversion in Figure 1? Also, I am negative on their "rapid" photoconversion, considering that It took seconds to minutes. Ideally, the authors should measure the quantum efficiency of the conversion. 12) There is no information of photostability of the new FPs. To show their practical usefulness, photobleaching data must be presented. Reviewer #2: The work presented in this excellent manuscript involved a collaborative team finding and analysing a new suite of fluorescent proteins from the original Aequorea victoria and a related Aequorea species. The group identified a number of new, interesting and potentially useful fluorescent proteins. Two of these were further characterized by structural biology to provide interesting insights into the molecular basis of function. I guess the most interest going forward is AausFP1 in terms of its overall brightness (which is authors has eluded too), but I am sure there is a lot to be learned (for both fundamental and long-term application) from the others. Overall, I thought this was an excellent piece of work with very little to argue with - the science was excellent and I enjoyed reading the manuscript. It is clear that this work is publishable in PLoS Biology as it stands. My reason for minor revisions is that I suggest a couple of changes (and they are minor in the scheme of things). 1. Oligomerisation can play an important role in the spectral properties of fluorescent proteins. As I read it, apart from the engineered mAvicFP1, all the other proteins were oligomers. Do the authors have other data than OSER to confirm the oligomeric status of the proteins (e.g. size exclusion, dynamic light scattering)? Some information is inferred from the two crystal structures but such data can sometimes be a little misleading in terms of oligomeric state in solution. It might also be worth adding a column to Table 1 to state the oligomeric form of each fluorescent protein. 2. Leading on from point 1, it is known that oligomerisation of normally monomeric fluorescent proteins can impact of the spectral characteristics. AausFP1 may be a good example (although given the comments in the manuscript, there is more to be told on this at a later date). A recent good example is DOI: 10.1038/s42004-019-0185-5 concerning how oligomerisation can have a positive impact on GFP properties. It might be good to include such information. 3. Very little is said about maturation times expect that in the methods it appears that certain variants matured at different rates. Could the authors add which proteins matured under which particular conditions. 4. While I don't dispute the extinction coefficients measured, I was surprised to see that the proteins where denatured to calculate them. Did the authors look at the values for the native proteins? Reviewer #3: This is a very valuable resource to the scientific community in that it identifies a number of new sequences for fluorescent proteins and chromoproteins and characterizes the basic properties of those proteins. These sequences increase the diversity of naturally derived sequences and could be useful for incorporating into efforts aimed at gene shuffling. The paper is clearly written and the resource and results are logically presented. I don't find any flaws with the analysis or presentation. The only thing I would request is that the axes in Figure 3 and the size of Figure 4 be increased because the text isn't legible. Otherwise I think this paper makes a valuable contribution to the scientific community and I support its publication. Reviewer #4: Lambert G.G. et al. cloned homolog genes of the Aequorea Victoria GFP from Aequorea sp. by mRNA-Seq and de novo transcriptome assembly. Isolated fluorescent proteins (FPs) and chromo proteins (CPs) were characterized, and distinct features such as a chromophore with a crosslink to the main polypeptide chain and reversibly photoswitchability were identified. To be honest, I got an impression to this manuscript such that the principal claim of the authors is unclear and it seems like a catalog of the FPs and CPs released from the author's group. To discuss the molecular evolution, meticulous comparison with FP/CPs derived from multiple species in the Aequorea sp. is essential. Meanwhile, for claiming the applicability of FP/CPs as a valuable resource for bioimaging, availability to the practical imaging technique using their distinct features must be shown. However, the authors did not seriously address these issues. Therefore, it is difficult to be accepted as a paper worthy to publish from this journal. I recommend for authors to submit this manuscript to much more specific journal. Minor points: 1. The descRiption in the Introduction section is not match with the contents in the Results and Discussion section. 2. There are many Supplementary Materials which are not cited in the text. 3. Fig. S12 and Fig. S-A to I in Supplementary Materials are unclear to make out the letters in the figures. 21 Aug 2020 Submitted filename: Response to Reviewers PLoS Biology Revision 8-2020.pdf Click here for additional data file. 16 Sep 2020 Dear Dr Shaner, Thank you for submitting your revised Methods and Resources entitled "Aequorea victoria's secrets: diverse and unusual fluorescent protein genes beyond GFP" for publication in PLOS Biology. I've now obtained advice from one of the original reviewers and have discussed their comments with the Academic Editor. Based on the reviews, we will probably accept this manuscript for publication, assuming that you will modify the manuscript to address the remaining points raised by the reviewer. IMPORTANT: a) As well as the remaining points from reviewer #1, please could you attend to my Data Policy requests further down this email? b) I'm afraid that after some discussion, we think that your title is not appropriate or informative enough. Specifically, while we appreciate the neat pun, we think that the allusion to a company whose products could be seen by many readers as objectifying women is not appropriate. Maybe something like "New jellyfish fluorescent proteins with unique properties for bioimaging and biosensing"? We expect to receive your revised manuscript within two weeks. Your revisions should address the specific points made by each reviewer. In addition to the remaining revisions and before we will be able to formally accept your manuscript and consider it "in press", we also need to ensure that your article conforms to our guidelines. A member of our team will be in touch shortly with a set of requests. As we can't proceed until these requirements are met, your swift response will help prevent delays to publication. To submit your revision, please go to https://www.editorialmanager.com/pbiology/ and log in as an Author. Click the link labelled 'Submissions Needing Revision' to find your submission record. Your revised submission must include the following: - a cover letter that should detail your responses to any editorial requests, if applicable - a Response to Reviewers file that provides a detailed response to the reviewers' comments (if applicable) - a track-changes file indicating any changes that you have made to the manuscript. *Copyediting* Upon acceptance of your article, your final files will be copyedited and typeset into the final PDF. While you will have an opportunity to review these files as proofs, PLOS will only permit corrections to spelling or significant scientific errors. Therefore, please take this final revision time to assess and make any remaining major changes to your manuscript. NOTE: If Supporting Information files are included with your article, note that these are not copyedited and will be published as they are submitted. Please ensure that these files are legible and of high quality (at least 300 dpi) in an easily accessible file format. For this reason, please be aware that any references listed in an SI file will not be indexed. For more information, see our Supporting Information guidelines: https://journals.plos.org/plosbiology/s/supporting-information *Published Peer Review History* Please note that you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out. Please see here for more details: https://blogs.plos.org/plos/2019/05/plos-journals-now-open-for-published-peer-review/ *Early Version* Please note that an uncorrected proof of your manuscript will be published online ahead of the final version, unless you opted out when submitting your manuscript. If, for any reason, you do not want an earlier version of your manuscript published online, uncheck the box. Should you, your institution's press office or the journal office choose to press release your paper, you will automatically be opted out of early publication. We ask that you notify us as soon as possible if you or your institution is planning to press release the article. *Protocols deposition* To enhance the reproducibility of your results, we recommend that if applicable you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosbiology/s/submission-guidelines#loc-materials-and-methods Please do not hesitate to contact me should you have any questions. Sincerely, Roli Roberts Roland G Roberts, PhD, Senior Editor, rroberts@plos.org, PLOS Biology ------------------------------------------------------------------------ DATA POLICY: You may be aware of the PLOS Data Policy, which requires that all data be made available without restriction: http://journals.plos.org/plosbiology/s/data-availability. For more information, please also see this editorial: http://dx.doi.org/10.1371/journal.pbio.1001797 Note that we do not require all raw data. Rather, we ask that all individual quantitative observations that underlie the data summarized in the figures and results of your paper be made available in one of the following forms: 1) Supplementary files (e.g., excel). Please ensure that all data files are uploaded as 'Supporting Information' and are invariably referred to (in the manuscript, figure legends, and the Description field when uploading your files) using the following format verbatim: S1 Data, S2 Data, etc. Multiple panels of a single or even several figures can be included as multiple sheets in one excel file that is saved using exactly the following convention: S1_Data.xlsx (using an underscore). 2) Deposition in a publicly available repository. Please also provide the accession code or a reviewer link so that we may view your data before publication. We note that many of your Fig panels are photos, or present structural, phylogenetic, sequence or spectral data, all of which are available in the supplement or in repositories. However, we also need you to provide the underlying data for Figs S14, S15, S16. NOTE: the numerical data provided should include all replicates AND the way in which the plotted mean and errors were derived (it should not present only the mean/average values). Please also ensure that figure legends in your manuscript include information on where the underlying data can be found (including repositories), and ensure your supplemental data file/s has a legend. Please ensure that your Data Statement in the submission system accurately describes where your data can be found. ------------------------------------------------------------------------ BLOT AND GEL REPORTING REQUIREMENTS: For manuscripts submitted on or after 1st July 2019, we require the original, uncropped and minimally adjusted images supporting all blot and gel results reported in an article's figures or Supporting Information files. We will require these files before a manuscript can be accepted so please prepare and upload them now. Please carefully read our guidelines for how to prepare and upload this data: https://journals.plos.org/plosbiology/s/figures#loc-blot-and-gel-reporting-requirements ------------------------------------------------------------------------ REVIEWERS' COMMENTS: Reviewer #1: This is an omnibus study that covers fluorescent proteins and chromoproteins from Aequorea species, and I agree that AausFP1 would be the top candidate for future engineering because of its extreme brightness. I think that the revised manuscript should be almost publishable. I have two minor criticisms as follows. I was interested in the observation that AvicFP1 was localized in the body and mouth but not the bell margin where the Aequorin-based bioluminescence occurs. Page 3, right. Lines 18- "We can only speculate about what biological imaging might look like today if AvicFP1, rather than avGFP, had been the first FP cloned." This is a vague sentence. I would suggest that the authors refer to the fact that avGFP was originally discovered as a protein accompanying Aequorin. Page 4, left. "To our knowledge, there have been no previous reports of chromoproteins with a quantum yield of absolutely zero." Please specify quantum yield values of AausFP2 and AausFP3 compared to others. 9 Oct 2020 Submitted filename: Response to Reviewers PLoS Biology Revision 9-2020.pdf Click here for additional data file. 15 Oct 2020 Dear Dr Shaner, On behalf of my colleagues and the Academic Editor, Ana J Garcia-Saez, I am pleased to inform you that we will be delighted to publish your Methods and Resources in PLOS Biology. The files will now enter our production system. You will receive a copyedited version of the manuscript, along with your figures for a final review. You will be given two business days to review and approve the copyedit. Then, within a week, you will receive a PDF proof of your typeset article. You will have two days to review the PDF and make any final corrections. If there is a chance that you'll be unavailable during the copy editing/proof review period, please provide us with contact details of one of the other authors whom you nominate to handle these stages on your behalf. This will ensure that any requested corrections reach the production department in time for publication. Early Version The version of your manuscript submitted at the copyedit stage will be posted online ahead of the final proof version, unless you have already opted out of the process. The date of the early version will be your article's publication date. The final article will be published to the same URL, and all versions of the paper will be accessible to readers. PRESS We frequently collaborate with press offices. If your institution or institutions have a press office, please notify them about your upcoming paper at this point, to enable them to help maximise its impact. If the press office is planning to promote your findings, we would be grateful if they could coordinate with biologypress@plos.org. If you have not yet opted out of the early version process, we ask that you notify us immediately of any press plans so that we may do so on your behalf. We also ask that you take this opportunity to read our Embargo Policy regarding the discussion, promotion and media coverage of work that is yet to be published by PLOS. As your manuscript is not yet published, it is bound by the conditions of our Embargo Policy. Please be aware that this policy is in place both to ensure that any press coverage of your article is fully substantiated and to provide a direct link between such coverage and the published work. For full details of our Embargo Policy, please visit http://www.plos.org/about/media-inquiries/embargo-policy/. Thank you again for submitting your manuscript to PLOS Biology and for your support of Open Access publishing. Please do not hesitate to contact me if I can provide any assistance during the production process. Kind regards, Erin O'Loughlin Publishing Editor, PLOS Biology on behalf of Roland Roberts, Senior Editor PLOS Biology
  46 in total

1.  MRBAYES: Bayesian inference of phylogenetic trees.

Authors:  J P Huelsenbeck; F Ronquist
Journal:  Bioinformatics       Date:  2001-08       Impact factor: 6.937

2.  Multi-domain GFP-like proteins from two species of marine hydrozoans.

Authors:  Marguerite E Hunt; Chintan K Modi; Galina V Aglyamova; D V S Ravikant; Eli Meyer; Mikhail V Matz
Journal:  Photochem Photobiol Sci       Date:  2012-01-18       Impact factor: 3.982

3.  The first mutant of the Aequorea victoria green fluorescent protein that forms a red chromophore.

Authors:  Alexander S Mishin; Fedor V Subach; Ilia V Yampolsky; William King; Konstantin A Lukyanov; Vladislav V Verkhusha
Journal:  Biochemistry       Date:  2008-03-27       Impact factor: 3.162

4.  Fast gapped-read alignment with Bowtie 2.

Authors:  Ben Langmead; Steven L Salzberg
Journal:  Nat Methods       Date:  2012-03-04       Impact factor: 28.547

5.  Improved green fluorescence.

Authors:  R Heim; A B Cubitt; R Y Tsien
Journal:  Nature       Date:  1995-02-23       Impact factor: 49.962

6.  The Galaxy platform for accessible, reproducible and collaborative biomedical analyses: 2018 update.

Authors:  Enis Afgan; Dannon Baker; Bérénice Batut; Marius van den Beek; Dave Bouvier; Martin Cech; John Chilton; Dave Clements; Nate Coraor; Björn A Grüning; Aysam Guerler; Jennifer Hillman-Jackson; Saskia Hiltemann; Vahid Jalili; Helena Rasche; Nicola Soranzo; Jeremy Goecks; James Taylor; Anton Nekrutenko; Daniel Blankenberg
Journal:  Nucleic Acids Res       Date:  2018-07-02       Impact factor: 16.971

7.  Full-length transcriptome assembly from RNA-Seq data without a reference genome.

Authors:  Manfred G Grabherr; Brian J Haas; Moran Yassour; Joshua Z Levin; Dawn A Thompson; Ido Amit; Xian Adiconis; Lin Fan; Raktima Raychowdhury; Qiandong Zeng; Zehua Chen; Evan Mauceli; Nir Hacohen; Andreas Gnirke; Nicholas Rhind; Federica di Palma; Bruce W Birren; Chad Nusbaum; Kerstin Lindblad-Toh; Nir Friedman; Aviv Regev
Journal:  Nat Biotechnol       Date:  2011-05-15       Impact factor: 54.908

8.  Improving FRET dynamic range with bright green and red fluorescent proteins.

Authors:  Amy J Lam; François St-Pierre; Yiyang Gong; Jesse D Marshall; Paula J Cranfill; Michelle A Baird; Michael R McKeown; Jörg Wiedenmann; Michael W Davidson; Mark J Schnitzer; Roger Y Tsien; Michael Z Lin
Journal:  Nat Methods       Date:  2012-09-09       Impact factor: 28.547

9.  A bright monomeric green fluorescent protein derived from Branchiostoma lanceolatum.

Authors:  Nathan C Shaner; Gerard G Lambert; Andrew Chammas; Yuhui Ni; Paula J Cranfill; Michelle A Baird; Brittney R Sell; John R Allen; Richard N Day; Maria Israelsson; Michael W Davidson; Jiwu Wang
Journal:  Nat Methods       Date:  2013-03-24       Impact factor: 28.547

10.  Developments in optics and performance at BL13-XALOC, the macromolecular crystallography beamline at the ALBA synchrotron.

Authors:  Jordi Juanhuix; Fernando Gil-Ortiz; Guifré Cuní; Carles Colldelram; Josep Nicolás; Julio Lidón; Eva Boter; Claude Ruget; Salvador Ferrer; Jordi Benach
Journal:  J Synchrotron Radiat       Date:  2014-05-20       Impact factor: 2.616

View more
  9 in total

1.  Chromophore reduction plus reversible photobleaching: how the mKate2 "photoconversion" works.

Authors:  Elena A Protasova; Alexander S Mishin; Konstantin A Lukyanov; Eugene G Maksimov; Alexey M Bogdanov
Journal:  Photochem Photobiol Sci       Date:  2021-06-04       Impact factor: 3.982

2.  Endoplasmic reticulum tubules limit the size of misfolded protein condensates.

Authors:  Smriti Parashar; Ravi Chidambaram; Shuliang Chen; Christina R Liem; Eric Griffis; Gerard G Lambert; Nathan C Shaner; Matthew Wortham; Jesse C Hay; Susan Ferro-Novick
Journal:  Elife       Date:  2021-09-01       Impact factor: 8.140

3.  Using FPbase: The Fluorescent Protein Database.

Authors:  Talley J Lambert
Journal:  Methods Mol Biol       Date:  2023

4.  AlphaFold2 and RoseTTAFold predict posttranslational modifications. Chromophore formation in GFP-like proteins.

Authors:  Sophia M Hartley; Kelly A Tiernan; Gjina Ahmetaj; Adriana Cretu; Yan Zhuang; Marc Zimmer
Journal:  PLoS One       Date:  2022-06-16       Impact factor: 3.752

5.  Neurophotonic tools for microscopic measurements and manipulation: status report.

Authors:  Ahmed S Abdelfattah; Sapna Ahuja; Taner Akkin; Srinivasa Rao Allu; Joshua Brake; David A Boas; Erin M Buckley; Robert E Campbell; Anderson I Chen; Xiaojun Cheng; Tomáš Čižmár; Irene Costantini; Massimo De Vittorio; Anna Devor; Patrick R Doran; Mirna El Khatib; Valentina Emiliani; Natalie Fomin-Thunemann; Yeshaiahu Fainman; Tomas Fernandez-Alfonso; Christopher G L Ferri; Ariel Gilad; Xue Han; Andrew Harris; Elizabeth M C Hillman; Ute Hochgeschwender; Matthew G Holt; Na Ji; Kıvılcım Kılıç; Evelyn M R Lake; Lei Li; Tianqi Li; Philipp Mächler; Evan W Miller; Rickson C Mesquita; K M Naga Srinivas Nadella; U Valentin Nägerl; Yusuke Nasu; Axel Nimmerjahn; Petra Ondráčková; Francesco S Pavone; Citlali Perez Campos; Darcy S Peterka; Filippo Pisano; Ferruccio Pisanello; Francesca Puppo; Bernardo L Sabatini; Sanaz Sadegh; Sava Sakadzic; Shy Shoham; Sanaya N Shroff; R Angus Silver; Ruth R Sims; Spencer L Smith; Vivek J Srinivasan; Martin Thunemann; Lei Tian; Lin Tian; Thomas Troxler; Antoine Valera; Alipasha Vaziri; Sergei A Vinogradov; Flavia Vitale; Lihong V Wang; Hana Uhlířová; Chris Xu; Changhuei Yang; Mu-Han Yang; Gary Yellen; Ofer Yizhar; Yongxin Zhao
Journal:  Neurophotonics       Date:  2022-04-27       Impact factor: 4.212

6.  Concurrent Gene Insertion, Deletion, and Inversion during the Construction of a Novel Attenuated BoHV-1 Using CRISPR/Cas9 Genome Editing.

Authors:  Chun-Yu Liu; Ming Jin; Hao Guo; Hong-Zhe Zhao; Li-Na Hou; Yang Yang; Yong-Jun Wen; Feng-Xue Wang
Journal:  Vet Sci       Date:  2022-03-30

7.  HyperXpress: Rapid Single Vessel DNA Assembly and Protein Production in Microliterscale.

Authors:  Darius Leon Zibulski; Niels Schlichting; Johannes Kabisch
Journal:  Front Bioeng Biotechnol       Date:  2022-04-01

8.  iCodon customizes gene expression based on the codon composition.

Authors:  Michay Diez; Santiago Gerardo Medina-Muñoz; Luciana Andrea Castellano; Gabriel da Silva Pescador; Qiushuang Wu; Ariel Alejandro Bazzini
Journal:  Sci Rep       Date:  2022-07-15       Impact factor: 4.996

9.  21 Fluorescent Protein-Based DNA Staining Dyes.

Authors:  Yurie Tehee Kim; Hyesoo Oh; Myung Jun Seo; Dong Hyeun Lee; Jieun Shin; Serang Bong; Sujeong Heo; Natalia Diyah Hapsari; Kyubong Jo
Journal:  Molecules       Date:  2022-08-17       Impact factor: 4.927

  9 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.