| Literature DB >> 25082566 |
Ying Wang, Zhanli Wang, Yaxian Zhang, Liyun Bai, Yue Zhao, Chunfang Liu, An Ma, Hui Yu.
Abstract
Polymerase chain reaction (PCR) is an in vitro technique for the nucleic acid amplification, which is commonly used to diagnose infectious diseases. The use of PCR for pathogens detection, genotyping and quantification has some advantages, such as high sensitivity, high specificity, reproducibility and technical ease. Brucellosis is a common zoonosis caused by Brucella spp., which still remains as a major health problem in many developing countries around the world. The direct culture and immunohistochemistry can be used for detecting infection with Brucella spp. However, PCR has the potential to address limitations of these methods. PCR are now one of the most useful assays for the diagnosis in human brucellosis. The aim of this review was to summarize the main PCR techniques and their applications for diagnosis and follow-up of patients with brucellosis. Moreover, advantages or limitation of the different PCR methods as well as the evaluation of PCR results for treatment and follow-up of human brucellosis were also discussed.Entities:
Mesh:
Year: 2014 PMID: 25082566 PMCID: PMC4236518 DOI: 10.1186/s12941-014-0031-7
Source DB: PubMed Journal: Ann Clin Microbiol Antimicrob ISSN: 1476-0711 Impact factor: 3.944
Efficiency of blood PCR assays
| B4 | TGGCTCGGTTGCCAATATCAA | bcsp31 | 100 | 100 | 100 | 98 | 14 |
| B5 | CGCGCTTGCCTTTCAGGTCTG | | | | | | |
| JPF | GCGCTCAGGCTGCCGACGCAA | omp2 | 98 | 100 | 100 | 96.1 | 14 |
| JPR | ACCAGCCATTGCGGTCGGTA | | | | | | |
| P1 | TGGAGGTCAGAAATGAAC | omp2 | 99 | 100 | 100 | 98 | 14 |
| P2 | GAGTGCGAAACGAGCGC | | | | | | |
| 26A | GCCCCTGACATAACCCGCTT | bp26 | 98.5 | 100 | 100 | 97.1 | 14 |
| 26B | GAGCGTGACATTTGCCGATA | | | | | | |
| F4 | TCGAGCGCCCGCAAGGGG | 16S | 53.1 | 100 | 53.1 | 100 | 35 |
| R2 | AACCATAGTGTCTCCACTAA | rRNA |
Comparison of conventional and real-time PCR assays lower limit of detection (fg)
| | | IS711 | bcsp31 | per | IS711 | bcsp31 | per |
| B. canis RM6/66 | 6 | 100 | 1000 | 1000 | 2 | 20 | 20 |
| B. abortus 544 | 7 | 100 | 1000 | 1000 | 2 | 2 | 2 |
| B. melitensis 16 M | 7 | 1000 | 1000 | 1000 | 2 | 20 | 20 |
| B. ovis 63/290 | 38 | 100 | 1000 | 1000 | 0.2 | 2 | 2 |
(This table was taken from ref. [54]).