Dalibor Mijaljica1, Mark Prescott, Rodney J Devenish. 1. Department of Biochemistry and Molecular Biology, School of Biomedical Sciences, Faculty of Medicine, Nursing and Health Sciences, Monash University, Victoria, Australia.
Abstract
Autophagy encompasses several processes by which cytosol and organelles can be delivered to the vacuole/lysosome for breakdown and recycling. We sought to investigate autophagy of the nucleus (nucleophagy) in the yeast Saccharomyces cerevisiae by employing genetically encoded fluorescent reporters. The use of such a nuclear reporter, n-Rosella, proved the basis of robust assays based on either following its accumulation (by confocal microscopy), or degradation (by immunoblotting), within the vacuole. We observed the delivery of n-Rosella to the vacuole only after prolonged periods of nitrogen starvation. Dual labeling of cells with Nvj1p-EYFP, a nuclear membrane reporter of piecemeal micronucleophagy of the nucleus (PMN), and the nucleoplasm-targeted NAB35-DsRed.T3 allowed us to detect PMN soon after the commencement of nitrogen starvation whilst delivery to the vacuole of the nucleoplasm reporter was observed only after prolonged periods of nitrogen starvation. This later delivery of nuclear components to the vacuole has been designated LN (late nucleophagy). Only a very few cells showed simultaneous accumulation of both reporters (Nvj1p-EYFP and NAB35-DsRed.T3) in the vacuole. We determined, therefore, that delivery of the two respective nuclear reporters to the vacuole is temporally and spatially separated. Furthermore, our data suggest that LN is mechanistically distinct from PMN because it can occur in nvj1Δ and vac8Δ cells, and does not require ATG11. Nevertheless, a subset of the components of the core macroautophagic machinery is required for LN as it is efficiently inhibited in null mutants of several autophagy-related genes (ATG) specifying such components. Moreover, the inhibition of LN in some mutants is accompanied by alterations in nuclear morphology.
Autophagy encompasses several processes by which cytosol and organelles can be delivered to the vacuole/lysosome for breakdown and recycling. We sought to investigate autophagy of the nucleus (nucleophagy) in the yeastSaccharomyces cerevisiae by employing genetically encoded fluorescent reporters. The use of such a nuclear reporter, n-Rosella, proved the basis of robust assays based on either following its accumulation (by confocal microscopy), or degradation (by immunoblotting), within the vacuole. We observed the delivery of n-Rosella to the vacuole only after prolonged periods of nitrogen starvation. Dual labeling of cells with Nvj1p-EYFP, a nuclear membrane reporter of piecemeal micronucleophagy of the nucleus (PMN), and the nucleoplasm-targeted NAB35-DsRed.T3 allowed us to detect PMN soon after the commencement of nitrogen starvation whilst delivery to the vacuole of the nucleoplasm reporter was observed only after prolonged periods of nitrogen starvation. This later delivery of nuclear components to the vacuole has been designated LN (late nucleophagy). Only a very few cells showed simultaneous accumulation of both reporters (Nvj1p-EYFP and NAB35-DsRed.T3) in the vacuole. We determined, therefore, that delivery of the two respective nuclear reporters to the vacuole is temporally and spatially separated. Furthermore, our data suggest that LN is mechanistically distinct from PMN because it can occur in nvj1Δ and vac8Δ cells, and does not require ATG11. Nevertheless, a subset of the components of the core macroautophagic machinery is required for LN as it is efficiently inhibited in null mutants of several autophagy-related genes (ATG) specifying such components. Moreover, the inhibition of LN in some mutants is accompanied by alterations in nuclear morphology.
Autophagy is an evolutionary conserved, catabolic process responsible for the non-selective or selective degradation of diverse cargoes. In non-selective autophagy bulk cytosol and other cellular components are targeted for degradation. By contrast during selective autophagy, a specific cargo such as a particular organelle is exclusively subjected to autophagic degradation (reviewed in [1]–[4]).Selective autophagic degradation of the nucleus (nucleophagy) in yeast (Saccharomyces cerevisiae) has been categorized as occurring by a microautophagic process, PMN, based on the morphological distinction that the cargo destined for degradation within a nuclear bleb is directly engulfed and sequestered into an invagination of the vacuolar membrane rather than being packaged into autophagosome-like vesicles [5], [6]. Upon nitrogen starvation the initiation of PMN occurs at nucleus-vacuole (NV) junctions formed by interactions between the outer nuclear membrane protein, Nvj1p and the vacuolar membrane protein, Vac8p [5]–[7]. PMN takes place through a series of morphologically distinct steps. First, an NV junction forms at the nuclear envelope (including both inner and outer nuclear membranes), coincident with an invagination of the vacuolar membrane that bulges into the vacuolar lumen. Later a fission event releases into the vacuolar lumen a nuclear-derived vesicle (PMN vesicle) filled with nuclear material enclosed by both nuclear membranes. Eventually, the PMN vesicle is degraded by resident vacuolar hydrolases [5], [7]–[9].As demonstrated by studies in vitro, ‘classical/canonical microautophagy’ (CM) in S. cerevisiae operates via a specialized structure, the autophagic tube, a long, narrow invagination of the vacuolar membrane that pinches off to form vesicles containing bulk cytosolic material within the lumen of the vacuole. This process is largely independent of the core autophagy-related genes (ATG) [10]. By contrast, efficient PMN requires core ATG genes [7], [9]. Some additional, non-Atg proteins, such as the components of the vacuolar transporter chaperone (VTC) complex [11], [12] and the exit from rapamycin-induced growth arrest (EGO) complex [13] are reported to be indispensable for CM, but are not required for efficient PMN [7].In a separate study we have shown that n-Rosella, a pH-based biosensor, can be used in conjunction with fluorescence microscopy to monitor uptake of nucleoplasm into the vacuole [14], [15]. Under growing conditions wild type, BY4741 cells expressing n-Rosella exhibit a pattern of fluorescence consistent with the uniform labelling of the nucleoplasm. In such cells the nucleus appears as a sharply defined single rounded structure that fluoresces both red and green. Nitrogen-starved, wild type cells expressing n-Rosella showed the accumulation of diffuse red fluorescence in the vacuole that indicated the delivery of n-Rosella to the vacuole [14], [15].Here, we report an extensive analysis of a process that we designate late nucleophagy (LN). Dual labeling of cells with Nvj1p-EYFP, an outer nuclear membrane reporter [5] and NAB35-DsRed.T3, a nucleoplasm reporter has enabled us to demonstrate that induction of PMN can be detected as early as after 3 hours of nitrogen starvation as reported previously [5]. LN can be detected only after prolonged periods of nitrogen starvation (20–24 hours) as observed by both confocal microscopy and immunoblotting. In addition to this clear temporal distinction between the two processes, our data suggest that they are also spatially separated, as we rarely observe labeling of single nuclear-derived, vesicle-like structures located in the vacuole with both reporters. Furthermore, in contrast to PMN, LN can occur in the absence of Nvj1p or Vac8p, and does not require Vps34PtdIns(3)P-kinase complex I components (Vps34p, Vps15p, Atg6p, and Atg14p) or Atg11p (an autophagy adapter protein). Nevertheless, a subset of the components of the core macroautophagic machinery is shown to be required for LN as it is efficiently inhibited in some atg mutants. Interestingly, this inhibition of LN was accompanied by morphological alterations of the nucleus.
Materials and Methods
Strains and Plasmids
S. cerevisiae strains used in this study were wild type, BY4741 (MAT
his3Δ1 leu2Δ0 met15Δ0 ura3Δ0) and the related isogenic single gene deletion strains (Research Genetics™).Plasmid pAS1NB-NAB35-Rosella (n-Rosella) encodes a dual color-emission pH-biosensor that consists of a pH-stable variant of the red fluorescent protein and pH-sensitive variant of GFP (pHluorin) fused to the C-terminus of NAB35 which encompasses the Nab2p nuclear localization signal [14], [15]. pAS1NB-NAB35-DsRed.T3 encodes only the red fluorescent component of Rosella fused to NAB35 [14], [15]. Plasmid PCUP1-Nvj1-EYFP expresses Nvj1p-EYFP under CUP1 promoter control [5], [16]. Plasmid pGFP-C-FUS expresses cytoplasmic GFP (c-GFP) under MET25 promoter and CYC1 terminator control [17].Plasmid pRS316 was used to expressAtg4 or its enzymatically inactive variants (Atg4C159A and Atg4C159S) [18]. pRS416 was used to express the ATG3 open reading frame under the control of its native promoter and terminator. The ATG3 gene cassette flanked by 5′ HindIII and 3′ NotI restriction sites was amplified from yeast genomic DNA by PCR using the primer pair ATG3UP (5′- AGAAGCTTACGTTTTCTACCGTTCCCGTCTC) and ATG3DO (5′ATAGTTTAGCGGCCGCTTTACCAACCTTCCATGGTATAG). Following HindIII/BamHI digestion the PCR product was ligated into the expression site of pRS416 [19].Transformation of yeast cells with plasmid DNA was performed as described previously [15].
Media and Growth Conditions
For the purpose of fluorescence imaging yeast strains were grown as previously described [14], [15]. Briefly, cell cultures were grown to mid-exponential growth phase in Saccharomyces Salts medium (SS) with the addition of 2% (w/v) glucose (SS+D) as a carbon source. Cells were harvested and washed three times with SS+D medium and either re-inoculated into fresh SS+D medium, or nitrogen starvation medium (SD-N) containing 0.17% (w/w) yeastnitrogen base without added amino acids or ammonium sulfate and containing 2% (w/v) glucose. Amino acid supplements were added as required.Basal levels of Nvj1p-EYFP expression under CUP1 promoter control were achieved by growth in SS+D without added Cu2+. Expression was induced by growth in medium containing 0.1 mM CuSO4 for 1 hour as previously described [5], [16].
Fluorescence Microscopy
Cells were prepared as described previously [14], [15]. To label the vacuole lumen, cells were stained by incubation with CMAC-Arg dye (Invitrogen-Molecular Probes, Cat. No. Y-7531) as described previously [14], [15]. Nuclei were stained by incubation with the nucleic acid stain Hoechst 33258 (Invitrogen-Molecular Probes, Cat. No. H1398) at a final concentration of 1 µM for 45 min immediately before imaging. Confocal Laser Scanning Microscopy (CLSM) was performed on a Fluoview FV500 microscope (Olympus, Australia) using published parameters [14], [15]. Yeast cells expressing either n-Rosella or NAB35-DsRed.T3 were scored for the delivery of diffuse red fluorescence into the vacuole concomitant with checking for the absence of green fluorescence as appropriate. At the same time these cells were scored for nuclear morphology (normal = round nucleus; altered = irregularly shaped nucleus). Yeast cells expressing Nvj1p-EYFP were scored for the accumulation in the vacuole of blebs and vesicle-like structures showing yellow fluorescence emission (EYFP is considered yellow, but it is detected in the ‘green’ channel). In each experiment 200–300 cells were scored and experiments were performed in triplicate.
Immunoblotting
Cells expressing n-Rosella (OD600 = 2.5) were harvested by centrifugation and resuspended in 100 µl water. NaOH (100 µl, 0.2 M) was added and the cell suspension incubated for 5 min at 21°C and centrifuged. The pellet was resuspended in 50 µl SDS-PAGE sample buffer (0.06 M Tris-HCl, pH 6.8, 5% (v/v) glycerol, 2% (w/v) SDS, 4% (v/v) β-mercaptoethanol, 0.0025% (w/v) bromophenol blue), boiled for 3 min and centrifuged when cool. Sample supernatants (5 μl) were subjected to SDS-PAGE on 12% polyacrylamide gels. Proteins were transferred to PVDF membranes and probed with a monoclonal antibody against GFP (1∶4,000 dilution) (Roche Applied Science, Cat. No. 11814460001), or 3-phosphoglycerate kinase (1∶2,000 dilution) (Molecular Probes-Invitrogen, Cat. No. A6457). Secondary antibody was HRP-conjugated anti-mouse IgG (GE Healthcare, Cat. No. NA931V) (1∶20,000 dilution). Chemiluminescent signals were generated using ECL reagent (ThermoScientific, Cat. No. 34095) and detected using photographic film.After exposure to ECL, the membranes were washed in 10% (v/v) methanol, for 30 min at room temperature. Then, additional washing of the membranes was performed for 30 min (2×15 min) with wash buffer (1×PBS). A stripping procedure was performed for 30 min by washing in pre-warmed (37°C) stripping buffer, pH 2.2 (containing 1.5% (w/v) glycine, 0.1% (w/v) SDS and 1% (v/v) Tween-20) for 30 min. Then the membranes were washed for 30 min (3×10 min) with wash buffer (1×PBS), then blocked for 30 min in blocking buffer (1×PBS containing 5% (w/v) skim milk powder). In all experiments we first carried out blotting for GFP, stripped the membranes as described above and then blotted for PGK (3-phosphoglycerate kinase).
Electron Microscopy
For the purpose of electron microscopy cells were grown aerobically at 28°C to mid-exponential growth phase in SS+D medium containing the required auxotrophic supplements. Cells were harvested and washed three times with SS+D medium and re-inoculated into fresh SS+D or SD-N medium and incubated at 28°C for the times indicated.Sample preparation procedures including fixing, embedding and ultrathin sectioning with lead citrate staining were according to Bauer et al.
[20]. Samples were visualized on a Jeol 101 TEM electron microscope (Japan). Images were processed and analyzed using Image J (version 1.36b) (http://rsb.info.nih.gov/ij/).
Results
Delivery of n-Rosella to the Vacuole is Only Apparent after Prolonged Periods of Nitrogen Starvation
Nucleophagy was induced in wild type cells by incubating in SD-N medium. Cells were sampled at selected time points between 0 and 72 hours after the onset of nitrogen starvation and examined using fluorescence microscopy. The accumulation of n-Rosella (diffuse red fluorescence) in the vacuole was considered to be indicative of the occurrence of nucleophagy (Fig. 1A–E) [14]. The delivery of n-Rosella to the vacuole could only be observed after prolonged periods of nitrogen starvation (Fig. 1A–C). After 24 hours ∼42% of cells showed accumulation of diffuse red fluorescence in the vacuole (Fig. 1B), while prolonged periods of nitrogen starvation (48 and 72 hours) lead to a higher proportion of cells showing evidence of nucleophagy (56% and 63%, respectively) (Fig. 1B). The correct targeting of n-Rosella (red and green fluorescence) to the nucleus was confirmed by co-localization with blue fluorescence emission of Hoechst 33258 used to label nucleic acids (Fig. 1D). The accumulation of diffuse red fluorescence was confirmed as being localized inside the vacuole on the basis of co-localization with the vacuole lumen marker, CMAC-Arg (Fig. 1E).
Figure 1
Delivery of n-Rosella to the vacuole of nitrogen-starved wild type cells.
(A) Wild type (BY4741) cells expressing n-Rosella were subjected to nitrogen starvation and then sampled at selected time points (0, 6, 24, 48 and 72 hours after commencement of nitrogen starvation). Accumulation of diffuse red fluorescence in the vacuole was taken as evidence of nucleophagy. (B) The percentage of cells showing accumulation of diffuse red fluorescence in the vacuole at various time points is shown. (C) Cells expressing n-Rosella were starved in SD(-N) medium for 0, 3, 6, 9, 12, 15, 18, 21, 24, 48 and 72 hours, and the increase in processed degradation product (free GFP) levels was monitored by immunoblotting as described in Materials and Methods. Cytosolic PGK was detected as a loading control. *indicates the presumptive degradation product of n-Rosella lacking the NAB35 nuclear targeting signal. (D) Staining with Hoechst 33258 was performed to confirm the targeting of n-Rosella (red and green fluorescence) to the nucleus 24 hours after commencement of nitrogen starvation. (E) Staining with the vacuolar lumen dye, CMAC-Arg was performed to confirm the delivery of n-Rosella (diffuse red fluorescence) to the vacuole (24 hours after commencement of nitrogen starvation).
Delivery of n-Rosella to the vacuole of nitrogen-starved wild type cells.
(A) Wild type (BY4741) cells expressing n-Rosella were subjected to nitrogen starvation and then sampled at selected time points (0, 6, 24, 48 and 72 hours after commencement of nitrogen starvation). Accumulation of diffuse red fluorescence in the vacuole was taken as evidence of nucleophagy. (B) The percentage of cells showing accumulation of diffuse red fluorescence in the vacuole at various time points is shown. (C) Cells expressing n-Rosella were starved in SD(-N) medium for 0, 3, 6, 9, 12, 15, 18, 21, 24, 48 and 72 hours, and the increase in processed degradation product (free GFP) levels was monitored by immunoblotting as described in Materials and Methods. Cytosolic PGK was detected as a loading control. *indicates the presumptive degradation product of n-Rosella lacking the NAB35 nuclear targeting signal. (D) Staining with Hoechst 33258 was performed to confirm the targeting of n-Rosella (red and green fluorescence) to the nucleus 24 hours after commencement of nitrogen starvation. (E) Staining with the vacuolar lumen dye, CMAC-Arg was performed to confirm the delivery of n-Rosella (diffuse red fluorescence) to the vacuole (24 hours after commencement of nitrogen starvation).Furthermore, we followed the proteolytic digestion of n-Rosella by immunoblotting using an antibody with specificity for the GFP component. n-Rosella is comprised of a nuclear targeting signal (∼ 5 kDa), two fluorescent proteins (each ∼28 kDa) linked by a short exposed polypeptide (∼1 kDa). Delivery of n-Rosella to the vacuole exposes it to the lumenal proteases resulting in several cleavage products. Cleavage of the polypeptide linker that joins the two fluorescent protein moieties will lead to the production of ‘free’ GFP which serves as a measure of vacuolar degradation of n-Rosella. Cell lysates prepared from cells harvested at selected time points between 0 and 72 hours after the onset of nitrogen starvation were subjected to SDS-PAGE and after transfer of proteins to PVDF membranes blots probed for GFP (Fig. 1C). The predominate band observed for both non-starved and starved cells migrated as a polypeptide ∼ 65 kDa and is presumed to be full-length n-Rosella. A band denoted * migrates with a size corresponding to ∼58 kDa which is consistent with it being n-Rosella lacking the NAB35 nuclear targeting signal (Fig. 1C). At time points between 9 and 21 hours of nitrogen starvation, small amounts of a band migrating with a size corresponding to ∼28 kDa, consistent with the proteolytic release of free GFP were observed. The amount of GFP released by digestion of n-Rosella was significantly increased at 24 hours of starvation and later time points (Fig. 1C). Collectively, these results are consistent with delivery of n-Rosella to the vacuole. Cytosolic PGK, migrating with a size corresponding to ∼44 kDa, served as a loading control.We next studied wild type cells of two further strains having different genetic backgrounds, YRD15 [21] and CRY1 [22]. The delivery of n-Rosella to the vacuole of both YRD15 and CRY1 cells as judged by accumulation of vacuolar red fluorescence was observed only after 20–24 hours following commencement of nitrogen starvation. Furthermore, the proportion of YRD15 and CRY1 cells showing evidence of nucleophagy was 20 and 25–35%, respectively (data not shown), comparable to that for BY4741 cells. These results suggest that the late onset of nucleophagy revealed using n-Rosella is independent of strain background.
Evidence for Direct Delivery of NAB35 Targeted Reporters to the Vacuolar Lumen
We sought to exclude the possibility that NAB35 targeted reporter proteins either ‘leak’ out of the nucleus, or are mis-targeted to the cytoplasm for some unknown reason after the prolonged incubation of the cells in nitrogen starvation medium, and are then transported to the vacuole via a canonical autophagic pathway. To this end we conducted experiments using atg6Δ cells. Atg6 is regarded as a core component of the autophagy machinery and as such both macroautophagy and microautophagy would be non-functional in these cells [23]. This phenotype was confirmed by expression in atg6Δ cells of GFP localized in the cytoplasm. Such cells did not show green fluorescence in the vacuole after 20 (or more) hours of nitrogen starvation (Fig. 2A). As indicated atg6Δ cells are capable of LN, but not PMN. Dual-labeled cells expressing both cytoplasmically localized GFP and nuclear localized NAB35-DsRed.T3 (the red fluorescent component of n-Rosella biosensor) grown under the same conditions of nitrogen starvation showed red fluorescence in the vacuole, but not green fluorescence (Fig. 2B). Therefore, we conclude that the red fluorescent material accumulated in the vacuole is n-Rosella delivered directly from the nucleus.
Figure 2
The diffuse red fluorescence (NAB35-DsRed.T3) accumulated in the vacuole is delivered directly from the nucleus.
Wild type (BY4741) and atg6Δ cells expressing cyto-GFP alone (A), or co-expressing cyto-GFP and NAB35-DsRed.T3 (B), under growing (SS+D) and nitrogen starvation conditions (SD-N) were sampled after 24 hours. Staining with the vacuolar lumen staining dye, CMAC-Arg was used to confirm delivery of fluorescent reporters to the vacuole.
The diffuse red fluorescence (NAB35-DsRed.T3) accumulated in the vacuole is delivered directly from the nucleus.
Wild type (BY4741) and atg6Δ cells expressing cyto-GFP alone (A), or co-expressing cyto-GFP and NAB35-DsRed.T3 (B), under growing (SS+D) and nitrogen starvation conditions (SD-N) were sampled after 24 hours. Staining with the vacuolar lumen staining dye, CMAC-Arg was used to confirm delivery of fluorescent reporters to the vacuole.
LN and PMN are Initiated at Different Times During Nitrogen Starvation
In wild type cells PMN was observed to occur 3 hours after the commencement of nitrogen starvation [5], [7]. The relatively late time point (24 hours and beyond) at which delivery of n-Rosella to the vacuole of nitrogen-starved wild type cells could be detected suggested the LN process we were observing was different to that of PMN. Thus, we next sought to determine if it was indeed the case that the timing of LN is distinctly separate from the timing of PMN in starved wild type cells. Cells harboring vectors encoding NAB35-DsRed.T3 and Nvj1p-EYFP (under control of a Cu2+ inducible promoter) individually, or together, were grown in SS+D medium. Expression of Nvj1p-EYFP was induced for 1 hour by the addition of CuSO4 to the growth medium before transfer to SD-N medium. Control cells were incubated in fresh SS+D lacking exogenous Cu2+ for the same time period.When both the reporters NAB35-DsRed.T3 and Nvj1p-EYFP were expressed together in wild type cells, Nvj1p-EYFP labeled PMN vesicles (Fig. 3A; white arrows and Fig. S1A) could be detected in the vacuole as early as after 3 hours of nitrogen starvation, whereas delivery of NAB35-DsRed.T3 could be detected as diffuse red fluorescence only after 20–24 hours (Fig. 3A; yellow arrows). A time course of detection of both events is presented in Fig. 3B. Notably, vesicles labeled with both Nvj1p-EYFP and NAB35-DsRed.T3 were not observed in cells subjected to starvation for 20 hours or less. However, co-labeling of one or two vesicles in the vacuole was observed in a small percentage (∼5%) of cells from 20 hours and beyond (Fig. 3C; white arrows and Fig. S1B). These results indicate that the delivery of each reporter is initiated at different time points after the onset of nitrogen starvation. The same behavior of reporters has been observed in rapamycin-treated cells (data not shown), indicating that LN is not a process specifically related to growth in nitrogen starvation medium.
Figure 3
Wild type cells co-expressing Nvj1-EYFP and NAB35-DsRed.T3 nuclear reporters show temporal separation of nucleophagic events.
(A) Wild type (BY4741) cells co-expressing both nuclear reporters were imaged under growing (SS+D) and nitrogen starvation (SD-N) conditions (3 and 24 hours after commencement of nitrogen starvation), respectively. The appearance of Nvj1p-EYFP-derived vesicles (PMN vesicles) in the vacuole is highlighted by white arrows, whereas accumulation of NAB35-DsRed.T3-derived fluorescence (diffuse red fluorescence) is indicated by yellow arrows. (B) Percentage of cells showing accumulation of fluorescence in the vacuole over time: ♦ green (Nvj1p-EYFP) only; • red (NAB35-DsRed.T3) only; ▾ green and red. (C) Accumulation of both Nvj1p-EYFP-derived vesicles (PMN vesicles) and accumulation of NAB35-DsRed.T3-derived diffuse red fluorescence in the same cells 24 hours after commencement of nitrogen starvation. The appearance of vacuolar vesicles containing both nuclear reporters is indicated by white arrows.
Wild type cells co-expressing Nvj1-EYFP and NAB35-DsRed.T3 nuclear reporters show temporal separation of nucleophagic events.
(A) Wild type (BY4741) cells co-expressing both nuclear reporters were imaged under growing (SS+D) and nitrogen starvation (SD-N) conditions (3 and 24 hours after commencement of nitrogen starvation), respectively. The appearance of Nvj1p-EYFP-derived vesicles (PMN vesicles) in the vacuole is highlighted by white arrows, whereas accumulation of NAB35-DsRed.T3-derived fluorescence (diffuse red fluorescence) is indicated by yellow arrows. (B) Percentage of cells showing accumulation of fluorescence in the vacuole over time: ♦ green (Nvj1p-EYFP) only; • red (NAB35-DsRed.T3) only; ▾ green and red. (C) Accumulation of both Nvj1p-EYFP-derived vesicles (PMN vesicles) and accumulation of NAB35-DsRed.T3-derived diffuse red fluorescence in the same cells 24 hours after commencement of nitrogen starvation. The appearance of vacuolar vesicles containing both nuclear reporters is indicated by white arrows.Cells expressing Nvj1p-EYFP alone confirmed our observations with dual-labeled cells that PMN can be first detected as early as after 3 hours of the commencement of nitrogen starvation. At this time, as shown previously by Goldfarb and colleagues [5] some 50–60% of cells showed Nvj1p-EYFP-labeled vesicles in the vacuolar lumen. The percentage of cells showing this phenotype remained at this level up to 48 hours following initiation of nitrogen starvation (data not shown). In parallel experiments using cells expressing only NAB35-DsRed.T3 the accumulation of diffuse red fluorescence in the vacuole was observed after 20–24 hours of starvation in 25–35% of cells, as observed for both dual-labeled cells and cells expressing n-Rosella alone (data not shown).
Delivery of Nucleoplasm to the Vacuole does not Require Nvj1p, Vac8p, or Vac8p-Binding Partners
Nvj1p and Vac8p are two proteins found at NV junctions and that are required for mediating PMN [5], [7]. Under conditions of nitrogen starvation nvj1Δ (Fig. 4A) and vac8Δ (Fig. 4B) cells expressing n-Rosella showed significant accumulation of diffuse red fluorescence in the vacuole after 24 hours of nitrogen starvation (Fig. 4C). Immunoblotting analysis of lysates prepared from nvj1Δ or vac8Δ cells indicated that free GFP was present in cells only after 24 hours of nitrogen starvation (Fig. 4D). Collectively, these results indicate that LN is not dependent on either the NVJ1 or VAC8 gene product.
Figure 4
The inactivation of the NVJ1 and VAC8 genes required for PMN does not abrogate the delivery of n-Rosella to the vacuole.
nvj1Δ (A) and vac8Δ (B) cells expressing n-Rosella were imaged under growing (SS+D) and nitrogen starvation (SD−N) conditions (24 hours after commencement of nitrogen starvation). (C) The percentage of nvj1Δ and vac8Δ cells showing accumulation of diffuse red fluorescence in the vacuole under growing (SS+D) and nitrogen starvation (SD-N) conditions (24 hours after commencement of nitrogen starvation). (D) Wild type, nvj1Δ and vac8Δ cells expressing n-Rosella were starved in SD(−N) medium for 0 and 24 hours, and the levels of the free GFP degradation product monitored by immunoblotting as described in Materials and Methods. Cytosolic PGK was detected as a loading control. *indicates the presumptive degradation product of n-Rosella lacking the NAB35 nuclear targeting signal. (E) vac8Δ cells co-expressing the two nuclear reporters, Nvj1-EYFP and NAB35-DsRed.T3 were imaged under growing (SS+D) and nitrogen starvation (SD−N) conditions (3 and 24 hours after commencement of nitrogen starvation), respectively. The accumulation of NAB35-DsRed.T3-derived fluorescence (diffuse red fluorescence) is indicated by white arrow. (F) Percentage of vac8Δ cells showing accumulation of fluorescence in the vacuole over time: ♦ green (Nvj1p-EYFP) only; • red (NAB35-DsRed.T3) only; ▾ green and red.
The inactivation of the NVJ1 and VAC8 genes required for PMN does not abrogate the delivery of n-Rosella to the vacuole.
nvj1Δ (A) and vac8Δ (B) cells expressing n-Rosella were imaged under growing (SS+D) and nitrogen starvation (SD−N) conditions (24 hours after commencement of nitrogen starvation). (C) The percentage of nvj1Δ and vac8Δ cells showing accumulation of diffuse red fluorescence in the vacuole under growing (SS+D) and nitrogen starvation (SD-N) conditions (24 hours after commencement of nitrogen starvation). (D) Wild type, nvj1Δ and vac8Δ cells expressing n-Rosella were starved in SD(−N) medium for 0 and 24 hours, and the levels of the free GFP degradation product monitored by immunoblotting as described in Materials and Methods. Cytosolic PGK was detected as a loading control. *indicates the presumptive degradation product of n-Rosella lacking the NAB35 nuclear targeting signal. (E) vac8Δ cells co-expressing the two nuclear reporters, Nvj1-EYFP and NAB35-DsRed.T3 were imaged under growing (SS+D) and nitrogen starvation (SD−N) conditions (3 and 24 hours after commencement of nitrogen starvation), respectively. The accumulation of NAB35-DsRed.T3-derived fluorescence (diffuse red fluorescence) is indicated by white arrow. (F) Percentage of vac8Δ cells showing accumulation of fluorescence in the vacuole over time: ♦ green (Nvj1p-EYFP) only; • red (NAB35-DsRed.T3) only; ▾ green and red.To corroborate the results obtained using n-Rosella, NAB35-DsRed.T3 and Nvj1-EYFP were expressed individually or co-expressed in vac8Δ cells. Upon nitrogen starvation, the delivery of Nvj1p-EYFP to the vacuole was abrogated (and remained so), whereas the delivery of NAB35-DsRed.T3 could still be observed after 24 hours of nitrogen starvation, as expected (Fig. 4E; white arrow and Fig. 4F).A number of Vac8p-binding partners, identified by yeast two-hybrid screening, are encoded by the VAC17, TCO89, ATG13, VID21, VAB2 and TAO3 genes, plus two uncharacterized open reading frames, YEL043W and YFR035C
[24]. We investigated whether LN is dependent on these proteins by nitrogen starvation of strains harboring n-Rosella and each lacking expression of a putative Vac8p binding partner. The haploid tao3Δ strain is inviable [24] and was not investigated here. ATG13 encodes a protein considered a component of the core macroautophagic machinery [25], [26]. Delivery of n-Rosella to the vacuole was observed in only a small proportion (∼5%) of atg13Δ cells subjected to nitrogen starvation (Fig. S2A); the majority of cells did not accumulate diffuse red fluorescence in the vacuole. Moreover many cells (∼35%) exhibited altered nuclear morphology (see below). Null mutants for the remaining six genes were assessed for their ability to deliver n-Rosella to the vacuole. In each case the outcome, in terms of accumulation of diffuse red fluorescence in the vacuole, was essentially equivalent to that found for wild type cells subjected to nitrogen starvation (Fig. S2B). Lysates of vac17Δ and tco89Δ cells were subjected to immunoblotting analysis and the results showed that after 24 hours of nitrogen starvation free GFP could be detected (Figs. S2A–B and Fig. S3A). These results indicate that aside from Atg13p the absence of individual putative Vac8p binding partners did not inhibit LN, or lead to altered nuclear morphology (Table 1).
Table 1
The requirement for different ATG and non-ATG genes on the degradation of the nucleus and nuclear morphology during LN.
Gene(s)
Gene group
Requirement for the deliveryof n-Rosella to the vacuole
This mutant shows accumulation of vesicles rather than diffuse red fluorescence in the vacuole.
ATG22 is vacuolar amino acid permease required for efflux after autophagic breakdown [29]. This mutant shows accumulation of vesicles and diffuse red fluorescence in the vacuole.
These mutants show a leaky phenotype in ∼5% of cells (see text for details).
This mutant shows accumulation of vesicles rather than diffuse red fluorescence in the vacuole.ATG22 is vacuolar amino acid permease required for efflux after autophagic breakdown [29]. This mutant shows accumulation of vesicles and diffuse red fluorescence in the vacuole.These mutants show a leaky phenotype in ∼5% of cells (see text for details).
LN Puncta can be Visualized in the Vacuoles of atg15Δ and pep4Δ Cells
We next sought evidence that the fluorescent n-Rosella might enter the vacuole in the form of vesicles or particulate structures that are very rapidly broken down such that they are not seen under conditions where the vacuolar enzymes show normal activity. Thus, we investigated the delivery to the vacuole of n-Rosella or both Nvj1p-EYFP and NAB35-DsRed.T3 in atg15Δ cells. The ATG15 gene product is a putative lipase [27], [28] that promotes the lysis of intravacuolar autophagic bodies, cytoplasm-to-vacuole targeting (Cvt) vesicles and multivesicular bodies delivered to the vacuole under autophagy-inducing conditions. Our expectation was that lysis of vesicular or particulate structures would be delayed in atg15Δ cells much like it is in pep4Δ cells [28].Nitrogen-starved, atg15Δ cells expressing n-Rosella exhibited the accumulation of red and/or red/green puncta in their vacuoles after 16 hours of nitrogen starvation (Fig. 5A and Fig. S4A). These puncta were observed to co-localize with Hoechst 33258 nucleic acid stain, indicating that they most likely have derived from the nucleus. The nature of the Hoechst 33258 stained material has not been determined. The observation that some puncta (5–10%) exhibited both red and green fluorescence suggests that their delivery occurs via some form of vesicle-like structure. Presumably their exposure to the acidic conditions of the vacuolar lumen is delayed in the absence of Atg15p thereby allowing the green fluorescence to persist.
Figure 5
Detection of nuclear-derived intra-vacuolar puncta in atg15Δ and pep4Δ cells.
(A) atg15Δ cells expressing n-Rosella were imaged under growing (SS+D) and nitrogen starvation (SD−N) conditions (24 hours after commencement of nitrogen starvation). Staining with Hoechst 33258 was performed to confirm the targeting of n-Rosella (red and green fluorescence) to the nucleus and nucleus-derived vesicles/puncta observed in the vacuole. (B) atg15Δ cells co-expressing the nuclear reporters, Nvj1-EYFP and NAB35-DsRed.T3 were imaged under growing (SS+D) and nitrogen starvation (SD−N) conditions (24 hours after commencement of nitrogen starvation). White arrow highlights Nvj1p-EYFP labeled vesicle whereas yellow arrow highlights NAB35-DsRed.T3 labeled vesicle/puncta, respectively. (C) Percentage of cells showing accumulation of reporter fluorescence over time: ♦ green (Nvj1p-EYFP) only; • red (NAB35-DsRed.T3) only; ▾ green and red. (D) pep4Δ cells expressing n-Rosella were imaged under growing (SS+D) and nitrogen starvation (SD−N) conditions (24 hours after commencement of nitrogen starvation). (E) pep4Δ cells co-expressing the nuclear reporters, Nvj1-EYFP and NAB35-DsRed.T3 were imaged under growing (SS+D) and nitrogen starvation (SD−N) conditions (24 hours after commencement of nitrogen starvation). The appearance of Nvj1p-EYFP-derived vesicles (PMN blebs and/or vesicles) in the vacuole is highlighted by white arrows, whereas accumulation of NAB35-DsRed.T3-derived vesicles/puncta is indicated by yellow arrows. (F) Staining with the vacuolar lumen dye, CMAC-Arg confirmed the delivery of NAB35-DsRed.T3 (red fluorescence) and Nvj1-EYFP (green fluorescence) to the vacuole.
Detection of nuclear-derived intra-vacuolar puncta in atg15Δ and pep4Δ cells.
(A) atg15Δ cells expressing n-Rosella were imaged under growing (SS+D) and nitrogen starvation (SD−N) conditions (24 hours after commencement of nitrogen starvation). Staining with Hoechst 33258 was performed to confirm the targeting of n-Rosella (red and green fluorescence) to the nucleus and nucleus-derived vesicles/puncta observed in the vacuole. (B) atg15Δ cells co-expressing the nuclear reporters, Nvj1-EYFP and NAB35-DsRed.T3 were imaged under growing (SS+D) and nitrogen starvation (SD−N) conditions (24 hours after commencement of nitrogen starvation). White arrow highlights Nvj1p-EYFP labeled vesicle whereas yellow arrow highlights NAB35-DsRed.T3 labeled vesicle/puncta, respectively. (C) Percentage of cells showing accumulation of reporter fluorescence over time: ♦ green (Nvj1p-EYFP) only; • red (NAB35-DsRed.T3) only; ▾ green and red. (D) pep4Δ cells expressing n-Rosella were imaged under growing (SS+D) and nitrogen starvation (SD−N) conditions (24 hours after commencement of nitrogen starvation). (E) pep4Δ cells co-expressing the nuclear reporters, Nvj1-EYFP and NAB35-DsRed.T3 were imaged under growing (SS+D) and nitrogen starvation (SD−N) conditions (24 hours after commencement of nitrogen starvation). The appearance of Nvj1p-EYFP-derived vesicles (PMN blebs and/or vesicles) in the vacuole is highlighted by white arrows, whereas accumulation of NAB35-DsRed.T3-derived vesicles/puncta is indicated by yellow arrows. (F) Staining with the vacuolar lumen dye, CMAC-Arg confirmed the delivery of NAB35-DsRed.T3 (red fluorescence) and Nvj1-EYFP (green fluorescence) to the vacuole.To further investigate the origin of these vacuolar puncta, we next investigated nitrogen-starved atg15Δ cells expressing both Nvj1p-EYFP and NAB35-DsRed.T3. Nvj1p-EYFP vesicles were found to accumulate in the vacuole 3 hours after onset of starvation, whereas intensely red fluorescent (NAB35-DsRed.T3) puncta were first visualized after 16 hours, but were more evident at 20 hours and beyond. After 24 hours of nitrogen starvation vesicles positive for Nvj1p-EYFP (Fig. 5B; white arrow and Fig. S4B), or NAB35-DsRed.T3 (Fig. 5B; yellow arrow and Fig. S4B), were observed. Notably, only a few cells (<5%) exhibited vesicle-like structures showing both green and red fluorescence indicating the presence of both reporters (Fig. 5C). Collectively, these results suggest that the formation of PMN vesicles and LN vesicle-like structures, are mechanistically distinct. Furthermore, the observation that red puncta are first observed in atg15Δ at the same time as diffuse red fluorescence is observed in wild type cells argues against the temporal difference in detection of LN compared to PMN arising simply from differential sensitivity of detection between EYFP-labeled membrane vesicles (PMN) and red fluorescence (LN). We also carried out similar experiments in pep4Δ cells in which degradation of material delivered to the vacuolar is also perturbed. The results obtained for pep4Δ cells (Fig. 5D–F and Fig. S4C–E) mirror those obtained for atg15Δ cells. It is important to note that intravacuolar Nvj1-EYFP labeled vesicles and NAB35-DsRed.T3 derived puncta co-localize with the vacuolar lumen marker CMAC-Arg (Fig. 5F). Immunoblotting analysis of lysates prepared from atg15Δ or pep4Δ cells did not detect any free GFP even after 24 hours of nitrogen starvation. The absence of degradation product on immunoblots of lysates lacking putative lipase (atg15Δ) or vacuolar proteinase A (pep4Δ) confirms the vacuolar origin of the GFP degradation product (Fig. S4E).
Efficient Delivery of n-Rosella to the Vacuole Requires a Spectrum of Core ATG Genes
Efficient PMN requires many ATG genes [7], [9]. We assessed null mutants of all 31 ATG genes known to be involved in autophagic processes in Saccharomyces cerevisiae, for LN under conditions of nitrogen starvation (Fig. S2A). In some cases altered nuclear morphology was observed (see below). Based on our observations, we grouped the ATG genes into two classes (I and II) depending on whether their deletion affected either their ability to deliver n-Rosella to the vacuole and/or nuclear morphology during nitrogen starvation (Table 1).Class I genes include: ATG6, ATG11, ATG14, ATG15, ATG19, ATG20, ATG21, ATG22* [29], ATG24, ATG26, ATG27, ATG32, ATG33 and ATG34 (Table 1). Mutant strains exhibit delivery of n-Rosella to the vacuole during nitrogen starvation at levels comparable to the wild type cells (Fig. S2A) and exhibit normal nuclear morphology. Since ATG11 has been reported to be required for efficient PMN [3], we monitored the delivery of Nvj1p-EYFP and NAB35-DsRed.T3 to the vacuole in atg11Δ cells. We confirmed previous observations [7] that PMN is abrogated in atg11Δ cells (data not shown). By contrast, the accumulation in the vacuole of n-Rosella (Fig. 6A) and NAB35-DsRed.T3 could still be observed in some 25–35% of cells (Fig. 6B) after 24 hours, as in wild type cells. Immunoblotting analysis of lysates prepared from atg6Δ or atg11Δ cells detected free GFP only after 24 hours of nitrogen starvation (Fig. 6C and Figs. S2B and S3B). Collectively, these results indicate that functional ATG gene products from Class I, including ATG6 and ATG11, are not required for efficient LN.
Figure 6
The deletion of the ATG6 or ATG11 genes does not abrogate the delivery of n-Rosella to the vacuole.
(A) atg11Δ cells expressing n-Rosella were imaged under growing (SS+D) and nitrogen starvation (SD-N) conditions (0, 24, 48 and 72 hours after commencement of nitrogen starvation). (B) atg11Δ cells co-expressing both nuclear reporters were imaged under growing (SS+D) and nitrogen starvation (SD-N) conditions and the percentage of cells showing accumulation of fluorescence over time determined: ♦ green (Nvj1p-EYFP) only; • red (NAB35-DsRed.T3) only; ▾ green and red. (C) Wild type, atg6Δ, atg11Δ, atg8Δ and atg10Δ cells expressing n-Rosella were starved in SD(-N) medium for 0 and 24 hours, and degradation product (free GFP) levels were monitored by immunoblotting as described in Materials and Methods. Cytosolic PGK was detected as a loading control. *indicates the presumptive degradation product of n-Rosella lacking the NAB35 nuclear targeting signal.
The deletion of the ATG6 or ATG11 genes does not abrogate the delivery of n-Rosella to the vacuole.
(A) atg11Δ cells expressing n-Rosella were imaged under growing (SS+D) and nitrogen starvation (SD-N) conditions (0, 24, 48 and 72 hours after commencement of nitrogen starvation). (B) atg11Δ cells co-expressing both nuclear reporters were imaged under growing (SS+D) and nitrogen starvation (SD-N) conditions and the percentage of cells showing accumulation of fluorescence over time determined: ♦ green (Nvj1p-EYFP) only; • red (NAB35-DsRed.T3) only; ▾ green and red. (C) Wild type, atg6Δ, atg11Δ, atg8Δ and atg10Δ cells expressing n-Rosella were starved in SD(-N) medium for 0 and 24 hours, and degradation product (free GFP) levels were monitored by immunoblotting as described in Materials and Methods. Cytosolic PGK was detected as a loading control. *indicates the presumptive degradation product of n-Rosella lacking the NAB35 nuclear targeting signal.Class II genes include ATG1*, ATG2, ATG3, ATG4, ATG5, ATG7*, ATG8*, ATG9, ATG10*, ATG12, ATG13*, ATG16*, ATG17*, ATG18, ATG23*, ATG29* and ATG31*. In null mutants for some of these genes (designated by *), n-Rosella was delivered to the vacuole in a small proportion (∼5–10%) of nitrogen-starved cells that still exhibited normal nuclear morphology [14]. However, the majority of cells for these null mutants for all cells for the other mutants in class II did not accumulate diffuse red fluorescence in the vacuole (Fig. S2A), and ∼35% of nitrogen-starved cells exhibited altered nuclear morphology (Table 1). Instead of containing a round-shaped nucleus such cells exhibited an irregularly shaped nucleus often with projecting ‘arms or horns’. In order to establish if nitrogen starvation affects the changes in nuclear morphology, atg8Δ or atg10Δ cells expressing n-Rosella were nitrogen starved for 24 hours and then resuspended in SS+D medium (i.e., growth medium) for 6 or 24 hours. At both time points all cells exhibited normal round-shaped nuclear morphology (data not shown). These results indicate that the alteration in nuclear morphology is a consequence of nitrogen starvation in atg8Δ [14] and atg10Δ cells. Immunoblotting analysis of lysates prepared from atg8Δ or atg10Δ cells did not detect any free GFP even after 24 hours of nitrogen starvation (Fig. 6C and Figs. S2B and S3C). Together, these results indicate that functional ATG gene products from Class II including ATG8 and ATG10 are essential for efficient LN.To confirm that it is the absence of the ATG gene product that prevents delivery of the reporter to the vacuole, as well as affecting nuclear morphology, a plasmid-borne ATG3 or ATG4 gene cassette was introduced into atg3Δ or atg4Δ cells, respectively. Under conditions of nitrogen starvation, the ability of cells to deliver n-Rosella to the vacuole was restored in both instances (Fig. 7A–C and Fig. 8A–B). Diffuse red fluorescence was observed in the vacuole of nitrogen-starved cells at proportions comparable to that of starved wild type cells (∼25–35%). In addition, these ‘rescued’ cells showed normal nuclear morphology. Nuclear morphology of wild type, atg3Δ and ATG3 rescue cells was also confirmed by transmission electron microscopy. Compared to the round-shaped nucleus of the wild type and ATG3 rescue cells, the nucleus in atg3Δ cells sampled at 12 and 24 hours of nitrogen starvation looks extended and distorted (Fig. 7C). Furthermore, expression of enzymatically inactive variants of Atg4p; Atg4C159A (Fig. 8C) or Atg4C159S (data not shown), respectively, in atg4Δ cells, did not rescue the phenotype. In these cells, n-Rosella was not delivered to the vacuole under nitrogen starvation and approximately 35% of cells for each mutant exhibited altered nuclear morphology. Immunoblotting analysis of lysates prepared from atg3Δ or atg4Δ cells did not detect any free GFP even after 24 hours of nitrogen starvation. (Fig. 7D and Figs. S2B and S3D). Collectively, these results indicate that functional ATG gene products from Class II including ATG3 and ATG4 are necessary for efficient LN.
Figure 7
Deletion of the ATG3 gene abrogates the delivery of n-Rosella to the vacuole and influences nuclear morphology.
(A) atg3Δ and (B) atg3Δ + ATG3 cells expressing n-Rosella were imaged under growing (SS+D) and nitrogen starvation (SD−N) conditions (24 hours after commencement of nitrogen starvation). (C) Electron microscopy images of wild type (BY4741), atg3Δ and atg3Δ + ATG3 cells expressing n-Rosella were imaged under growing (SS+D) and nitrogen starvation (SD-N) conditions. Nitrogen-starved cells were sampled for imaging after 12 and 24 hours. Examples of contacts between the nucleus and vacuoles as well as alterations in nuclear morphology are presented. N, nucleus; V, vacuole. Bar, 2 µm. (D) Wild type, atg3Δ and atg4Δ cells expressing n-Rosella were starved in SD(−N) medium for 0 and 24 hours, and the levels of free GFP degradation product monitored by immunoblotting as described in Materials and Methods. Cytosolic PGK was detected as a loading control. *indicates the presumptive degradation product of n-Rosella lacking the NAB35 nuclear targeting signal. **indicates non-specific degradation product observed only in growing cells (0 hours).
Figure 8
The absence of a functional ATG4 gene product abrogates the delivery of n-Rosella to the vacuole and influences nuclear morphology.
atg4Δ (A), atg4Δ + ATG4 (B), and atg4Δ + Atg4C159A (C) cells expressing n-Rosella were imaged under growing (SS+D) and nitrogen starvation (SD−N) conditions (24 hours after commencement of nitrogen starvation).
Deletion of the ATG3 gene abrogates the delivery of n-Rosella to the vacuole and influences nuclear morphology.
(A) atg3Δ and (B) atg3Δ + ATG3 cells expressing n-Rosella were imaged under growing (SS+D) and nitrogen starvation (SD−N) conditions (24 hours after commencement of nitrogen starvation). (C) Electron microscopy images of wild type (BY4741), atg3Δ and atg3Δ + ATG3 cells expressing n-Rosella were imaged under growing (SS+D) and nitrogen starvation (SD-N) conditions. Nitrogen-starved cells were sampled for imaging after 12 and 24 hours. Examples of contacts between the nucleus and vacuoles as well as alterations in nuclear morphology are presented. N, nucleus; V, vacuole. Bar, 2 µm. (D) Wild type, atg3Δ and atg4Δ cells expressing n-Rosella were starved in SD(−N) medium for 0 and 24 hours, and the levels of free GFP degradation product monitored by immunoblotting as described in Materials and Methods. Cytosolic PGK was detected as a loading control. *indicates the presumptive degradation product of n-Rosella lacking the NAB35 nuclear targeting signal. **indicates non-specific degradation product observed only in growing cells (0 hours).
The absence of a functional ATG4 gene product abrogates the delivery of n-Rosella to the vacuole and influences nuclear morphology.
atg4Δ (A), atg4Δ + ATG4 (B), and atg4Δ + Atg4C159A (C) cells expressing n-Rosella were imaged under growing (SS+D) and nitrogen starvation (SD−N) conditions (24 hours after commencement of nitrogen starvation).
Genes Required for ‘Classical Microautophagy’ are not Essential for LN
We investigated LN in strains lacking expression of individual components of either the VTC or EGO complex. The VTC complex is required for homotypic vacuolar fusion [30], and the EGO complex is essential for the induction of a microautophagy-like recovery process occurring after rapamycin-induced macroautophagy [13]. In each case the outcome was essentially equivalent to that found for wild type cells subjected to nitrogen starvation; accumulation of diffuse red fluorescence in the vacuole and normal nuclear morphology (Table 1). Lysates prepared from ego1Δ or vtc4Δ cells and subjected to immunoblotting analysis showed that after 24 hours of nitrogen starvation the amount of free GFP detected was similar to that observed in wild type cells (Figs. S2B and S4E). These results indicate that the components of both complexes are not required for LN during nitrogen starvation-induced autophagy.
Discussion
Table 2 summarizes the key differences between LN and PMN [31]. It is to be emphasized that this study shows that nuclear delivery to the vacuole observed using nucleoplasm reporters (n-Rosella and NAB35-DsRed.T3) is different from PMN because there is no requirement for the NV junction components, Nvj1p or Vac8p, and does not require Vps34PtdIns(3)P-kinase complex I components (e.g., Vps34, Vps15, Atg6) and or other core ATG genes, for example ATG11, essential for PMN. Furthermore, LN is temporally and spatially distinct from PMN. Thus, we have concluded that two forms of nucleophagy can occur independently in nitrogen-starved yeast cells.
Table 2
Major requirement differences between PMN and LN.
Requirement
PMN
Late Nucleophagy (LN)
Cvt-specific protein Atg11
YES
NO
NVJ1 and VAC8 genes
YES
NO
Phosphatidylinositol 3-kinase (PI3K) complex I
YES
NO
Altered nuclear morphology
Not reported
YES
Nuclear vesicle budding
YES
Mechanism not determined
Minimal time required for vacuolar delivery
3–6 hours
20–24 hours
The Requirement for ATG Genes in LN
ATG genes required for effective LN belong to class II (Table 1). Our work identifies an additional role for some of the encoded Atg proteins in terms of their requirement for selective degradation of the nucleus by LN. The genes required encode components belonging to the two ubiquitin-like (Atg5p-Atg12p and Atg8p) conjugation pathways and the Atg9p cycling system. Notable members of the core autophagy gene group not required for LN is ATG6, which together with VPS15 and VPS34 (Fig. S2B) comprise PtdIns(3)P-kinase complex I (Table 1). That this complex can be dispensed for LN suggests that part of the machinery required to initiate macroautophagic events is not required.All four components of the Atg8p-phosphatidylethanolamine (PE) conjugation system, namely ATG3, ATG4, ATG7 and ATG8, are essential for efficient LN (Table 1), suggesting the generation of Atg8p-PE is important for the process by which LN takes place. Confirmation of the requirement for the enzymatic activities for some of these Atg proteins was determined by testing for LN in null cells expressing enzymatically inactive Atg protein. For example, variants of Atg4p (i.e., C159A or C159S) [18] are not able to “rescue” the atg4Δ phenotype. Presently it is unclear how Atg8p-PE might facilitate uptake of nucleoplasm into the vacuole, but an attractive possibility is that it acts to bring the two opposing (vacuolar and nuclear) membranes into close contact for interaction and eventual fusion. Indeed, Atg8p has been demonstrated to be involved in tethering between adjacent membranes and stimulating membrane hemifusion in vitro, although the physiological relevance of this activity has not been determined [32], [33]. Such functions, which mimic expansion of the autophagosomal membrane during macroautophagy, may contribute to membrane interactions during LN. What is the role of the Atg12p–Atg5p–Atg16p complex in LN? Previous suggestions made in the context of canonical macroautophagy [34] could apply to LN, namely that this complex acts as a coat component to drive curvature of membranes during LN puncta formation. Alternatively the primary importance of the Atg12p–Atg5p conjugate could be to function as an E3, ubiquitin ligase for Atg8p-PE conjugation [35].Two components of the Atg9p cycling systems, namely Atg11p and Atg27p, are dispensable for LN whereas Atg2p, Atg18p and Atg1p and Atg13p (Table 1) are required for LN. In growing conditions the absence of Atg11p blocks transport of Atg9p to the pre-autophagosome (PAS) [36], [37]. By contrast, under starvation conditions, Atg9 recruitment to the PAS does not require Atg11, but requires interaction with Atg17 [38] which we found to be essential for LN. The anterograde movement of Atg9p to the PAS also depends on Atg23p and Atg27p [39], [40]. Atg27 is reported to shuttle between the PAS, mitochondria, and the Golgi complex. Presumably membrane from these sources is not required for LN as Atg27 was shown to be dispensable for LN.If Atg9p localization at the PAS under starvation conditions is required for LN then the requirement for the Atg1p kinase complex, Atg18p and Atg2p may relate to these autophagy components being normally required for the retrograde movement of Atg9p away from the PAS [41]. Also one might speculate that Atg2p and Atg18p, as peripheral membrane proteins, may localize to the nuclear envelope (NE) and/or vacuolar membrane to co-operate with Atg9p and Atg8-PE to facilitate membrane interactions between vacuole and the nucleus. In this context the role of the Atg1p-Atg13p complex could be, as previously reported [42], to promote the interaction of Atg9p with Atg2p and Atg18p. It is possible that other proteins yet to be identified associate with Atg1p and/or Atg13p to facilitate the process of LN. Vac8p cannot act in such a capacity since it is not required for LN (Table 1), despite it being a putative binding partner of Atg13p.Notably, there are proteins that are not required for LN, but which are required for PMN. The Cvt-specific protein, Atg11p is not required and hence LN is not a Cvt related process. Taken together these differences clearly distinguish LN mechanistically not only from PMN, but also from Cvt thus defining LN as a new selective, starvation-induced autophagic subtype. However, there remains much to be determined about the precise mechanism and timing of membrane re-arrangements driving autophagic turnover of the nucleus during LN, in particular the localization of those Atg proteins essential for LN and the order of their recruitment to the site of LN puncta production.A related question is the possible role of lipid trafficking membrane proteins and their possible contribution to the mechanism of LN. In yeast Osh proteins have been proposed to play a general role in lipid trafficking at membrane contact sites between different organelles including the nucleus and vacuole [43], [44]. Goldfarb and colleagues [5] showed that upon nitrogen starvation, and concomitant with increased expression of Nvj1p, two proteins, Osh1p and Tsc13p, required for PMN [6], [45], [46] are recruited to NV junctions presumably in order to facilitate lipid biosynthesis and trafficking. Whether such proteins are required for LN has not yet been determined, however, if these proteins are recruited for LN then they must interact with a different subset of proteins given that Nvj1p is not required for LN.
The Nature of LN Puncta
Although PMN vesicles, and presumably LN puncta, are formed from components of both the NE and vacuolar membrane, their structure appears to be different. For example, in the vacuole PMN vesicles appear more stable than LN puncta. LN derived puncta can be visualized in atg15Δ (Fig. 5A) and atg22Δ cells (Table 1), pep4Δ (Fig. 5D–F) cells or in wild type cells incubated with the cell permeable serine protease inhibitor, PMSF (data not shown), that inhibits the breakdown of autophagic vesicles in the vacuole. This result suggests that the membrane complement of proteins and lipids of PMN vesicles makes them more resistant to degradation (or dis-assembly). Such properties might arise from the presence of one or both of the membranes (nuclear and vacuolar derived) that presumably contribute to the structure of the vesicles/puncta. At present we can only speculate regarding any membrane surrounding LN puncta that can be observed in atg15Δ or pep4Δ cells. Potentially differences may arise because vesicle or puncta formation involves recruitment of different sub-domains of the NE and/or the vacuolar membrane. For PMN, NE regions lacking the nuclear pore complexes but containing smooth ER-derived membranes with a few integral membrane proteins were reported by Thumm and colleagues [46] as contributing to PMN vesicles.
Alterations in Nuclear Morphology During LN
Cells unable to deliver material to the vacuole by LN (e.g., atg3Δ cells) show altered nuclear morphology. It is not clear whether these alterations are a consequence of LN being mechanistically deranged leading to other alternative outcomes or the inability of cell to remove material from the nucleus. Normal nuclear morphology was observed in atg15Δ (Fig. 5A) and/or atg22Δ cells (data not shown) or wild type cells treated with PMSF (data not shown) in which material is delivered to the vacuole, but not degraded. It is possible these observations reflect an excess of nuclear envelope or the presence of stress prone components of the nucleus in these cells that would normally be removed during nitrogen starvation induced autophagy.Furthermore, the presence of protrusions or ‘horns’ evident after nitrogen starvation can be reversed if cells are taken out of nitrogen starvation and put back into SS+D medium (data not shown). This indicates that alterations in nuclear morphology arise largely as a consequence of nitrogen starvation rather than a deficiency in nucleophagy. Similar alterations in nuclear morphology to those observed here were reported in spo7Δ and nem1Δ [47]–[49]. The SPO7 or NEM1 genes encode proteins that are essential for the maintenance of normal spherical nuclear morphology, but it is unclear why loss of these proteins has an effect on nuclear structure.In addition, we investigated whether altered nuclear morphology might have arisen as a consequence of yeast apoptosis-like processes occurring after extended nitrogen starvation. Propidium iodide nucleic acid stain was used to identify dead cells [50] in wild type, atg3Δ and atg11Δ cultures grown in SS+D or SD−N medium for 24 hrs. We found less than 5% dead cells in all of these cell populations (Fig. S5), whereas the percentage of cells showing LN and/or changes in nuclear morphology was much greater (25–35%). Our conclusion is that apoptosis-like processes do not contribute to altered nuclear morphology.
Other Questions Concerning the Molecular Mechanism of LN
A significant question is whether PMN and LN facilitate the sequestration of different nuclear cargoes. At present we have no clues as to the cargo delivered to the vacuole in LN. This can be addressed by determining if different nuclear components such as histones, nucleolus and nuclear pore complexes are degraded under conditions including PMN and LN. We have established that canonical NV junctions are not required for LN, but it remains to be definitively established whether both PMN and LN may occur at the same regions of nucleus-vacuole interaction. The temporal separation observed indeed suggests that LN and PMN are largely exclusive events perhaps requiring different vacuolar/nuclear contacts and associated components (proteins and/or lipids). Future studies will be directed towards elucidating the nature of the nucleus-vacuole contact during LN, particularly in the absence of Vac8p and Nvj1p proteins, as well any mechanistic and/or functional inter-relationship of LN and PMN.(Higher magnification images corresponding to Figures 3A and 3C, respectively.) (A) Wild type (BY4741) cells co-expressing both nuclear reporters were imaged under growing (SS+D) and nitrogen starvation (SD-N) conditions (3 and 24 hours after commencement of nitrogen starvation), respectively. The appearance of Nvj1p-EYFP-derived vesicles (PMN blebs and/or vesicles) in the vacuole is highlighted by white arrows, whereas accumulation of NAB35-DsRed.T3-derived fluorescence (diffuse red fluorescence) is indicated by yellow arrows. (B) Accumulation of both Nvj1p-EYFP-derived vesicles (PMN blebs and/or vesicles) and accumulation of NAB35-DsRed.T3-derived (diffuse red) fluorescence in the same cells 24 hours after commencement of nitrogen starvation. The appearance of vacuolar vesicles containing both nuclear reporters is indicated by white arrows.(TIF)Click here for additional data file.Percentage of cells showing accumulation of red fluorescence in the vacuole under growing conditions and 24 hours after commencement of nitrogen starvation for wild type and atg null mutant strains (A), and other null mutants strains (B). (C) levels of free GFP degradation product monitored by immunoblotting as described in Materials and Methods. Cytosolic PGK was detected as a loading control. *indicates the presumptive degradation product of n-Rosella lacking the NAB35 nuclear targeting signal. **indicates non-specific degradation product observed only in growing cells (0 hours).(TIF)Click here for additional data file.(A) vac17Δ, tco89Δ, (B) wild type (BY4741), atg6Δ, atg11Δ (C) wild type (BY4741), atg8Δ, atg10Δ and (D) wild type (BY4741), atg3Δ, atg4Δ cells expressing n-Rosella were starved in SD(-N) medium for 0, 6, 12, and 24 hours. The level of free GFP degradation product was monitored by immunoblotting as described in Materials and Methods. * indicates the presumptive degradation product of n-Rosella lacking the NAB35 nuclear targeting signal. Cytosolic PGK was detected as a loading control in panel A.(TIF)Click here for additional data file.(Higher magnification images corresponding to the Figure 5A, 5B, 5D and 5E, respectively.) (A) atg15Δ cells expressing n-Rosella were imaged under growing (SS+D) and nitrogen starvation (SD-N) conditions (24 hours after commencement of nitrogen starvation). Staining with Hoechst 33258 was performed to confirm the targeting of n-Rosella (red and green fluorescence) to the nucleus (24 hours after commencement of nitrogen starvation) and nucleus-derived vesicles/puncta observed in the vacuole. (B) atg15Δ cells co-expressing the nuclear reporters, Nvj1-EYFP and NAB35-DsRed.T3 were imaged under growing (SS+D) and nitrogen starvation (SD-N) conditions (24 hours after commencement of nitrogen starvation). White arrow highlights Nvj1p-EYFP labeled vesicle whereas yellow arrow highlights NAB35-DsRed.T3 labeled vesicle/puncta, respectively. (C) pep4Δ cells expressing n-Rosella were imaged under growing (SS+D) and nitrogen starvation (SD-N) conditions (24 hours after commencement of nitrogen starvation). (D) pep4Δ cells co-expressing the nuclear reporters, Nvj1-EYFP and NAB35-DsRed.T3 were imaged under growing (SS+D) and nitrogen starvation (SD-N) conditions (24 hours after commencement of nitrogen starvation). The appearance of Nvj1p-EYFP-derived vesicles (PMN blebs and/or vesicles) in the vacuole is highlighted by white arrows, whereas accumulation of NAB35-DsRed.T3-derived vesicles/puncta is indicated by yellow arrows. (E) Wild type (BY4741), ego1Δ, vtc4Δ, atg15Δ and pep4Δ cells expressing n-Rosella were starved in SD(-N) medium for 0 and 24 hours, and the levels of free GFP degradation product monitored by immunoblotting as described in Materials and Methods. *indicates the presumptive degradation product of n-Rosella lacking the NAB35 nuclear targeting signal. Cytosolic PGK was detected as a loading control.(TIF)Click here for additional data file.Wild type (BY4741), atg3Δ and atg11Δ cells were grown in SS+D or SD-N medium for 24 hours. Loss of plasma membrane integrity (indication of dead cells) was indicated by PI staining. Cells were incubated with 5 µg/ml of PI for 10 min at room temperature.(TIF)Click here for additional data file.
Authors: T Kirisako; Y Ichimura; H Okada; Y Kabeya; N Mizushima; T Yoshimori; M Ohsumi; T Takao; T Noda; Y Ohsumi Journal: J Cell Biol Date: 2000-10-16 Impact factor: 10.539
Authors: Lorenzo Galluzzi; Eric H Baehrecke; Andrea Ballabio; Patricia Boya; José Manuel Bravo-San Pedro; Francesco Cecconi; Augustine M Choi; Charleen T Chu; Patrice Codogno; Maria Isabel Colombo; Ana Maria Cuervo; Jayanta Debnath; Vojo Deretic; Ivan Dikic; Eeva-Liisa Eskelinen; Gian Maria Fimia; Simone Fulda; David A Gewirtz; Douglas R Green; Malene Hansen; J Wade Harper; Marja Jäättelä; Terje Johansen; Gabor Juhasz; Alec C Kimmelman; Claudine Kraft; Nicholas T Ktistakis; Sharad Kumar; Beth Levine; Carlos Lopez-Otin; Frank Madeo; Sascha Martens; Jennifer Martinez; Alicia Melendez; Noboru Mizushima; Christian Münz; Leon O Murphy; Josef M Penninger; Mauro Piacentini; Fulvio Reggiori; David C Rubinsztein; Kevin M Ryan; Laura Santambrogio; Luca Scorrano; Anna Katharina Simon; Hans-Uwe Simon; Anne Simonsen; Nektarios Tavernarakis; Sharon A Tooze; Tamotsu Yoshimori; Junying Yuan; Zhenyu Yue; Qing Zhong; Guido Kroemer Journal: EMBO J Date: 2017-06-08 Impact factor: 11.598
Authors: Antonia A Nemec; Lauren A Howell; Anna K Peterson; Matthew A Murray; Robert J Tomko Journal: J Biol Chem Date: 2017-11-06 Impact factor: 5.157
Authors: Daniel J Klionsky; Amal Kamal Abdel-Aziz; Sara Abdelfatah; Mahmoud Abdellatif; Asghar Abdoli; Steffen Abel; Hagai Abeliovich; Marie H Abildgaard; Yakubu Princely Abudu; Abraham Acevedo-Arozena; Iannis E Adamopoulos; Khosrow Adeli; Timon E Adolph; Annagrazia Adornetto; Elma Aflaki; Galila Agam; Anupam Agarwal; Bharat B Aggarwal; Maria Agnello; Patrizia Agostinis; Javed N Agrewala; Alexander Agrotis; Patricia V Aguilar; S Tariq Ahmad; Zubair M Ahmed; Ulises Ahumada-Castro; Sonja Aits; Shu Aizawa; Yunus Akkoc; Tonia Akoumianaki; Hafize Aysin Akpinar; Ahmed M Al-Abd; Lina Al-Akra; Abeer Al-Gharaibeh; Moulay A Alaoui-Jamali; Simon Alberti; Elísabet Alcocer-Gómez; Cristiano Alessandri; Muhammad Ali; M Abdul Alim Al-Bari; Saeb Aliwaini; Javad Alizadeh; Eugènia Almacellas; Alexandru Almasan; Alicia Alonso; Guillermo D Alonso; Nihal Altan-Bonnet; Dario C Altieri; Élida M C Álvarez; Sara Alves; Cristine Alves da Costa; Mazen M Alzaharna; Marialaura Amadio; Consuelo Amantini; Cristina Amaral; Susanna Ambrosio; Amal O Amer; Veena Ammanathan; Zhenyi An; Stig U Andersen; Shaida A Andrabi; Magaiver Andrade-Silva; Allen M Andres; Sabrina Angelini; David Ann; Uche C Anozie; Mohammad Y Ansari; Pedro Antas; Adam Antebi; Zuriñe Antón; Tahira Anwar; Lionel Apetoh; Nadezda Apostolova; Toshiyuki Araki; Yasuhiro Araki; Kohei Arasaki; Wagner L Araújo; Jun Araya; Catherine Arden; Maria-Angeles Arévalo; Sandro Arguelles; Esperanza Arias; Jyothi Arikkath; Hirokazu Arimoto; Aileen R Ariosa; Darius Armstrong-James; Laetitia Arnauné-Pelloquin; Angeles Aroca; Daniela S Arroyo; Ivica Arsov; Rubén Artero; Dalia Maria Lucia Asaro; Michael Aschner; Milad Ashrafizadeh; Osnat Ashur-Fabian; Atanas G Atanasov; Alicia K Au; Patrick Auberger; Holger W Auner; Laure Aurelian; Riccardo Autelli; Laura Avagliano; Yenniffer Ávalos; Sanja Aveic; Célia Alexandra Aveleira; Tamar Avin-Wittenberg; Yucel Aydin; Scott Ayton; Srinivas Ayyadevara; Maria Azzopardi; Misuzu Baba; Jonathan M Backer; Steven K Backues; Dong-Hun Bae; Ok-Nam Bae; Soo Han Bae; Eric H Baehrecke; Ahruem Baek; Seung-Hoon Baek; Sung Hee Baek; Giacinto Bagetta; Agnieszka Bagniewska-Zadworna; Hua Bai; Jie Bai; Xiyuan Bai; Yidong Bai; Nandadulal Bairagi; Shounak Baksi; Teresa Balbi; Cosima T Baldari; Walter Balduini; Andrea Ballabio; Maria Ballester; Salma Balazadeh; Rena Balzan; Rina Bandopadhyay; Sreeparna Banerjee; Sulagna Banerjee; Ágnes Bánréti; Yan Bao; Mauricio S Baptista; Alessandra Baracca; Cristiana Barbati; Ariadna Bargiela; Daniela Barilà; Peter G Barlow; Sami J Barmada; Esther Barreiro; George E Barreto; Jiri Bartek; Bonnie Bartel; Alberto Bartolome; Gaurav R Barve; Suresh H Basagoudanavar; Diane C Bassham; Robert C Bast; Alakananda Basu; Henri Batoko; Isabella Batten; Etienne E Baulieu; Bradley L Baumgarner; Jagadeesh Bayry; Rupert Beale; Isabelle Beau; Florian Beaumatin; Luiz R G Bechara; George R Beck; Michael F Beers; Jakob Begun; Christian Behrends; Georg M N Behrens; Roberto Bei; Eloy Bejarano; Shai Bel; Christian Behl; Amine Belaid; Naïma Belgareh-Touzé; Cristina Bellarosa; Francesca Belleudi; Melissa Belló Pérez; Raquel Bello-Morales; Jackeline Soares de Oliveira Beltran; Sebastián Beltran; Doris Mangiaracina Benbrook; Mykolas Bendorius; Bruno A Benitez; Irene Benito-Cuesta; Julien Bensalem; Martin W Berchtold; Sabina Berezowska; Daniele Bergamaschi; Matteo Bergami; Andreas Bergmann; Laura Berliocchi; Clarisse Berlioz-Torrent; Amélie Bernard; Lionel Berthoux; Cagri G Besirli; Sebastien Besteiro; Virginie M Betin; Rudi Beyaert; Jelena S Bezbradica; Kiran Bhaskar; Ingrid Bhatia-Kissova; Resham Bhattacharya; Sujoy Bhattacharya; Shalmoli Bhattacharyya; Md Shenuarin Bhuiyan; Sujit Kumar Bhutia; Lanrong Bi; Xiaolin Bi; Trevor J Biden; Krikor Bijian; Viktor A Billes; Nadine Binart; Claudia Bincoletto; Asa B Birgisdottir; Geir Bjorkoy; Gonzalo Blanco; Ana Blas-Garcia; Janusz Blasiak; Robert Blomgran; Klas Blomgren; Janice S Blum; Emilio Boada-Romero; Mirta Boban; Kathleen Boesze-Battaglia; Philippe Boeuf; Barry Boland; Pascale Bomont; Paolo Bonaldo; Srinivasa Reddy Bonam; Laura Bonfili; Juan S Bonifacino; Brian A Boone; Martin D Bootman; Matteo Bordi; Christoph Borner; Beat C Bornhauser; Gautam Borthakur; Jürgen Bosch; Santanu Bose; Luis M Botana; Juan Botas; Chantal M Boulanger; Michael E Boulton; Mathieu Bourdenx; Benjamin Bourgeois; Nollaig M Bourke; Guilhem Bousquet; Patricia Boya; Peter V Bozhkov; Luiz H M Bozi; Tolga O Bozkurt; Doug E Brackney; Christian H Brandts; Ralf J Braun; Gerhard H Braus; Roberto Bravo-Sagua; José M Bravo-San Pedro; Patrick Brest; Marie-Agnès Bringer; Alfredo Briones-Herrera; V Courtney Broaddus; Peter Brodersen; Jeffrey L Brodsky; Steven L Brody; Paola G Bronson; Jeff M Bronstein; Carolyn N Brown; Rhoderick E Brown; Patricia C Brum; John H Brumell; Nicola Brunetti-Pierri; Daniele Bruno; Robert J Bryson-Richardson; Cecilia Bucci; Carmen Buchrieser; Marta Bueno; Laura Elisa Buitrago-Molina; Simone Buraschi; Shilpa Buch; J Ross Buchan; Erin M Buckingham; Hikmet Budak; Mauricio Budini; Geert Bultynck; Florin Burada; Joseph R Burgoyne; M Isabel Burón; Victor Bustos; Sabrina Büttner; Elena Butturini; Aaron Byrd; Isabel Cabas; Sandra Cabrera-Benitez; Ken Cadwell; Jingjing Cai; Lu Cai; Qian Cai; Montserrat Cairó; Jose A Calbet; Guy A Caldwell; Kim A Caldwell; Jarrod A Call; Riccardo Calvani; Ana C Calvo; Miguel Calvo-Rubio Barrera; Niels Os Camara; Jacques H Camonis; Nadine Camougrand; Michelangelo Campanella; Edward M Campbell; François-Xavier Campbell-Valois; Silvia Campello; Ilaria Campesi; Juliane C Campos; Olivier Camuzard; Jorge Cancino; Danilo Candido de Almeida; Laura Canesi; Isabella Caniggia; Barbara Canonico; Carles Cantí; Bin Cao; Michele Caraglia; Beatriz Caramés; Evie H Carchman; Elena Cardenal-Muñoz; Cesar Cardenas; Luis Cardenas; Sandra M Cardoso; Jennifer S Carew; Georges F Carle; Gillian Carleton; Silvia Carloni; Didac Carmona-Gutierrez; Leticia A Carneiro; Oliana Carnevali; Julian M Carosi; Serena Carra; Alice Carrier; Lucie Carrier; Bernadette Carroll; A Brent Carter; Andreia Neves Carvalho; Magali Casanova; Caty Casas; Josefina Casas; Chiara Cassioli; Eliseo F Castillo; Karen Castillo; Sonia Castillo-Lluva; Francesca Castoldi; Marco Castori; Ariel F Castro; Margarida Castro-Caldas; Javier Castro-Hernandez; Susana Castro-Obregon; Sergio D Catz; Claudia Cavadas; Federica Cavaliere; Gabriella Cavallini; Maria Cavinato; Maria L Cayuela; Paula Cebollada Rica; Valentina Cecarini; Francesco Cecconi; Marzanna Cechowska-Pasko; Simone Cenci; Victòria Ceperuelo-Mallafré; João J Cerqueira; Janete M Cerutti; Davide Cervia; Vildan Bozok Cetintas; Silvia Cetrullo; Han-Jung Chae; Andrei S Chagin; Chee-Yin Chai; Gopal Chakrabarti; Oishee Chakrabarti; Tapas Chakraborty; Trinad Chakraborty; Mounia Chami; Georgios Chamilos; David W Chan; Edmond Y W Chan; Edward D Chan; H Y Edwin Chan; Helen H Chan; Hung Chan; Matthew T V Chan; Yau Sang Chan; Partha K Chandra; Chih-Peng Chang; Chunmei Chang; Hao-Chun Chang; Kai Chang; Jie Chao; Tracey Chapman; Nicolas Charlet-Berguerand; Samrat Chatterjee; Shail K Chaube; Anu Chaudhary; Santosh Chauhan; Edward Chaum; Frédéric Checler; Michael E Cheetham; Chang-Shi Chen; Guang-Chao Chen; Jian-Fu Chen; Liam L Chen; Leilei Chen; Lin Chen; Mingliang Chen; Mu-Kuan Chen; Ning Chen; Quan Chen; Ruey-Hwa Chen; Shi Chen; Wei Chen; Weiqiang Chen; Xin-Ming Chen; Xiong-Wen Chen; Xu Chen; Yan Chen; Ye-Guang Chen; Yingyu Chen; Yongqiang Chen; Yu-Jen Chen; Yue-Qin Chen; Zhefan Stephen Chen; Zhi Chen; Zhi-Hua Chen; Zhijian J Chen; Zhixiang Chen; Hanhua Cheng; Jun Cheng; Shi-Yuan Cheng; Wei Cheng; Xiaodong Cheng; Xiu-Tang Cheng; Yiyun Cheng; Zhiyong Cheng; Zhong Chen; Heesun Cheong; Jit Kong Cheong; Boris V Chernyak; Sara Cherry; Chi Fai Randy Cheung; Chun Hei Antonio Cheung; King-Ho Cheung; Eric Chevet; Richard J Chi; Alan Kwok Shing Chiang; Ferdinando Chiaradonna; Roberto Chiarelli; Mario Chiariello; Nathalia Chica; Susanna Chiocca; Mario Chiong; Shih-Hwa Chiou; Abhilash I Chiramel; Valerio Chiurchiù; Dong-Hyung Cho; Seong-Kyu Choe; Augustine M K Choi; Mary E Choi; Kamalika Roy Choudhury; Norman S Chow; Charleen T Chu; Jason P Chua; John Jia En Chua; Hyewon Chung; Kin Pan Chung; Seockhoon Chung; So-Hyang Chung; Yuen-Li Chung; Valentina Cianfanelli; Iwona A Ciechomska; Mariana Cifuentes; Laura Cinque; Sebahattin Cirak; Mara Cirone; Michael J Clague; Robert Clarke; Emilio Clementi; Eliana M Coccia; Patrice Codogno; Ehud Cohen; Mickael M Cohen; Tania Colasanti; Fiorella Colasuonno; Robert A Colbert; Anna Colell; Miodrag Čolić; Nuria S Coll; Mark O Collins; María I Colombo; Daniel A Colón-Ramos; Lydie Combaret; Sergio Comincini; Márcia R Cominetti; Antonella Consiglio; Andrea Conte; Fabrizio Conti; Viorica Raluca Contu; Mark R Cookson; Kevin M Coombs; Isabelle Coppens; Maria Tiziana Corasaniti; Dale P Corkery; Nils Cordes; Katia Cortese; Maria do Carmo Costa; Sarah Costantino; Paola Costelli; Ana Coto-Montes; Peter J Crack; Jose L Crespo; Alfredo Criollo; Valeria Crippa; Riccardo Cristofani; Tamas Csizmadia; Antonio Cuadrado; Bing Cui; Jun Cui; Yixian Cui; Yong Cui; Emmanuel Culetto; Andrea C Cumino; Andrey V Cybulsky; Mark J Czaja; Stanislaw J Czuczwar; Stefania D'Adamo; Marcello D'Amelio; Daniela D'Arcangelo; Andrew C D'Lugos; Gabriella D'Orazi; James A da Silva; Hormos Salimi Dafsari; Ruben K Dagda; Yasin Dagdas; Maria Daglia; Xiaoxia Dai; Yun Dai; Yuyuan Dai; Jessica Dal Col; Paul Dalhaimer; Luisa Dalla Valle; Tobias Dallenga; Guillaume Dalmasso; Markus Damme; Ilaria Dando; Nico P Dantuma; April L Darling; Hiranmoy Das; Srinivasan Dasarathy; Santosh K Dasari; Srikanta Dash; Oliver Daumke; Adrian N Dauphinee; Jeffrey S Davies; Valeria A Dávila; Roger J Davis; Tanja Davis; Sharadha Dayalan Naidu; Francesca De Amicis; Karolien De Bosscher; Francesca De Felice; Lucia De Franceschi; Chiara De Leonibus; Mayara G de Mattos Barbosa; Guido R Y De Meyer; Angelo De Milito; Cosimo De Nunzio; Clara De Palma; Mauro De Santi; Claudio De Virgilio; Daniela De Zio; Jayanta Debnath; Brian J DeBosch; Jean-Paul Decuypere; Mark A Deehan; Gianluca Deflorian; James DeGregori; Benjamin Dehay; Gabriel Del Rio; Joe R Delaney; Lea M D Delbridge; Elizabeth Delorme-Axford; M Victoria Delpino; Francesca Demarchi; Vilma Dembitz; Nicholas D Demers; Hongbin Deng; Zhiqiang Deng; Joern Dengjel; Paul Dent; Donna Denton; Melvin L DePamphilis; Channing J Der; Vojo Deretic; Albert Descoteaux; Laura Devis; Sushil Devkota; Olivier Devuyst; Grant Dewson; Mahendiran Dharmasivam; Rohan Dhiman; Diego di Bernardo; Manlio Di Cristina; Fabio Di Domenico; Pietro Di Fazio; Alessio Di Fonzo; Giovanni Di Guardo; Gianni M Di Guglielmo; Luca Di Leo; Chiara Di Malta; Alessia Di Nardo; Martina Di Rienzo; Federica Di Sano; George Diallinas; Jiajie Diao; Guillermo Diaz-Araya; Inés Díaz-Laviada; Jared M Dickinson; Marc Diederich; Mélanie Dieudé; Ivan Dikic; Shiping Ding; Wen-Xing Ding; Luciana Dini; Jelena Dinić; Miroslav Dinic; Albena T Dinkova-Kostova; Marc S Dionne; Jörg H W Distler; Abhinav Diwan; Ian M C Dixon; Mojgan Djavaheri-Mergny; Ina Dobrinski; Oxana Dobrovinskaya; Radek Dobrowolski; Renwick C J Dobson; Jelena Đokić; Serap Dokmeci Emre; Massimo Donadelli; Bo Dong; Xiaonan Dong; Zhiwu Dong; Gerald W Dorn Ii; Volker Dotsch; Huan Dou; Juan Dou; Moataz Dowaidar; Sami Dridi; Liat Drucker; Ailian Du; Caigan Du; Guangwei Du; Hai-Ning Du; Li-Lin Du; André du Toit; Shao-Bin Duan; Xiaoqiong Duan; Sónia P Duarte; Anna Dubrovska; Elaine A Dunlop; Nicolas Dupont; Raúl V Durán; Bilikere S Dwarakanath; Sergey A Dyshlovoy; Darius Ebrahimi-Fakhari; Leopold Eckhart; Charles L Edelstein; Thomas Efferth; Eftekhar Eftekharpour; Ludwig Eichinger; Nabil Eid; Tobias Eisenberg; N Tony Eissa; Sanaa Eissa; Miriam Ejarque; Abdeljabar El Andaloussi; Nazira El-Hage; Shahenda El-Naggar; Anna Maria Eleuteri; Eman S El-Shafey; Mohamed Elgendy; Aristides G Eliopoulos; María M Elizalde; Philip M Elks; Hans-Peter Elsasser; Eslam S Elsherbiny; Brooke M Emerling; N C Tolga Emre; Christina H Eng; Nikolai Engedal; Anna-Mart Engelbrecht; Agnete S T Engelsen; Jorrit M Enserink; Ricardo Escalante; Audrey Esclatine; Mafalda Escobar-Henriques; Eeva-Liisa Eskelinen; Lucile Espert; Makandjou-Ola Eusebio; Gemma Fabrias; Cinzia Fabrizi; Antonio Facchiano; Francesco Facchiano; Bengt Fadeel; Claudio Fader; Alex C Faesen; W Douglas Fairlie; Alberto Falcó; Bjorn H Falkenburger; Daping Fan; Jie Fan; Yanbo Fan; Evandro F Fang; Yanshan Fang; Yognqi Fang; Manolis Fanto; Tamar Farfel-Becker; Mathias Faure; Gholamreza Fazeli; Anthony O Fedele; Arthur M Feldman; Du Feng; Jiachun Feng; Lifeng Feng; Yibin Feng; Yuchen Feng; Wei Feng; Thais Fenz Araujo; Thomas A Ferguson; Álvaro F Fernández; Jose C Fernandez-Checa; Sonia Fernández-Veledo; Alisdair R Fernie; Anthony W Ferrante; Alessandra Ferraresi; Merari F Ferrari; Julio C B Ferreira; Susan Ferro-Novick; Antonio Figueras; Riccardo Filadi; Nicoletta Filigheddu; Eduardo Filippi-Chiela; Giuseppe Filomeni; Gian Maria Fimia; Vittorio Fineschi; Francesca Finetti; Steven Finkbeiner; Edward A Fisher; Paul B Fisher; Flavio Flamigni; Steven J Fliesler; Trude H Flo; Ida Florance; Oliver Florey; Tullio Florio; Erika Fodor; Carlo Follo; Edward A Fon; Antonella Forlino; Francesco Fornai; Paola Fortini; Anna Fracassi; Alessandro Fraldi; Brunella Franco; Rodrigo Franco; Flavia Franconi; Lisa B Frankel; Scott L Friedman; Leopold F Fröhlich; Gema Frühbeck; Jose M Fuentes; Yukio Fujiki; Naonobu Fujita; Yuuki Fujiwara; Mitsunori Fukuda; Simone Fulda; Luc Furic; Norihiko Furuya; Carmela Fusco; Michaela U Gack; Lidia Gaffke; Sehamuddin Galadari; Alessia Galasso; Maria F Galindo; Sachith Gallolu Kankanamalage; Lorenzo Galluzzi; Vincent Galy; Noor Gammoh; Boyi Gan; Ian G Ganley; Feng Gao; Hui Gao; Minghui Gao; Ping Gao; Shou-Jiang Gao; Wentao Gao; Xiaobo Gao; Ana Garcera; Maria Noé Garcia; Verónica E Garcia; Francisco García-Del Portillo; Vega Garcia-Escudero; Aracely Garcia-Garcia; Marina Garcia-Macia; Diana García-Moreno; Carmen Garcia-Ruiz; Patricia García-Sanz; Abhishek D Garg; Ricardo Gargini; Tina Garofalo; Robert F Garry; Nils C Gassen; Damian Gatica; Liang Ge; Wanzhong Ge; Ruth Geiss-Friedlander; Cecilia Gelfi; Pascal Genschik; Ian E Gentle; Valeria Gerbino; Christoph Gerhardt; Kyla Germain; Marc Germain; David A Gewirtz; Elham Ghasemipour Afshar; Saeid Ghavami; Alessandra Ghigo; Manosij Ghosh; Georgios Giamas; Claudia Giampietri; Alexandra Giatromanolaki; Gary E Gibson; Spencer B Gibson; Vanessa Ginet; Edward Giniger; Carlotta Giorgi; Henrique Girao; Stephen E Girardin; Mridhula Giridharan; Sandy Giuliano; Cecilia Giulivi; Sylvie Giuriato; Julien Giustiniani; Alexander Gluschko; Veit Goder; Alexander Goginashvili; Jakub Golab; David C Goldstone; Anna Golebiewska; Luciana R Gomes; Rodrigo Gomez; Rubén Gómez-Sánchez; Maria Catalina Gomez-Puerto; Raquel Gomez-Sintes; Qingqiu Gong; Felix M Goni; Javier González-Gallego; Tomas Gonzalez-Hernandez; Rosa A Gonzalez-Polo; Jose A Gonzalez-Reyes; Patricia González-Rodríguez; Ing Swie Goping; Marina S Gorbatyuk; Nikolai V Gorbunov; Kıvanç Görgülü; Roxana M Gorojod; Sharon M Gorski; Sandro Goruppi; Cecilia Gotor; Roberta A Gottlieb; Illana Gozes; Devrim Gozuacik; Martin Graef; Markus H Gräler; Veronica Granatiero; Daniel Grasso; Joshua P Gray; Douglas R Green; Alexander Greenhough; Stephen L Gregory; Edward F Griffin; Mark W Grinstaff; Frederic Gros; Charles Grose; Angelina S Gross; Florian Gruber; Paolo Grumati; Tilman Grune; Xueyan Gu; Jun-Lin Guan; Carlos M Guardia; Kishore Guda; Flora Guerra; Consuelo Guerri; Prasun Guha; Carlos Guillén; Shashi Gujar; Anna Gukovskaya; Ilya Gukovsky; Jan Gunst; Andreas Günther; Anyonya R Guntur; Chuanyong Guo; Chun Guo; Hongqing Guo; Lian-Wang Guo; Ming Guo; Pawan Gupta; Shashi Kumar Gupta; Swapnil Gupta; Veer Bala Gupta; Vivek Gupta; Asa B Gustafsson; David D Gutterman; Ranjitha H B; Annakaisa Haapasalo; James E Haber; Aleksandra Hać; Shinji Hadano; Anders J Hafrén; Mansour Haidar; Belinda S Hall; Gunnel Halldén; Anne Hamacher-Brady; Andrea Hamann; Maho Hamasaki; Weidong Han; Malene Hansen; Phyllis I Hanson; Zijian Hao; Masaru Harada; Ljubica Harhaji-Trajkovic; Nirmala Hariharan; Nigil Haroon; James Harris; Takafumi Hasegawa; Noor Hasima Nagoor; Jeffrey A Haspel; Volker Haucke; Wayne D Hawkins; Bruce A Hay; Cole M Haynes; Soren B Hayrabedyan; Thomas S Hays; Congcong He; Qin He; Rong-Rong He; You-Wen He; Yu-Ying He; Yasser Heakal; Alexander M Heberle; J Fielding Hejtmancik; Gudmundur Vignir Helgason; Vanessa Henkel; Marc Herb; Alexander Hergovich; Anna Herman-Antosiewicz; Agustín Hernández; Carlos Hernandez; Sergio Hernandez-Diaz; Virginia Hernandez-Gea; Amaury Herpin; Judit Herreros; Javier H Hervás; Daniel Hesselson; Claudio Hetz; Volker T Heussler; Yujiro Higuchi; Sabine Hilfiker; Joseph A Hill; William S Hlavacek; Emmanuel A Ho; Idy H T Ho; Philip Wing-Lok Ho; Shu-Leong Ho; Wan Yun Ho; G Aaron Hobbs; Mark Hochstrasser; Peter H M Hoet; Daniel Hofius; Paul Hofman; Annika Höhn; Carina I Holmberg; Jose R Hombrebueno; Chang-Won Hong Yi-Ren Hong; Lora V Hooper; Thorsten Hoppe; Rastislav Horos; Yujin Hoshida; I-Lun Hsin; Hsin-Yun Hsu; Bing Hu; Dong Hu; Li-Fang Hu; Ming Chang Hu; Ronggui Hu; Wei Hu; Yu-Chen Hu; Zhuo-Wei Hu; Fang Hua; Jinlian Hua; Yingqi Hua; Chongmin Huan; Canhua Huang; Chuanshu Huang; Chuanxin Huang; Chunling Huang; Haishan Huang; Kun Huang; Michael L H Huang; Rui Huang; Shan Huang; Tianzhi Huang; Xing Huang; Yuxiang Jack Huang; Tobias B Huber; Virginie Hubert; Christian A Hubner; Stephanie M Hughes; William E Hughes; Magali Humbert; Gerhard Hummer; James H Hurley; Sabah Hussain; Salik Hussain; Patrick J Hussey; Martina Hutabarat; Hui-Yun Hwang; Seungmin Hwang; Antonio Ieni; Fumiyo Ikeda; Yusuke Imagawa; Yuzuru Imai; Carol Imbriano; Masaya Imoto; Denise M Inman; Ken Inoki; Juan Iovanna; Renato V Iozzo; Giuseppe Ippolito; Javier E Irazoqui; Pablo Iribarren; Mohd Ishaq; Makoto Ishikawa; Nestor Ishimwe; Ciro Isidoro; Nahed Ismail; Shohreh Issazadeh-Navikas; Eisuke Itakura; Daisuke Ito; Davor Ivankovic; Saška Ivanova; Anand Krishnan V Iyer; José M Izquierdo; Masanori Izumi; Marja Jäättelä; Majid Sakhi Jabir; William T Jackson; Nadia Jacobo-Herrera; Anne-Claire Jacomin; Elise Jacquin; Pooja Jadiya; Hartmut Jaeschke; Chinnaswamy Jagannath; Arjen J Jakobi; Johan Jakobsson; Bassam Janji; Pidder Jansen-Dürr; Patric J Jansson; Jonathan Jantsch; Sławomir Januszewski; Alagie Jassey; Steve Jean; Hélène Jeltsch-David; Pavla Jendelova; Andreas Jenny; Thomas E Jensen; Niels Jessen; Jenna L Jewell; Jing Ji; Lijun Jia; Rui Jia; Liwen Jiang; Qing Jiang; Richeng Jiang; Teng Jiang; Xuejun Jiang; Yu Jiang; Maria Jimenez-Sanchez; Eun-Jung Jin; Fengyan Jin; Hongchuan Jin; Li Jin; Luqi Jin; Meiyan Jin; Si Jin; Eun-Kyeong Jo; Carine Joffre; Terje Johansen; Gail V W Johnson; Simon A Johnston; Eija Jokitalo; Mohit Kumar Jolly; Leo A B Joosten; Joaquin Jordan; Bertrand Joseph; Dianwen Ju; Jeong-Sun Ju; Jingfang Ju; Esmeralda Juárez; Delphine Judith; Gábor Juhász; Youngsoo Jun; Chang Hwa Jung; Sung-Chul Jung; Yong Keun Jung; Heinz Jungbluth; Johannes Jungverdorben; Steffen Just; Kai Kaarniranta; Allen Kaasik; Tomohiro Kabuta; Daniel Kaganovich; Alon Kahana; Renate Kain; Shinjo Kajimura; Maria Kalamvoki; Manjula Kalia; Danuta S Kalinowski; Nina Kaludercic; Ioanna Kalvari; Joanna Kaminska; Vitaliy O Kaminskyy; Hiromitsu Kanamori; Keizo Kanasaki; Chanhee Kang; Rui Kang; Sang Sun Kang; Senthilvelrajan Kaniyappan; Tomotake Kanki; Thirumala-Devi Kanneganti; Anumantha G Kanthasamy; Arthi Kanthasamy; Marc Kantorow; Orsolya Kapuy; Michalis V Karamouzis; Md Razaul Karim; Parimal Karmakar; Rajesh G Katare; Masaru Kato; Stefan H E Kaufmann; Anu Kauppinen; Gur P Kaushal; Susmita Kaushik; Kiyoshi Kawasaki; Kemal Kazan; Po-Yuan Ke; Damien J Keating; Ursula Keber; John H Kehrl; Kate E Keller; Christian W Keller; Jongsook Kim Kemper; Candia M Kenific; Oliver Kepp; Stephanie Kermorgant; Andreas Kern; Robin Ketteler; Tom G Keulers; Boris Khalfin; Hany Khalil; Bilon Khambu; Shahid Y Khan; Vinoth Kumar Megraj Khandelwal; Rekha Khandia; Widuri Kho; Noopur V Khobrekar; Sataree Khuansuwan; Mukhran Khundadze; Samuel A Killackey; Dasol Kim; Deok Ryong Kim; Do-Hyung Kim; Dong-Eun Kim; Eun Young Kim; Eun-Kyoung Kim; Hak-Rim Kim; Hee-Sik Kim; Jeong Hun Kim; Jin Kyung Kim; Jin-Hoi Kim; Joungmok Kim; Ju Hwan Kim; Keun Il Kim; Peter K Kim; Seong-Jun Kim; Scot R Kimball; Adi Kimchi; Alec C Kimmelman; Tomonori Kimura; Matthew A King; Kerri J Kinghorn; Conan G Kinsey; Vladimir Kirkin; Lorrie A Kirshenbaum; Sergey L Kiselev; Shuji Kishi; Katsuhiko Kitamoto; Yasushi Kitaoka; Kaio Kitazato; Richard N Kitsis; Josef T Kittler; Ole Kjaerulff; Peter S Klein; Thomas Klopstock; Jochen Klucken; Helene Knævelsrud; Roland L Knorr; Ben C B Ko; Fred Ko; Jiunn-Liang Ko; Hotaka Kobayashi; Satoru Kobayashi; Ina Koch; Jan C Koch; Ulrich Koenig; Donat Kögel; Young Ho Koh; Masato Koike; Sepp D Kohlwein; Nur M Kocaturk; Masaaki Komatsu; Jeannette König; Toru Kono; Benjamin T Kopp; Tamas Korcsmaros; Gözde Korkmaz; Viktor I Korolchuk; Mónica Suárez Korsnes; Ali Koskela; Janaiah Kota; Yaichiro Kotake; Monica L Kotler; Yanjun Kou; Michael I Koukourakis; Evangelos Koustas; Attila L Kovacs; Tibor Kovács; Daisuke Koya; Tomohiro Kozako; Claudine Kraft; Dimitri Krainc; Helmut Krämer; Anna D Krasnodembskaya; Carole Kretz-Remy; Guido Kroemer; Nicholas T Ktistakis; Kazuyuki Kuchitsu; Sabine Kuenen; Lars Kuerschner; Thomas Kukar; Ajay Kumar; Ashok Kumar; Deepak Kumar; Dhiraj Kumar; Sharad Kumar; Shinji Kume; Caroline Kumsta; Chanakya N Kundu; Mondira Kundu; Ajaikumar B Kunnumakkara; Lukasz Kurgan; Tatiana G Kutateladze; Ozlem Kutlu; SeongAe Kwak; Ho Jeong Kwon; Taeg Kyu Kwon; Yong Tae Kwon; Irene Kyrmizi; Albert La Spada; Patrick Labonté; Sylvain Ladoire; Ilaria Laface; Frank Lafont; Diane C Lagace; Vikramjit Lahiri; Zhibing Lai; Angela S Laird; Aparna Lakkaraju; Trond Lamark; Sheng-Hui Lan; Ane Landajuela; Darius J R Lane; Jon D Lane; Charles H Lang; Carsten Lange; Ülo Langel; Rupert Langer; Pierre Lapaquette; Jocelyn Laporte; Nicholas F LaRusso; Isabel Lastres-Becker; Wilson Chun Yu Lau; Gordon W Laurie; Sergio Lavandero; Betty Yuen Kwan Law; Helen Ka-Wai Law; Rob Layfield; Weidong Le; Herve Le Stunff; Alexandre Y Leary; Jean-Jacques Lebrun; Lionel Y W Leck; Jean-Philippe Leduc-Gaudet; Changwook Lee; Chung-Pei Lee; Da-Hye Lee; Edward B Lee; Erinna F Lee; Gyun Min Lee; He-Jin Lee; Heung Kyu Lee; Jae Man Lee; Jason S Lee; Jin-A Lee; Joo-Yong Lee; Jun Hee Lee; Michael Lee; Min Goo Lee; Min Jae Lee; Myung-Shik Lee; Sang Yoon Lee; Seung-Jae Lee; Stella Y Lee; Sung Bae Lee; Won Hee Lee; Ying-Ray Lee; Yong-Ho Lee; Youngil Lee; Christophe Lefebvre; Renaud Legouis; Yu L Lei; Yuchen Lei; Sergey Leikin; Gerd Leitinger; Leticia Lemus; Shuilong Leng; Olivia Lenoir; Guido Lenz; Heinz Josef Lenz; Paola Lenzi; Yolanda León; Andréia M Leopoldino; Christoph Leschczyk; Stina Leskelä; Elisabeth Letellier; Chi-Ting Leung; Po Sing Leung; Jeremy S Leventhal; Beth Levine; Patrick A Lewis; Klaus Ley; Bin Li; Da-Qiang Li; Jianming Li; Jing Li; Jiong Li; Ke Li; Liwu Li; Mei Li; Min Li; Min Li; Ming Li; Mingchuan Li; Pin-Lan Li; Ming-Qing Li; Qing Li; Sheng Li; Tiangang Li; Wei Li; Wenming Li; Xue Li; Yi-Ping Li; Yuan Li; Zhiqiang Li; Zhiyong Li; Zhiyuan Li; Jiqin Lian; Chengyu Liang; Qiangrong Liang; Weicheng Liang; Yongheng Liang; YongTian Liang; Guanghong Liao; Lujian Liao; Mingzhi Liao; Yung-Feng Liao; Mariangela Librizzi; Pearl P Y Lie; Mary A Lilly; Hyunjung J Lim; Thania R R Lima; Federica Limana; Chao Lin; Chih-Wen Lin; Dar-Shong Lin; Fu-Cheng Lin; Jiandie D Lin; Kurt M Lin; Kwang-Huei Lin; Liang-Tzung Lin; Pei-Hui Lin; Qiong Lin; Shaofeng Lin; Su-Ju Lin; Wenyu Lin; Xueying Lin; Yao-Xin Lin; Yee-Shin Lin; Rafael Linden; Paula Lindner; Shuo-Chien Ling; Paul Lingor; Amelia K Linnemann; Yih-Cherng Liou; Marta M Lipinski; Saška Lipovšek; Vitor A Lira; Natalia Lisiak; Paloma B Liton; Chao Liu; Ching-Hsuan Liu; Chun-Feng Liu; Cui Hua Liu; Fang Liu; Hao Liu; Hsiao-Sheng Liu; Hua-Feng Liu; Huifang Liu; Jia Liu; Jing Liu; Julia Liu; Leyuan Liu; Longhua Liu; Meilian Liu; Qin Liu; Wei Liu; Wende Liu; Xiao-Hong Liu; Xiaodong Liu; Xingguo Liu; Xu Liu; Xuedong Liu; Yanfen Liu; Yang Liu; Yang Liu; Yueyang Liu; Yule Liu; J Andrew Livingston; Gerard Lizard; Jose M Lizcano; Senka Ljubojevic-Holzer; Matilde E LLeonart; David Llobet-Navàs; Alicia Llorente; Chih Hung Lo; Damián Lobato-Márquez; Qi Long; Yun Chau Long; Ben Loos; Julia A Loos; Manuela G López; Guillermo López-Doménech; José Antonio López-Guerrero; Ana T López-Jiménez; Óscar López-Pérez; Israel López-Valero; Magdalena J Lorenowicz; Mar Lorente; Peter Lorincz; Laura Lossi; Sophie Lotersztajn; Penny E Lovat; Jonathan F Lovell; Alenka Lovy; Péter Lőw; Guang Lu; Haocheng Lu; Jia-Hong Lu; Jin-Jian Lu; Mengji Lu; Shuyan Lu; Alessandro Luciani; John M Lucocq; Paula Ludovico; Micah A Luftig; Morten Luhr; Diego Luis-Ravelo; Julian J Lum; Liany Luna-Dulcey; Anders H Lund; Viktor K Lund; Jan D Lünemann; Patrick Lüningschrör; Honglin Luo; Rongcan Luo; Shouqing Luo; Zhi Luo; Claudio Luparello; Bernhard Lüscher; Luan Luu; Alex Lyakhovich; Konstantin G Lyamzaev; Alf Håkon Lystad; Lyubomyr Lytvynchuk; Alvin C Ma; Changle Ma; Mengxiao Ma; Ning-Fang Ma; Quan-Hong Ma; Xinliang Ma; Yueyun Ma; Zhenyi Ma; Ormond A MacDougald; Fernando Macian; Gustavo C MacIntosh; Jeffrey P MacKeigan; Kay F Macleod; Sandra Maday; Frank Madeo; Muniswamy Madesh; Tobias Madl; Julio Madrigal-Matute; Akiko Maeda; Yasuhiro Maejima; Marta Magarinos; Poornima Mahavadi; Emiliano Maiani; Kenneth Maiese; Panchanan Maiti; Maria Chiara Maiuri; Barbara Majello; Michael B Major; Elena Makareeva; Fayaz Malik; Karthik Mallilankaraman; Walter Malorni; Alina Maloyan; Najiba Mammadova; Gene Chi Wai Man; Federico Manai; Joseph D Mancias; Eva-Maria Mandelkow; Michael A Mandell; Angelo A Manfredi; Masoud H Manjili; Ravi Manjithaya; Patricio Manque; Bella B Manshian; Raquel Manzano; Claudia Manzoni; Kai Mao; Cinzia Marchese; Sandrine Marchetti; Anna Maria Marconi; Fabrizio Marcucci; Stefania Mardente; Olga A Mareninova; Marta Margeta; Muriel Mari; Sara Marinelli; Oliviero Marinelli; Guillermo Mariño; Sofia Mariotto; Richard S Marshall; Mark R Marten; Sascha Martens; Alexandre P J Martin; Katie R Martin; Sara Martin; Shaun Martin; Adrián Martín-Segura; Miguel A Martín-Acebes; Inmaculada Martin-Burriel; Marcos Martin-Rincon; Paloma Martin-Sanz; José A Martina; Wim Martinet; Aitor Martinez; Ana Martinez; Jennifer Martinez; Moises Martinez Velazquez; Nuria Martinez-Lopez; Marta Martinez-Vicente; Daniel O Martins; Joilson O Martins; Waleska K Martins; Tania Martins-Marques; Emanuele Marzetti; Shashank Masaldan; Celine Masclaux-Daubresse; Douglas G Mashek; Valentina Massa; Lourdes Massieu; Glenn R Masson; Laura Masuelli; Anatoliy I Masyuk; Tetyana V Masyuk; Paola Matarrese; Ander Matheu; Satoaki Matoba; Sachiko Matsuzaki; Pamela Mattar; Alessandro Matte; Domenico Mattoscio; José L Mauriz; Mario Mauthe; Caroline Mauvezin; Emanual Maverakis; Paola Maycotte; Johanna Mayer; Gianluigi Mazzoccoli; Cristina Mazzoni; Joseph R Mazzulli; Nami McCarty; Christine McDonald; Mitchell R McGill; Sharon L McKenna; BethAnn McLaughlin; Fionn McLoughlin; Mark A McNiven; Thomas G McWilliams; Fatima Mechta-Grigoriou; Tania Catarina Medeiros; Diego L Medina; Lynn A Megeney; Klara Megyeri; Maryam Mehrpour; Jawahar L Mehta; Alfred J Meijer; Annemarie H Meijer; Jakob Mejlvang; Alicia Meléndez; Annette Melk; Gonen Memisoglu; Alexandrina F Mendes; Delong Meng; Fei Meng; Tian Meng; Rubem Menna-Barreto; Manoj B Menon; Carol Mercer; Anne E Mercier; Jean-Louis Mergny; Adalberto Merighi; Seth D Merkley; Giuseppe Merla; Volker Meske; Ana Cecilia Mestre; Shree Padma Metur; Christian Meyer; Hemmo Meyer; Wenyi Mi; Jeanne Mialet-Perez; Junying Miao; Lucia Micale; Yasuo Miki; Enrico Milan; Małgorzata Milczarek; Dana L Miller; Samuel I Miller; Silke Miller; Steven W Millward; Ira Milosevic; Elena A Minina; Hamed Mirzaei; Hamid Reza Mirzaei; Mehdi Mirzaei; Amit Mishra; Nandita Mishra; Paras Kumar Mishra; Maja Misirkic Marjanovic; Roberta Misasi; Amit Misra; Gabriella Misso; Claire Mitchell; Geraldine Mitou; Tetsuji Miura; Shigeki Miyamoto; Makoto Miyazaki; Mitsunori Miyazaki; Taiga Miyazaki; Keisuke Miyazawa; Noboru Mizushima; Trine H Mogensen; Baharia Mograbi; Reza Mohammadinejad; Yasir Mohamud; Abhishek Mohanty; Sipra Mohapatra; Torsten Möhlmann; Asif Mohmmed; Anna Moles; Kelle H Moley; Maurizio Molinari; Vincenzo Mollace; Andreas Buch Møller; Bertrand Mollereau; Faustino Mollinedo; Costanza Montagna; Mervyn J Monteiro; Andrea Montella; L Ruth Montes; Barbara Montico; Vinod K Mony; Giacomo Monzio Compagnoni; Michael N Moore; Mohammad A Moosavi; Ana L Mora; Marina Mora; David Morales-Alamo; Rosario Moratalla; Paula I Moreira; Elena Morelli; Sandra Moreno; Daniel Moreno-Blas; Viviana Moresi; Benjamin Morga; Alwena H Morgan; Fabrice Morin; Hideaki Morishita; Orson L Moritz; Mariko Moriyama; Yuji Moriyasu; Manuela Morleo; Eugenia Morselli; Jose F Moruno-Manchon; Jorge Moscat; Serge Mostowy; Elisa Motori; Andrea Felinto Moura; Naima Moustaid-Moussa; Maria Mrakovcic; Gabriel Muciño-Hernández; Anupam Mukherjee; Subhadip Mukhopadhyay; Jean M Mulcahy Levy; Victoriano Mulero; Sylviane Muller; Christian Münch; Ashok Munjal; Pura Munoz-Canoves; Teresa Muñoz-Galdeano; Christian Münz; Tomokazu Murakawa; Claudia Muratori; Brona M Murphy; J Patrick Murphy; Aditya Murthy; Timo T Myöhänen; Indira U Mysorekar; Jennifer Mytych; Seyed Mohammad Nabavi; Massimo Nabissi; Péter Nagy; Jihoon Nah; Aimable Nahimana; Ichiro Nakagawa; Ken Nakamura; Hitoshi Nakatogawa; Shyam S Nandi; Meera Nanjundan; Monica Nanni; Gennaro Napolitano; Roberta Nardacci; Masashi Narita; Melissa Nassif; Ilana Nathan; Manabu Natsumeda; Ryno J Naude; Christin Naumann; Olaia Naveiras; Fatemeh Navid; Steffan T Nawrocki; Taras Y Nazarko; Francesca Nazio; Florentina Negoita; Thomas Neill; Amanda L Neisch; Luca M Neri; Mihai G Netea; Patrick Neubert; Thomas P Neufeld; Dietbert Neumann; Albert Neutzner; Phillip T Newton; Paul A Ney; Ioannis P Nezis; Charlene C W Ng; Tzi Bun Ng; Hang T T Nguyen; Long T Nguyen; Hong-Min Ni; Clíona Ní Cheallaigh; Zhenhong Ni; M Celeste Nicolao; Francesco Nicoli; Manuel Nieto-Diaz; Per Nilsson; Shunbin Ning; Rituraj Niranjan; Hiroshi Nishimune; Mireia Niso-Santano; Ralph A Nixon; Annalisa Nobili; Clevio Nobrega; Takeshi Noda; Uxía Nogueira-Recalde; Trevor M Nolan; Ivan Nombela; Ivana Novak; Beatriz Novoa; Takashi Nozawa; Nobuyuki Nukina; Carmen Nussbaum-Krammer; Jesper Nylandsted; Tracey R O'Donovan; Seónadh M O'Leary; Eyleen J O'Rourke; Mary P O'Sullivan; Timothy E O'Sullivan; Salvatore Oddo; Ina Oehme; Michinaga Ogawa; Eric Ogier-Denis; Margret H Ogmundsdottir; Besim Ogretmen; Goo Taeg Oh; Seon-Hee Oh; Young J Oh; Takashi Ohama; Yohei Ohashi; Masaki Ohmuraya; Vasileios Oikonomou; Rani Ojha; Koji Okamoto; Hitoshi Okazawa; Masahide Oku; Sara Oliván; Jorge M A Oliveira; Michael Ollmann; James A Olzmann; Shakib Omari; M Bishr Omary; Gizem Önal; Martin Ondrej; Sang-Bing Ong; Sang-Ging Ong; Anna Onnis; Juan A Orellana; Sara Orellana-Muñoz; Maria Del Mar Ortega-Villaizan; Xilma R Ortiz-Gonzalez; Elena Ortona; Heinz D Osiewacz; Abdel-Hamid K Osman; Rosario Osta; Marisa S Otegui; Kinya Otsu; Christiane Ott; Luisa Ottobrini; Jing-Hsiung James Ou; Tiago F Outeiro; Inger Oynebraten; Melek Ozturk; Gilles Pagès; Susanta Pahari; Marta Pajares; Utpal B Pajvani; Rituraj Pal; Simona Paladino; Nicolas Pallet; Michela Palmieri; Giuseppe Palmisano; Camilla Palumbo; Francesco Pampaloni; Lifeng Pan; Qingjun Pan; Wenliang Pan; Xin Pan; Ganna Panasyuk; Rahul Pandey; Udai B Pandey; Vrajesh Pandya; Francesco Paneni; Shirley Y Pang; Elisa Panzarini; Daniela L Papademetrio; Elena Papaleo; Daniel Papinski; Diana Papp; Eun Chan Park; Hwan Tae Park; Ji-Man Park; Jong-In Park; Joon Tae Park; Junsoo Park; Sang Chul Park; Sang-Youel Park; Abraham H Parola; Jan B Parys; Adrien Pasquier; Benoit Pasquier; João F Passos; Nunzia Pastore; Hemal H Patel; Daniel Patschan; Sophie Pattingre; Gustavo Pedraza-Alva; Jose Pedraza-Chaverri; Zully Pedrozo; Gang Pei; Jianming Pei; Hadas Peled-Zehavi; Joaquín M Pellegrini; Joffrey Pelletier; Miguel A Peñalva; Di Peng; Ying Peng; Fabio Penna; Maria Pennuto; Francesca Pentimalli; Cláudia Mf Pereira; Gustavo J S Pereira; Lilian C Pereira; Luis Pereira de Almeida; Nirma D Perera; Ángel Pérez-Lara; Ana B Perez-Oliva; María Esther Pérez-Pérez; Palsamy Periyasamy; Andras Perl; Cristiana Perrotta; Ida Perrotta; Richard G Pestell; Morten Petersen; Irina Petrache; Goran Petrovski; Thorsten Pfirrmann; Astrid S Pfister; Jennifer A Philips; Huifeng Pi; Anna Picca; Alicia M Pickrell; Sandy Picot; Giovanna M Pierantoni; Marina Pierdominici; Philippe Pierre; Valérie Pierrefite-Carle; Karolina Pierzynowska; Federico Pietrocola; Miroslawa Pietruczuk; Claudio Pignata; Felipe X Pimentel-Muiños; Mario Pinar; Roberta O Pinheiro; Ronit Pinkas-Kramarski; Paolo Pinton; Karolina Pircs; Sujan Piya; Paola Pizzo; Theo S Plantinga; Harald W Platta; Ainhoa Plaza-Zabala; Markus Plomann; Egor Y Plotnikov; Helene Plun-Favreau; Ryszard Pluta; Roger Pocock; Stefanie Pöggeler; Christian Pohl; Marc Poirot; Angelo Poletti; Marisa Ponpuak; Hana Popelka; Blagovesta Popova; Helena Porta; Soledad Porte Alcon; Eliana Portilla-Fernandez; Martin Post; Malia B Potts; Joanna Poulton; Ted Powers; Veena Prahlad; Tomasz K Prajsnar; Domenico Praticò; Rosaria Prencipe; Muriel Priault; Tassula Proikas-Cezanne; Vasilis J Promponas; Christopher G Proud; Rosa Puertollano; Luigi Puglielli; Thomas Pulinilkunnil; Deepika Puri; Rajat Puri; Julien Puyal; Xiaopeng Qi; Yongmei Qi; Wenbin Qian; Lei Qiang; Yu Qiu; Joe Quadrilatero; Jorge Quarleri; Nina Raben; Hannah Rabinowich; Debora Ragona; Michael J Ragusa; Nader Rahimi; Marveh Rahmati; Valeria Raia; Nuno Raimundo; Namakkal-Soorappan Rajasekaran; Sriganesh Ramachandra Rao; Abdelhaq Rami; Ignacio Ramírez-Pardo; David B Ramsden; Felix Randow; Pundi N Rangarajan; Danilo Ranieri; Hai Rao; Lang Rao; Rekha Rao; Sumit Rathore; J Arjuna Ratnayaka; Edward A Ratovitski; Palaniyandi Ravanan; Gloria Ravegnini; Swapan K Ray; Babak Razani; Vito Rebecca; Fulvio Reggiori; Anne Régnier-Vigouroux; Andreas S Reichert; David Reigada; Jan H Reiling; Theo Rein; Siegfried Reipert; Rokeya Sultana Rekha; Hongmei Ren; Jun Ren; Weichao Ren; Tristan Renault; Giorgia Renga; Karen Reue; Kim Rewitz; Bruna Ribeiro de Andrade Ramos; S Amer Riazuddin; Teresa M Ribeiro-Rodrigues; Jean-Ehrland Ricci; Romeo Ricci; Victoria Riccio; Des R Richardson; Yasuko Rikihisa; Makarand V Risbud; Ruth M Risueño; Konstantinos Ritis; Salvatore Rizza; Rosario Rizzuto; Helen C Roberts; Luke D Roberts; Katherine J Robinson; Maria Carmela Roccheri; Stephane Rocchi; George G Rodney; Tiago Rodrigues; Vagner Ramon Rodrigues Silva; Amaia Rodriguez; Ruth Rodriguez-Barrueco; Nieves Rodriguez-Henche; Humberto Rodriguez-Rocha; Jeroen Roelofs; Robert S Rogers; Vladimir V Rogov; Ana I Rojo; Krzysztof Rolka; Vanina Romanello; Luigina Romani; Alessandra Romano; Patricia S Romano; David Romeo-Guitart; Luis C Romero; Montserrat Romero; Joseph C Roney; Christopher Rongo; Sante Roperto; Mathias T Rosenfeldt; Philip Rosenstiel; Anne G Rosenwald; Kevin A Roth; Lynn Roth; Steven Roth; Kasper M A Rouschop; Benoit D Roussel; Sophie Roux; Patrizia Rovere-Querini; Ajit Roy; Aurore Rozieres; Diego Ruano; David C Rubinsztein; Maria P Rubtsova; Klaus Ruckdeschel; Christoph Ruckenstuhl; Emil Rudolf; Rüdiger Rudolf; Alessandra Ruggieri; Avnika Ashok Ruparelia; Paola Rusmini; Ryan R Russell; Gian Luigi Russo; Maria Russo; Rossella Russo; Oxana O Ryabaya; Kevin M Ryan; Kwon-Yul Ryu; Maria Sabater-Arcis; Ulka Sachdev; Michael Sacher; Carsten Sachse; Abhishek Sadhu; Junichi Sadoshima; Nathaniel Safren; Paul Saftig; Antonia P Sagona; Gaurav Sahay; Amirhossein Sahebkar; Mustafa Sahin; Ozgur Sahin; Sumit Sahni; Nayuta Saito; Shigeru Saito; Tsunenori Saito; Ryohei Sakai; Yasuyoshi Sakai; Jun-Ichi Sakamaki; Kalle Saksela; Gloria Salazar; Anna Salazar-Degracia; Ghasem H Salekdeh; Ashok K Saluja; Belém Sampaio-Marques; Maria Cecilia Sanchez; Jose A Sanchez-Alcazar; Victoria Sanchez-Vera; Vanessa Sancho-Shimizu; J Thomas Sanderson; Marco Sandri; Stefano Santaguida; Laura Santambrogio; Magda M Santana; Giorgio Santoni; Alberto Sanz; Pascual Sanz; Shweta Saran; Marco Sardiello; Timothy J Sargeant; Apurva Sarin; Chinmoy Sarkar; Sovan Sarkar; Maria-Rosa Sarrias; Surajit Sarkar; Dipanka Tanu Sarmah; Jaakko Sarparanta; Aishwarya Sathyanarayan; Ranganayaki Sathyanarayanan; K Matthew Scaglione; Francesca Scatozza; Liliana Schaefer; Zachary T Schafer; Ulrich E Schaible; Anthony H V Schapira; Michael Scharl; Hermann M Schatzl; Catherine H Schein; Wiep Scheper; David Scheuring; Maria Vittoria Schiaffino; Monica Schiappacassi; Rainer Schindl; Uwe Schlattner; Oliver Schmidt; Roland Schmitt; Stephen D Schmidt; Ingo Schmitz; Eran Schmukler; Anja Schneider; Bianca E Schneider; Romana Schober; Alejandra C Schoijet; Micah B Schott; Michael Schramm; Bernd Schröder; Kai Schuh; Christoph Schüller; Ryan J Schulze; Lea Schürmanns; Jens C Schwamborn; Melanie Schwarten; Filippo Scialo; Sebastiano Sciarretta; Melanie J Scott; Kathleen W Scotto; A Ivana Scovassi; Andrea Scrima; Aurora Scrivo; David Sebastian; Salwa Sebti; Simon Sedej; Laura Segatori; Nava Segev; Per O Seglen; Iban Seiliez; Ekihiro Seki; Scott B Selleck; Frank W Sellke; Joshua T Selsby; Michael Sendtner; Serif Senturk; Elena Seranova; Consolato Sergi; Ruth Serra-Moreno; Hiromi Sesaki; Carmine Settembre; Subba Rao Gangi Setty; Gianluca Sgarbi; Ou Sha; John J Shacka; Javeed A Shah; Dantong Shang; Changshun Shao; Feng Shao; Soroush Sharbati; Lisa M Sharkey; Dipali Sharma; Gaurav Sharma; Kulbhushan Sharma; Pawan Sharma; Surendra Sharma; Han-Ming Shen; Hongtao Shen; Jiangang Shen; Ming Shen; Weili Shen; Zheni Shen; Rui Sheng; Zhi Sheng; Zu-Hang Sheng; Jianjian Shi; Xiaobing Shi; Ying-Hong Shi; Kahori Shiba-Fukushima; Jeng-Jer Shieh; Yohta Shimada; Shigeomi Shimizu; Makoto Shimozawa; Takahiro Shintani; Christopher J Shoemaker; Shahla Shojaei; Ikuo Shoji; Bhupendra V Shravage; Viji Shridhar; Chih-Wen Shu; Hong-Bing Shu; Ke Shui; Arvind K Shukla; Timothy E Shutt; Valentina Sica; Aleem Siddiqui; Amanda Sierra; Virginia Sierra-Torre; Santiago Signorelli; Payel Sil; Bruno J de Andrade Silva; Johnatas D Silva; Eduardo Silva-Pavez; Sandrine Silvente-Poirot; Rachel E Simmonds; Anna Katharina Simon; Hans-Uwe Simon; Matias Simons; Anurag Singh; Lalit P Singh; Rajat Singh; Shivendra V Singh; Shrawan K Singh; Sudha B Singh; Sunaina Singh; Surinder Pal Singh; Debasish Sinha; Rohit Anthony Sinha; Sangita Sinha; Agnieszka Sirko; Kapil Sirohi; Efthimios L Sivridis; Panagiotis Skendros; Aleksandra Skirycz; Iva Slaninová; Soraya S Smaili; Andrei Smertenko; Matthew D Smith; Stefaan J Soenen; Eun Jung Sohn; Sophia P M Sok; Giancarlo Solaini; Thierry Soldati; Scott A Soleimanpour; Rosa M Soler; Alexei Solovchenko; Jason A Somarelli; Avinash Sonawane; Fuyong Song; Hyun Kyu Song; Ju-Xian Song; Kunhua Song; Zhiyin Song; Leandro R Soria; Maurizio Sorice; Alexander A Soukas; Sandra-Fausia Soukup; Diana Sousa; Nadia Sousa; Paul A Spagnuolo; Stephen A Spector; M M Srinivas Bharath; Daret St Clair; Venturina Stagni; Leopoldo Staiano; Clint A Stalnecker; Metodi V Stankov; Peter B Stathopulos; Katja Stefan; Sven Marcel Stefan; Leonidas Stefanis; Joan S Steffan; Alexander Steinkasserer; Harald Stenmark; Jared Sterneckert; Craig Stevens; Veronika Stoka; Stephan Storch; Björn Stork; Flavie Strappazzon; Anne Marie Strohecker; Dwayne G Stupack; Huanxing Su; Ling-Yan Su; Longxiang Su; Ana M Suarez-Fontes; Carlos S Subauste; Selvakumar Subbian; Paula V Subirada; Ganapasam Sudhandiran; Carolyn M Sue; Xinbing Sui; Corey Summers; Guangchao Sun; Jun Sun; Kang Sun; Meng-Xiang Sun; Qiming Sun; Yi Sun; Zhongjie Sun; Karen K S Sunahara; Eva Sundberg; Katalin Susztak; Peter Sutovsky; Hidekazu Suzuki; Gary Sweeney; J David Symons; Stephen Cho Wing Sze; Nathaniel J Szewczyk; Anna Tabęcka-Łonczynska; Claudio Tabolacci; Frank Tacke; Heinrich Taegtmeyer; Marco Tafani; Mitsuo Tagaya; Haoran Tai; Stephen W G Tait; Yoshinori Takahashi; Szabolcs Takats; Priti Talwar; Chit Tam; Shing Yau Tam; Davide Tampellini; Atsushi Tamura; Chong Teik Tan; Eng-King Tan; Ya-Qin Tan; Masaki Tanaka; Motomasa Tanaka; Daolin Tang; Jingfeng Tang; Tie-Shan Tang; Isei Tanida; Zhipeng Tao; Mohammed Taouis; Lars Tatenhorst; Nektarios Tavernarakis; Allen Taylor; Gregory A Taylor; Joan M Taylor; Elena Tchetina; Andrew R Tee; Irmgard Tegeder; David Teis; Natercia Teixeira; Fatima Teixeira-Clerc; Kumsal A Tekirdag; Tewin Tencomnao; Sandra Tenreiro; Alexei V Tepikin; Pilar S Testillano; Gianluca Tettamanti; Pierre-Louis Tharaux; Kathrin Thedieck; Arvind A Thekkinghat; Stefano Thellung; Josephine W Thinwa; V P Thirumalaikumar; Sufi Mary Thomas; Paul G Thomes; Andrew Thorburn; Lipi Thukral; Thomas Thum; Michael Thumm; Ling Tian; Ales Tichy; Andreas Till; Vincent Timmerman; Vladimir I Titorenko; Sokol V Todi; Krassimira Todorova; Janne M Toivonen; Luana Tomaipitinca; Dhanendra Tomar; Cristina Tomas-Zapico; Sergej Tomić; Benjamin Chun-Kit Tong; Chao Tong; Xin Tong; Sharon A Tooze; Maria L Torgersen; Satoru Torii; Liliana Torres-López; Alicia Torriglia; Christina G Towers; Roberto Towns; Shinya Toyokuni; Vladimir Trajkovic; Donatella Tramontano; Quynh-Giao Tran; Leonardo H Travassos; Charles B Trelford; Shirley Tremel; Ioannis P Trougakos; Betty P Tsao; Mario P Tschan; Hung-Fat Tse; Tak Fu Tse; Hitoshi Tsugawa; Andrey S Tsvetkov; David A Tumbarello; Yasin Tumtas; María J Tuñón; Sandra Turcotte; Boris Turk; Vito Turk; Bradley J Turner; Richard I Tuxworth; Jessica K Tyler; Elena V Tyutereva; Yasuo Uchiyama; Aslihan Ugun-Klusek; Holm H Uhlig; Marzena Ułamek-Kozioł; Ilya V Ulasov; Midori Umekawa; Christian Ungermann; Rei Unno; Sylvie Urbe; Elisabet Uribe-Carretero; Suayib Üstün; Vladimir N Uversky; Thomas Vaccari; Maria I Vaccaro; Björn F Vahsen; Helin Vakifahmetoglu-Norberg; Rut Valdor; Maria J Valente; Ayelén Valko; Richard B Vallee; Angela M Valverde; Greet Van den Berghe; Stijn van der Veen; Luc Van Kaer; Jorg van Loosdregt; Sjoerd J L van Wijk; Wim Vandenberghe; Ilse Vanhorebeek; Marcos A Vannier-Santos; Nicola Vannini; M Cristina Vanrell; Chiara Vantaggiato; Gabriele Varano; Isabel Varela-Nieto; Máté Varga; M Helena Vasconcelos; Somya Vats; Demetrios G Vavvas; Ignacio Vega-Naredo; Silvia Vega-Rubin-de-Celis; Guillermo Velasco; Ariadna P Velázquez; Tibor Vellai; Edo Vellenga; Francesca Velotti; Mireille Verdier; Panayotis Verginis; Isabelle Vergne; Paul Verkade; Manish Verma; Patrik Verstreken; Tim Vervliet; Jörg Vervoorts; Alexandre T Vessoni; Victor M Victor; Michel Vidal; Chiara Vidoni; Otilia V Vieira; Richard D Vierstra; Sonia Viganó; Helena Vihinen; Vinoy Vijayan; Miquel Vila; Marçal Vilar; José M Villalba; Antonio Villalobo; Beatriz Villarejo-Zori; Francesc Villarroya; Joan Villarroya; Olivier Vincent; Cecile Vindis; Christophe Viret; Maria Teresa Viscomi; Dora Visnjic; Ilio Vitale; David J Vocadlo; Olga V Voitsekhovskaja; Cinzia Volonté; Mattia Volta; Marta Vomero; Clarissa Von Haefen; Marc A Vooijs; Wolfgang Voos; Ljubica Vucicevic; Richard Wade-Martins; Satoshi Waguri; Kenrick A Waite; Shuji Wakatsuki; David W Walker; Mark J Walker; Simon A Walker; Jochen Walter; Francisco G Wandosell; Bo Wang; Chao-Yung Wang; Chen Wang; Chenran Wang; Chenwei Wang; Cun-Yu Wang; Dong Wang; Fangyang Wang; Feng Wang; Fengming Wang; Guansong Wang; Han Wang; Hao Wang; Hexiang Wang; Hong-Gang Wang; Jianrong Wang; Jigang Wang; Jiou Wang; Jundong Wang; Kui Wang; Lianrong Wang; Liming Wang; Maggie Haitian Wang; Meiqing Wang; Nanbu Wang; Pengwei Wang; Peipei Wang; Ping Wang; Ping Wang; Qing Jun Wang; Qing Wang; Qing Kenneth Wang; Qiong A Wang; Wen-Tao Wang; Wuyang Wang; Xinnan Wang; Xuejun Wang; Yan Wang; Yanchang Wang; Yanzhuang Wang; Yen-Yun Wang; Yihua Wang; Yipeng Wang; Yu Wang; Yuqi Wang; Zhe Wang; Zhenyu Wang; Zhouguang Wang; Gary Warnes; Verena Warnsmann; Hirotaka Watada; Eizo Watanabe; Maxinne Watchon; Anna Wawrzyńska; Timothy E Weaver; Grzegorz Wegrzyn; Ann M Wehman; Huafeng Wei; Lei Wei; Taotao Wei; Yongjie Wei; Oliver H Weiergräber; Conrad C Weihl; Günther Weindl; Ralf Weiskirchen; Alan Wells; Runxia H Wen; Xin Wen; Antonia Werner; Beatrice Weykopf; Sally P Wheatley; J Lindsay Whitton; Alexander J Whitworth; Katarzyna Wiktorska; Manon E Wildenberg; Tom Wileman; Simon Wilkinson; Dieter Willbold; Brett Williams; Robin S B Williams; Roger L Williams; Peter R Williamson; Richard A Wilson; Beate Winner; Nathaniel J Winsor; Steven S Witkin; Harald Wodrich; Ute Woehlbier; Thomas Wollert; Esther Wong; Jack Ho Wong; Richard W Wong; Vincent Kam Wai Wong; W Wei-Lynn Wong; An-Guo Wu; Chengbiao Wu; Jian Wu; Junfang Wu; Kenneth K Wu; Min Wu; Shan-Ying Wu; Shengzhou Wu; Shu-Yan Wu; Shufang Wu; William K K Wu; Xiaohong Wu; Xiaoqing Wu; Yao-Wen Wu; Yihua Wu; Ramnik J Xavier; Hongguang Xia; Lixin Xia; Zhengyuan Xia; Ge Xiang; Jin Xiang; Mingliang Xiang; Wei Xiang; Bin Xiao; Guozhi Xiao; Hengyi Xiao; Hong-Tao Xiao; Jian Xiao; Lan Xiao; Shi Xiao; Yin Xiao; Baoming Xie; Chuan-Ming Xie; Min Xie; Yuxiang Xie; Zhiping Xie; Zhonglin Xie; Maria Xilouri; Congfeng Xu; En Xu; Haoxing Xu; Jing Xu; JinRong Xu; Liang Xu; Wen Wen Xu; Xiulong Xu; Yu Xue; Sokhna M S Yakhine-Diop; Masamitsu Yamaguchi; Osamu Yamaguchi; Ai Yamamoto; Shunhei Yamashina; Shengmin Yan; Shian-Jang Yan; Zhen Yan; Yasuo Yanagi; Chuanbin Yang; Dun-Sheng Yang; Huan Yang; Huang-Tian Yang; Hui Yang; Jin-Ming Yang; Jing Yang; Jingyu Yang; Ling Yang; Liu Yang; Ming Yang; Pei-Ming Yang; Qian Yang; Seungwon Yang; Shu Yang; Shun-Fa Yang; Wannian Yang; Wei Yuan Yang; Xiaoyong Yang; Xuesong Yang; Yi Yang; Ying Yang; Honghong Yao; Shenggen Yao; Xiaoqiang Yao; Yong-Gang Yao; Yong-Ming Yao; Takahiro Yasui; Meysam Yazdankhah; Paul M Yen; Cong Yi; Xiao-Ming Yin; Yanhai Yin; Zhangyuan Yin; Ziyi Yin; Meidan Ying; Zheng Ying; Calvin K Yip; Stephanie Pei Tung Yiu; Young H Yoo; Kiyotsugu Yoshida; Saori R Yoshii; Tamotsu Yoshimori; Bahman Yousefi; Boxuan Yu; Haiyang Yu; Jun Yu; Jun Yu; Li Yu; Ming-Lung Yu; Seong-Woon Yu; Victor C Yu; W Haung Yu; Zhengping Yu; Zhou Yu; Junying Yuan; Ling-Qing Yuan; Shilin Yuan; Shyng-Shiou F Yuan; Yanggang Yuan; Zengqiang Yuan; Jianbo Yue; Zhenyu Yue; Jeanho Yun; Raymond L Yung; David N Zacks; Gabriele Zaffagnini; Vanessa O Zambelli; Isabella Zanella; Qun S Zang; Sara Zanivan; Silvia Zappavigna; Pilar Zaragoza; Konstantinos S Zarbalis; Amir Zarebkohan; Amira Zarrouk; Scott O Zeitlin; Jialiu Zeng; Ju-Deng Zeng; Eva Žerovnik; Lixuan Zhan; Bin Zhang; Donna D Zhang; Hanlin Zhang; Hong Zhang; Hong Zhang; Honghe Zhang; Huafeng Zhang; Huaye Zhang; Hui Zhang; Hui-Ling Zhang; Jianbin Zhang; Jianhua Zhang; Jing-Pu Zhang; Kalin Y B Zhang; Leshuai W Zhang; Lin Zhang; Lisheng Zhang; Lu Zhang; Luoying Zhang; Menghuan Zhang; Peng Zhang; Sheng Zhang; Wei Zhang; Xiangnan Zhang; Xiao-Wei Zhang; Xiaolei Zhang; Xiaoyan Zhang; Xin Zhang; Xinxin Zhang; Xu Dong Zhang; Yang Zhang; Yanjin Zhang; Yi Zhang; Ying-Dong Zhang; Yingmei Zhang; Yuan-Yuan Zhang; Yuchen Zhang; Zhe Zhang; Zhengguang Zhang; Zhibing Zhang; Zhihai Zhang; Zhiyong Zhang; Zili Zhang; Haobin Zhao; Lei Zhao; Shuang Zhao; Tongbiao Zhao; Xiao-Fan Zhao; Ying Zhao; Yongchao Zhao; Yongliang Zhao; Yuting Zhao; Guoping Zheng; Kai Zheng; Ling Zheng; Shizhong Zheng; Xi-Long Zheng; Yi Zheng; Zu-Guo Zheng; Boris Zhivotovsky; Qing Zhong; Ao Zhou; Ben Zhou; Cefan Zhou; Gang Zhou; Hao Zhou; Hong Zhou; Hongbo Zhou; Jie Zhou; Jing Zhou; Jing Zhou; Jiyong Zhou; Kailiang Zhou; Rongjia Zhou; Xu-Jie Zhou; Yanshuang Zhou; Yinghong Zhou; Yubin Zhou; Zheng-Yu Zhou; Zhou Zhou; Binglin Zhu; Changlian Zhu; Guo-Qing Zhu; Haining Zhu; Hongxin Zhu; Hua Zhu; Wei-Guo Zhu; Yanping Zhu; Yushan Zhu; Haixia Zhuang; Xiaohong Zhuang; Katarzyna Zientara-Rytter; Christine M Zimmermann; Elena Ziviani; Teresa Zoladek; Wei-Xing Zong; Dmitry B Zorov; Antonio Zorzano; Weiping Zou; Zhen Zou; Zhengzhi Zou; Steven Zuryn; Werner Zwerschke; Beate Brand-Saberi; X Charlie Dong; Chandra Shekar Kenchappa; Zuguo Li; Yong Lin; Shigeru Oshima; Yueguang Rong; Judith C Sluimer; Christina L Stallings; Chun-Kit Tong Journal: Autophagy Date: 2021-02-08 Impact factor: 13.391
Authors: Daniel J Klionsky; Kotb Abdelmohsen; Akihisa Abe; Md Joynal Abedin; Hagai Abeliovich; Abraham Acevedo Arozena; Hiroaki Adachi; Christopher M Adams; Peter D Adams; Khosrow Adeli; Peter J Adhihetty; Sharon G Adler; Galila Agam; Rajesh Agarwal; Manish K Aghi; Maria Agnello; Patrizia Agostinis; Patricia V Aguilar; Julio Aguirre-Ghiso; Edoardo M Airoldi; Slimane Ait-Si-Ali; Takahiko Akematsu; Emmanuel T Akporiaye; Mohamed Al-Rubeai; Guillermo M Albaiceta; Chris Albanese; Diego Albani; Matthew L Albert; Jesus Aldudo; Hana Algül; Mehrdad Alirezaei; Iraide Alloza; Alexandru Almasan; Maylin Almonte-Beceril; Emad S Alnemri; Covadonga Alonso; Nihal Altan-Bonnet; Dario C Altieri; Silvia Alvarez; Lydia Alvarez-Erviti; Sandro Alves; Giuseppina Amadoro; Atsuo Amano; Consuelo Amantini; Santiago Ambrosio; Ivano Amelio; Amal O Amer; Mohamed Amessou; Angelika Amon; Zhenyi An; Frank A Anania; Stig U Andersen; Usha P Andley; Catherine K Andreadi; Nathalie Andrieu-Abadie; Alberto Anel; David K Ann; Shailendra Anoopkumar-Dukie; Manuela Antonioli; Hiroshi Aoki; Nadezda Apostolova; Saveria Aquila; Katia Aquilano; Koichi Araki; Eli Arama; Agustin Aranda; Jun Araya; Alexandre Arcaro; Esperanza Arias; Hirokazu Arimoto; Aileen R Ariosa; Jane L Armstrong; Thierry Arnould; Ivica Arsov; Katsuhiko Asanuma; Valerie Askanas; Eric Asselin; Ryuichiro Atarashi; Sally S Atherton; Julie D Atkin; Laura D Attardi; Patrick Auberger; Georg Auburger; Laure Aurelian; Riccardo Autelli; Laura Avagliano; Maria Laura Avantaggiati; Limor Avrahami; Suresh Awale; Neelam Azad; Tiziana Bachetti; Jonathan M Backer; Dong-Hun Bae; Jae-Sung Bae; Ok-Nam Bae; Soo Han Bae; Eric H Baehrecke; Seung-Hoon Baek; Stephen Baghdiguian; Agnieszka Bagniewska-Zadworna; Hua Bai; Jie Bai; Xue-Yuan Bai; Yannick Bailly; Kithiganahalli Narayanaswamy Balaji; Walter Balduini; Andrea Ballabio; Rena Balzan; Rajkumar Banerjee; Gábor Bánhegyi; Haijun Bao; Benoit Barbeau; Maria D Barrachina; Esther Barreiro; Bonnie Bartel; Alberto Bartolomé; Diane C Bassham; Maria Teresa Bassi; Robert C Bast; Alakananda Basu; Maria Teresa Batista; Henri Batoko; Maurizio Battino; Kyle Bauckman; Bradley L Baumgarner; K Ulrich Bayer; Rupert Beale; Jean-François Beaulieu; George R Beck; Christoph Becker; J David Beckham; Pierre-André Bédard; Patrick J Bednarski; Thomas J Begley; Christian Behl; Christian Behrends; Georg Mn Behrens; Kevin E Behrns; Eloy Bejarano; Amine Belaid; Francesca Belleudi; Giovanni Bénard; Guy Berchem; Daniele Bergamaschi; Matteo Bergami; Ben Berkhout; Laura Berliocchi; Amélie Bernard; Monique Bernard; Francesca Bernassola; Anne Bertolotti; Amanda S Bess; Sébastien Besteiro; Saverio Bettuzzi; Savita Bhalla; Shalmoli Bhattacharyya; Sujit K Bhutia; Caroline Biagosch; Michele Wolfe Bianchi; Martine Biard-Piechaczyk; Viktor Billes; Claudia Bincoletto; Baris Bingol; Sara W Bird; Marc Bitoun; Ivana Bjedov; Craig Blackstone; Lionel Blanc; Guillermo A Blanco; Heidi Kiil Blomhoff; Emilio Boada-Romero; Stefan Böckler; Marianne Boes; Kathleen Boesze-Battaglia; Lawrence H Boise; Alessandra Bolino; Andrea Boman; Paolo Bonaldo; Matteo Bordi; Jürgen Bosch; Luis M Botana; Joelle Botti; German Bou; Marina Bouché; Marion Bouchecareilh; Marie-Josée Boucher; Michael E Boulton; Sebastien G Bouret; Patricia Boya; Michaël Boyer-Guittaut; Peter V Bozhkov; Nathan Brady; Vania Mm Braga; Claudio Brancolini; Gerhard H Braus; José M Bravo-San Pedro; Lisa A Brennan; Emery H Bresnick; Patrick Brest; Dave Bridges; Marie-Agnès Bringer; Marisa Brini; Glauber C Brito; Bertha Brodin; Paul S Brookes; Eric J Brown; Karen Brown; Hal E Broxmeyer; Alain Bruhat; Patricia Chakur Brum; John H Brumell; Nicola Brunetti-Pierri; Robert J Bryson-Richardson; Shilpa Buch; Alastair M Buchan; Hikmet Budak; Dmitry V Bulavin; Scott J Bultman; Geert Bultynck; Vladimir Bumbasirevic; Yan Burelle; Robert E Burke; Margit Burmeister; Peter Bütikofer; Laura Caberlotto; Ken Cadwell; Monika Cahova; Dongsheng Cai; Jingjing Cai; Qian Cai; Sara Calatayud; Nadine Camougrand; Michelangelo Campanella; Grant R Campbell; Matthew Campbell; Silvia Campello; Robin Candau; Isabella Caniggia; Lavinia Cantoni; Lizhi Cao; Allan B Caplan; Michele Caraglia; Claudio Cardinali; Sandra Morais Cardoso; Jennifer S Carew; Laura A Carleton; Cathleen R Carlin; Silvia Carloni; Sven R Carlsson; Didac Carmona-Gutierrez; Leticia Am Carneiro; Oliana Carnevali; Serena Carra; Alice Carrier; Bernadette Carroll; Caty Casas; Josefina Casas; Giuliana Cassinelli; Perrine Castets; Susana Castro-Obregon; Gabriella Cavallini; Isabella Ceccherini; Francesco Cecconi; Arthur I Cederbaum; Valentín Ceña; Simone Cenci; Claudia Cerella; Davide Cervia; Silvia Cetrullo; Hassan Chaachouay; Han-Jung Chae; Andrei S Chagin; Chee-Yin Chai; Gopal Chakrabarti; Georgios Chamilos; Edmond Yw Chan; Matthew Tv Chan; Dhyan Chandra; Pallavi Chandra; Chih-Peng Chang; Raymond Chuen-Chung Chang; Ta Yuan Chang; John C Chatham; Saurabh Chatterjee; Santosh Chauhan; Yongsheng Che; Michael E Cheetham; Rajkumar Cheluvappa; Chun-Jung Chen; Gang Chen; Guang-Chao Chen; Guoqiang Chen; Hongzhuan Chen; Jeff W Chen; Jian-Kang Chen; Min Chen; Mingzhou Chen; Peiwen Chen; Qi Chen; Quan Chen; Shang-Der Chen; Si Chen; Steve S-L Chen; Wei Chen; Wei-Jung Chen; Wen Qiang Chen; Wenli Chen; Xiangmei Chen; Yau-Hung Chen; Ye-Guang Chen; Yin Chen; Yingyu Chen; Yongshun Chen; Yu-Jen Chen; Yue-Qin Chen; Yujie Chen; Zhen Chen; Zhong Chen; Alan Cheng; Christopher Hk Cheng; Hua Cheng; Heesun Cheong; Sara Cherry; Jason Chesney; Chun Hei Antonio Cheung; Eric Chevet; Hsiang Cheng Chi; Sung-Gil Chi; Fulvio Chiacchiera; Hui-Ling Chiang; Roberto Chiarelli; Mario Chiariello; Marcello Chieppa; Lih-Shen Chin; Mario Chiong; Gigi Nc Chiu; Dong-Hyung Cho; Ssang-Goo Cho; William C Cho; Yong-Yeon Cho; Young-Seok Cho; Augustine Mk Choi; Eui-Ju Choi; Eun-Kyoung Choi; Jayoung Choi; Mary E Choi; Seung-Il Choi; Tsui-Fen Chou; Salem Chouaib; Divaker Choubey; Vinay Choubey; Kuan-Chih Chow; Kamal Chowdhury; Charleen T Chu; Tsung-Hsien Chuang; Taehoon Chun; Hyewon Chung; Taijoon Chung; Yuen-Li Chung; Yong-Joon Chwae; Valentina Cianfanelli; Roberto Ciarcia; Iwona A Ciechomska; Maria Rosa Ciriolo; Mara Cirone; Sofie Claerhout; Michael J Clague; Joan Clària; Peter Gh Clarke; Robert Clarke; Emilio Clementi; Cédric Cleyrat; Miriam Cnop; Eliana M Coccia; Tiziana Cocco; Patrice Codogno; Jörn Coers; Ezra Ew Cohen; David Colecchia; Luisa Coletto; Núria S Coll; Emma Colucci-Guyon; Sergio Comincini; Maria Condello; Katherine L Cook; Graham H Coombs; Cynthia D Cooper; J Mark Cooper; Isabelle Coppens; Maria Tiziana Corasaniti; Marco Corazzari; Ramon Corbalan; Elisabeth Corcelle-Termeau; Mario D Cordero; Cristina Corral-Ramos; Olga Corti; Andrea Cossarizza; Paola Costelli; Safia Costes; Susan L Cotman; Ana Coto-Montes; Sandra Cottet; Eduardo Couve; Lori R Covey; L Ashley Cowart; Jeffery S Cox; Fraser P Coxon; Carolyn B Coyne; Mark S Cragg; Rolf J Craven; Tiziana Crepaldi; Jose L Crespo; Alfredo Criollo; Valeria Crippa; Maria Teresa Cruz; Ana Maria Cuervo; Jose M Cuezva; Taixing Cui; Pedro R Cutillas; Mark J Czaja; Maria F Czyzyk-Krzeska; Ruben K Dagda; Uta Dahmen; Chunsun Dai; Wenjie Dai; Yun Dai; Kevin N Dalby; Luisa Dalla Valle; Guillaume Dalmasso; Marcello D'Amelio; Markus Damme; Arlette Darfeuille-Michaud; Catherine Dargemont; Victor M Darley-Usmar; Srinivasan Dasarathy; Biplab Dasgupta; Srikanta Dash; Crispin R Dass; Hazel Marie Davey; Lester M Davids; David Dávila; Roger J Davis; Ted M Dawson; Valina L Dawson; Paula Daza; Jackie de Belleroche; Paul de Figueiredo; Regina Celia Bressan Queiroz de Figueiredo; José de la Fuente; Luisa De Martino; Antonella De Matteis; Guido Ry De Meyer; Angelo De Milito; Mauro De Santi; Wanderley de Souza; Vincenzo De Tata; Daniela De Zio; Jayanta Debnath; Reinhard Dechant; Jean-Paul Decuypere; Shane Deegan; Benjamin Dehay; Barbara Del Bello; Dominic P Del Re; Régis Delage-Mourroux; Lea Md Delbridge; Louise Deldicque; Elizabeth Delorme-Axford; Yizhen Deng; Joern Dengjel; Melanie Denizot; Paul Dent; Channing J Der; Vojo Deretic; Benoît Derrien; Eric Deutsch; Timothy P Devarenne; Rodney J Devenish; Sabrina Di Bartolomeo; Nicola Di Daniele; Fabio Di Domenico; Alessia Di Nardo; Simone Di Paola; Antonio Di Pietro; Livia Di Renzo; Aaron DiAntonio; Guillermo Díaz-Araya; Ines Díaz-Laviada; Maria T Diaz-Meco; Javier Diaz-Nido; Chad A Dickey; Robert C Dickson; Marc Diederich; Paul Digard; Ivan Dikic; Savithrama P Dinesh-Kumar; Chan Ding; Wen-Xing Ding; Zufeng Ding; Luciana Dini; Jörg Hw Distler; Abhinav Diwan; Mojgan Djavaheri-Mergny; Kostyantyn Dmytruk; Renwick Cj Dobson; Volker Doetsch; Karol Dokladny; Svetlana Dokudovskaya; Massimo Donadelli; X Charlie Dong; Xiaonan Dong; Zheng Dong; Terrence M Donohue; Kelly S Doran; Gabriella D'Orazi; Gerald W Dorn; Victor Dosenko; Sami Dridi; Liat Drucker; Jie Du; Li-Lin Du; Lihuan Du; André du Toit; Priyamvada Dua; Lei Duan; Pu Duann; Vikash Kumar Dubey; Michael R Duchen; Michel A Duchosal; Helene Duez; Isabelle Dugail; Verónica I Dumit; Mara C Duncan; Elaine A Dunlop; William A Dunn; Nicolas Dupont; Luc Dupuis; Raúl V Durán; Thomas M Durcan; Stéphane Duvezin-Caubet; Umamaheswar Duvvuri; Vinay Eapen; Darius Ebrahimi-Fakhari; Arnaud Echard; Leopold Eckhart; Charles L Edelstein; Aimee L Edinger; Ludwig Eichinger; Tobias Eisenberg; Avital Eisenberg-Lerner; N Tony Eissa; Wafik S El-Deiry; Victoria El-Khoury; Zvulun Elazar; Hagit Eldar-Finkelman; Chris Jh Elliott; Enzo Emanuele; Urban Emmenegger; Nikolai Engedal; Anna-Mart Engelbrecht; Simone Engelender; Jorrit M Enserink; Ralf Erdmann; Jekaterina Erenpreisa; Rajaraman Eri; Jason L Eriksen; Andreja Erman; Ricardo Escalante; Eeva-Liisa Eskelinen; Lucile Espert; Lorena Esteban-Martínez; Thomas J Evans; Mario Fabri; Gemma Fabrias; Cinzia Fabrizi; Antonio Facchiano; Nils J Færgeman; Alberto Faggioni; W Douglas Fairlie; Chunhai Fan; Daping Fan; Jie Fan; Shengyun Fang; Manolis Fanto; Alessandro Fanzani; Thomas Farkas; Mathias Faure; Francois B Favier; Howard Fearnhead; Massimo Federici; Erkang Fei; Tania C Felizardo; Hua Feng; Yibin Feng; Yuchen Feng; Thomas A Ferguson; Álvaro F Fernández; Maite G Fernandez-Barrena; Jose C Fernandez-Checa; Arsenio Fernández-López; Martin E Fernandez-Zapico; Olivier Feron; Elisabetta Ferraro; Carmen Veríssima Ferreira-Halder; Laszlo Fesus; Ralph Feuer; Fabienne C Fiesel; Eduardo C Filippi-Chiela; Giuseppe Filomeni; Gian Maria Fimia; John H Fingert; Steven Finkbeiner; Toren Finkel; Filomena Fiorito; Paul B Fisher; Marc Flajolet; Flavio Flamigni; Oliver Florey; Salvatore Florio; R Andres Floto; Marco Folini; Carlo Follo; Edward A Fon; Francesco Fornai; Franco Fortunato; Alessandro Fraldi; Rodrigo Franco; Arnaud Francois; Aurélie François; Lisa B Frankel; Iain Dc Fraser; Norbert Frey; Damien G Freyssenet; Christian Frezza; Scott L Friedman; Daniel E Frigo; Dongxu Fu; José M Fuentes; Juan Fueyo; Yoshio Fujitani; Yuuki Fujiwara; Mikihiro Fujiya; Mitsunori Fukuda; Simone Fulda; Carmela Fusco; Bozena Gabryel; Matthias Gaestel; Philippe Gailly; Malgorzata Gajewska; Sehamuddin Galadari; Gad Galili; Inmaculada Galindo; Maria F Galindo; Giovanna Galliciotti; Lorenzo Galluzzi; Luca Galluzzi; Vincent Galy; Noor Gammoh; Sam Gandy; Anand K Ganesan; Swamynathan Ganesan; Ian G Ganley; Monique Gannagé; Fen-Biao Gao; Feng Gao; Jian-Xin Gao; Lorena García Nannig; Eleonora García Véscovi; Marina Garcia-Macía; Carmen Garcia-Ruiz; Abhishek D Garg; Pramod Kumar Garg; Ricardo Gargini; Nils Christian Gassen; Damián Gatica; Evelina Gatti; Julie Gavard; Evripidis Gavathiotis; Liang Ge; Pengfei Ge; Shengfang Ge; Po-Wu Gean; Vania Gelmetti; Armando A Genazzani; Jiefei Geng; Pascal Genschik; Lisa Gerner; Jason E Gestwicki; David A Gewirtz; Saeid Ghavami; Eric Ghigo; Debabrata Ghosh; Anna Maria Giammarioli; Francesca Giampieri; Claudia Giampietri; Alexandra Giatromanolaki; Derrick J Gibbings; Lara Gibellini; Spencer B Gibson; Vanessa Ginet; Antonio Giordano; Flaviano Giorgini; Elisa Giovannetti; Stephen E Girardin; Suzana Gispert; Sandy Giuliano; Candece L Gladson; Alvaro Glavic; Martin Gleave; Nelly Godefroy; Robert M Gogal; Kuppan Gokulan; Gustavo H Goldman; Delia Goletti; Michael S Goligorsky; Aldrin V Gomes; Ligia C Gomes; Hernando Gomez; Candelaria Gomez-Manzano; Rubén Gómez-Sánchez; Dawit Ap Gonçalves; Ebru Goncu; Qingqiu Gong; Céline Gongora; Carlos B Gonzalez; Pedro Gonzalez-Alegre; Pilar Gonzalez-Cabo; Rosa Ana González-Polo; Ing Swie Goping; Carlos Gorbea; Nikolai V Gorbunov; Daphne R Goring; Adrienne M Gorman; Sharon M Gorski; Sandro Goruppi; Shino Goto-Yamada; Cecilia Gotor; Roberta A Gottlieb; Illana Gozes; Devrim Gozuacik; Yacine Graba; Martin Graef; Giovanna E Granato; Gary Dean Grant; Steven Grant; Giovanni Luca Gravina; Douglas R Green; Alexander Greenhough; Michael T Greenwood; Benedetto Grimaldi; Frédéric Gros; Charles Grose; Jean-Francois Groulx; Florian Gruber; Paolo Grumati; Tilman Grune; Jun-Lin Guan; Kun-Liang Guan; Barbara Guerra; Carlos Guillen; Kailash Gulshan; Jan Gunst; Chuanyong Guo; Lei Guo; Ming Guo; Wenjie Guo; Xu-Guang Guo; Andrea A Gust; Åsa B Gustafsson; Elaine Gutierrez; Maximiliano G Gutierrez; Ho-Shin Gwak; Albert Haas; James E Haber; Shinji Hadano; Monica Hagedorn; David R Hahn; Andrew J Halayko; Anne Hamacher-Brady; Kozo Hamada; Ahmed Hamai; Andrea Hamann; Maho Hamasaki; Isabelle Hamer; Qutayba Hamid; Ester M Hammond; Feng Han; Weidong Han; James T Handa; John A Hanover; Malene Hansen; Masaru Harada; Ljubica Harhaji-Trajkovic; J Wade Harper; Abdel Halim Harrath; Adrian L Harris; James Harris; Udo Hasler; Peter Hasselblatt; Kazuhisa Hasui; Robert G Hawley; Teresa S Hawley; Congcong He; Cynthia Y He; Fengtian He; Gu He; Rong-Rong He; Xian-Hui He; You-Wen He; Yu-Ying He; Joan K Heath; Marie-Josée Hébert; Robert A Heinzen; Gudmundur Vignir Helgason; Michael Hensel; Elizabeth P Henske; Chengtao Her; Paul K Herman; Agustín Hernández; Carlos Hernandez; Sonia Hernández-Tiedra; Claudio Hetz; P Robin Hiesinger; Katsumi Higaki; Sabine Hilfiker; Bradford G Hill; Joseph A Hill; William D Hill; Keisuke Hino; Daniel Hofius; Paul Hofman; Günter U Höglinger; Jörg Höhfeld; Marina K Holz; Yonggeun Hong; David A Hood; Jeroen Jm Hoozemans; Thorsten Hoppe; Chin Hsu; Chin-Yuan Hsu; Li-Chung Hsu; Dong Hu; Guochang Hu; Hong-Ming Hu; Hongbo Hu; Ming Chang Hu; Yu-Chen Hu; Zhuo-Wei Hu; Fang Hua; Ya Hua; Canhua Huang; Huey-Lan Huang; Kuo-How Huang; Kuo-Yang Huang; Shile Huang; Shiqian Huang; Wei-Pang Huang; Yi-Ran Huang; Yong Huang; Yunfei Huang; Tobias B Huber; Patricia Huebbe; Won-Ki Huh; Juha J Hulmi; Gang Min Hur; James H Hurley; Zvenyslava Husak; Sabah Na Hussain; Salik Hussain; Jung Jin Hwang; Seungmin Hwang; Thomas Is Hwang; Atsuhiro Ichihara; Yuzuru Imai; Carol Imbriano; Megumi Inomata; Takeshi Into; Valentina Iovane; Juan L Iovanna; Renato V Iozzo; Nancy Y Ip; Javier E Irazoqui; Pablo Iribarren; Yoshitaka Isaka; Aleksandra J Isakovic; Harry Ischiropoulos; Jeffrey S Isenberg; Mohammad Ishaq; Hiroyuki Ishida; Isao Ishii; Jane E Ishmael; Ciro Isidoro; Ken-Ichi Isobe; Erika Isono; Shohreh Issazadeh-Navikas; Koji Itahana; Eisuke Itakura; Andrei I Ivanov; Anand Krishnan V Iyer; José M Izquierdo; Yotaro Izumi; Valentina Izzo; Marja Jäättelä; Nadia Jaber; Daniel John Jackson; William T Jackson; Tony George Jacob; Thomas S Jacques; Chinnaswamy Jagannath; Ashish Jain; Nihar Ranjan Jana; Byoung Kuk Jang; Alkesh Jani; Bassam Janji; Paulo Roberto Jannig; Patric J Jansson; Steve Jean; Marina Jendrach; Ju-Hong Jeon; Niels Jessen; Eui-Bae Jeung; Kailiang Jia; Lijun Jia; Hong Jiang; Hongchi Jiang; Liwen Jiang; Teng Jiang; Xiaoyan Jiang; Xuejun Jiang; Xuejun Jiang; Ying Jiang; Yongjun Jiang; Alberto Jiménez; Cheng Jin; Hongchuan Jin; Lei Jin; Meiyan Jin; Shengkan Jin; Umesh Kumar Jinwal; Eun-Kyeong Jo; Terje Johansen; Daniel E Johnson; Gail Vw Johnson; James D Johnson; Eric Jonasch; Chris Jones; Leo Ab Joosten; Joaquin Jordan; Anna-Maria Joseph; Bertrand Joseph; Annie M Joubert; Dianwen Ju; Jingfang Ju; Hsueh-Fen Juan; Katrin Juenemann; Gábor Juhász; Hye Seung Jung; Jae U Jung; Yong-Keun Jung; Heinz Jungbluth; Matthew J Justice; Barry Jutten; Nadeem O Kaakoush; Kai Kaarniranta; Allen Kaasik; Tomohiro Kabuta; Bertrand Kaeffer; Katarina Kågedal; Alon Kahana; Shingo Kajimura; Or Kakhlon; Manjula Kalia; Dhan V Kalvakolanu; Yoshiaki Kamada; Konstantinos Kambas; Vitaliy O Kaminskyy; Harm H Kampinga; Mustapha Kandouz; Chanhee Kang; Rui Kang; Tae-Cheon Kang; Tomotake Kanki; Thirumala-Devi Kanneganti; Haruo Kanno; Anumantha G Kanthasamy; Marc Kantorow; Maria Kaparakis-Liaskos; Orsolya Kapuy; Vassiliki Karantza; Md Razaul Karim; Parimal Karmakar; Arthur Kaser; Susmita Kaushik; Thomas Kawula; A Murat Kaynar; Po-Yuan Ke; Zun-Ji Ke; John H Kehrl; Kate E Keller; Jongsook Kim Kemper; Anne K Kenworthy; Oliver Kepp; Andreas Kern; Santosh Kesari; David Kessel; Robin Ketteler; Isis do Carmo Kettelhut; Bilon Khambu; Muzamil Majid Khan; Vinoth Km Khandelwal; Sangeeta Khare; Juliann G Kiang; Amy A Kiger; Akio Kihara; Arianna L Kim; Cheol Hyeon Kim; Deok Ryong Kim; Do-Hyung Kim; Eung Kweon Kim; Hye Young Kim; Hyung-Ryong Kim; Jae-Sung Kim; Jeong Hun Kim; Jin Cheon Kim; Jin Hyoung Kim; Kwang Woon Kim; Michael D Kim; Moon-Moo Kim; Peter K Kim; Seong Who Kim; Soo-Youl Kim; Yong-Sun Kim; Yonghyun Kim; Adi Kimchi; Alec C Kimmelman; Tomonori Kimura; Jason S King; Karla Kirkegaard; Vladimir Kirkin; Lorrie A Kirshenbaum; Shuji Kishi; Yasuo Kitajima; Katsuhiko Kitamoto; Yasushi Kitaoka; Kaio Kitazato; Rudolf A Kley; Walter T Klimecki; Michael Klinkenberg; Jochen Klucken; Helene Knævelsrud; Erwin Knecht; Laura Knuppertz; Jiunn-Liang Ko; Satoru Kobayashi; Jan C Koch; Christelle Koechlin-Ramonatxo; Ulrich Koenig; Young Ho Koh; Katja Köhler; Sepp D Kohlwein; Masato Koike; Masaaki Komatsu; Eiki Kominami; Dexin Kong; Hee Jeong Kong; Eumorphia G Konstantakou; Benjamin T Kopp; Tamas Korcsmaros; Laura Korhonen; Viktor I Korolchuk; Nadya V Koshkina; Yanjun Kou; Michael I Koukourakis; Constantinos Koumenis; Attila L Kovács; Tibor Kovács; Werner J Kovacs; Daisuke Koya; Claudine Kraft; Dimitri Krainc; Helmut Kramer; Tamara Kravic-Stevovic; Wilhelm Krek; Carole Kretz-Remy; Roswitha Krick; Malathi Krishnamurthy; Janos Kriston-Vizi; Guido Kroemer; Michael C Kruer; Rejko Kruger; Nicholas T Ktistakis; Kazuyuki Kuchitsu; Christian Kuhn; Addanki Pratap Kumar; Anuj Kumar; Ashok Kumar; Deepak Kumar; Dhiraj Kumar; Rakesh Kumar; Sharad Kumar; Mondira Kundu; Hsing-Jien Kung; Atsushi Kuno; Sheng-Han Kuo; Jeff Kuret; Tino Kurz; Terry Kwok; Taeg Kyu Kwon; Yong Tae Kwon; Irene Kyrmizi; Albert R La Spada; Frank Lafont; Tim Lahm; Aparna Lakkaraju; Truong Lam; Trond Lamark; Steve Lancel; Terry H Landowski; Darius J R Lane; Jon D Lane; Cinzia Lanzi; Pierre Lapaquette; Louis R Lapierre; Jocelyn Laporte; Johanna Laukkarinen; Gordon W Laurie; Sergio Lavandero; Lena Lavie; Matthew J LaVoie; Betty Yuen Kwan Law; Helen Ka-Wai Law; Kelsey B Law; Robert Layfield; Pedro A Lazo; Laurent Le Cam; Karine G Le Roch; Hervé Le Stunff; Vijittra Leardkamolkarn; Marc Lecuit; Byung-Hoon Lee; Che-Hsin Lee; Erinna F Lee; Gyun Min Lee; He-Jin Lee; Hsinyu Lee; Jae Keun Lee; Jongdae Lee; Ju-Hyun Lee; Jun Hee Lee; Michael Lee; Myung-Shik Lee; Patty J Lee; Sam W Lee; Seung-Jae Lee; Shiow-Ju Lee; Stella Y Lee; Sug Hyung Lee; Sung Sik Lee; Sung-Joon Lee; Sunhee Lee; Ying-Ray Lee; Yong J Lee; Young H Lee; Christiaan Leeuwenburgh; Sylvain Lefort; Renaud Legouis; Jinzhi Lei; Qun-Ying Lei; David A Leib; Gil Leibowitz; Istvan Lekli; Stéphane D Lemaire; John J Lemasters; Marius K Lemberg; Antoinette Lemoine; Shuilong Leng; Guido Lenz; Paola Lenzi; Lilach O Lerman; Daniele Lettieri Barbato; Julia I-Ju Leu; Hing Y Leung; Beth Levine; Patrick A Lewis; Frank Lezoualc'h; Chi Li; Faqiang Li; Feng-Jun Li; Jun Li; Ke Li; Lian Li; Min Li; Min Li; Qiang Li; Rui Li; Sheng Li; Wei Li; Wei Li; Xiaotao Li; Yumin Li; Jiqin Lian; Chengyu Liang; Qiangrong Liang; Yulin Liao; Joana Liberal; Pawel P Liberski; Pearl Lie; Andrew P Lieberman; Hyunjung Jade Lim; Kah-Leong Lim; Kyu Lim; Raquel T Lima; Chang-Shen Lin; Chiou-Feng Lin; Fang Lin; Fangming Lin; Fu-Cheng Lin; Kui Lin; Kwang-Huei Lin; Pei-Hui Lin; Tianwei Lin; Wan-Wan Lin; Yee-Shin Lin; Yong Lin; Rafael Linden; Dan Lindholm; Lisa M Lindqvist; Paul Lingor; Andreas Linkermann; Lance A Liotta; Marta M Lipinski; Vitor A Lira; Michael P Lisanti; Paloma B Liton; Bo Liu; Chong Liu; Chun-Feng Liu; Fei Liu; Hung-Jen Liu; Jianxun Liu; Jing-Jing Liu; Jing-Lan Liu; Ke Liu; Leyuan Liu; Liang Liu; Quentin Liu; Rong-Yu Liu; Shiming Liu; Shuwen Liu; Wei Liu; Xian-De Liu; Xiangguo Liu; Xiao-Hong Liu; Xinfeng Liu; Xu Liu; Xueqin Liu; Yang Liu; Yule Liu; Zexian Liu; Zhe Liu; Juan P Liuzzi; Gérard Lizard; Mila Ljujic; Irfan J Lodhi; Susan E Logue; Bal L Lokeshwar; Yun Chau Long; Sagar Lonial; Benjamin Loos; Carlos López-Otín; Cristina López-Vicario; Mar Lorente; Philip L Lorenzi; Péter Lõrincz; Marek Los; Michael T Lotze; Penny E Lovat; Binfeng Lu; Bo Lu; Jiahong Lu; Qing Lu; She-Min Lu; Shuyan Lu; Yingying Lu; Frédéric Luciano; Shirley Luckhart; John Milton Lucocq; Paula Ludovico; Aurelia Lugea; Nicholas W Lukacs; Julian J Lum; Anders H Lund; Honglin Luo; Jia Luo; Shouqing Luo; Claudio Luparello; Timothy Lyons; Jianjie Ma; Yi Ma; Yong Ma; Zhenyi Ma; Juliano Machado; Glaucia M Machado-Santelli; Fernando Macian; Gustavo C MacIntosh; Jeffrey P MacKeigan; Kay F Macleod; John D MacMicking; Lee Ann MacMillan-Crow; Frank Madeo; Muniswamy Madesh; Julio Madrigal-Matute; Akiko Maeda; Tatsuya Maeda; Gustavo Maegawa; Emilia Maellaro; Hannelore Maes; Marta Magariños; Kenneth Maiese; Tapas K Maiti; Luigi Maiuri; Maria Chiara Maiuri; Carl G Maki; Roland Malli; Walter Malorni; Alina Maloyan; Fathia Mami-Chouaib; Na Man; Joseph D Mancias; Eva-Maria Mandelkow; Michael A Mandell; Angelo A Manfredi; Serge N Manié; Claudia Manzoni; Kai Mao; Zixu Mao; Zong-Wan Mao; Philippe Marambaud; Anna Maria Marconi; Zvonimir Marelja; Gabriella Marfe; Marta Margeta; Eva Margittai; Muriel Mari; Francesca V Mariani; Concepcio Marin; Sara Marinelli; Guillermo Mariño; Ivanka Markovic; Rebecca Marquez; Alberto M Martelli; Sascha Martens; Katie R Martin; Seamus J Martin; Shaun Martin; Miguel A Martin-Acebes; Paloma Martín-Sanz; Camille Martinand-Mari; Wim Martinet; Jennifer Martinez; Nuria Martinez-Lopez; Ubaldo Martinez-Outschoorn; Moisés Martínez-Velázquez; Marta Martinez-Vicente; Waleska Kerllen Martins; Hirosato Mashima; James A Mastrianni; Giuseppe Matarese; Paola Matarrese; Roberto Mateo; Satoaki Matoba; Naomichi Matsumoto; Takehiko Matsushita; Akira Matsuura; Takeshi Matsuzawa; Mark P Mattson; Soledad Matus; Norma Maugeri; Caroline Mauvezin; Andreas Mayer; Dusica Maysinger; Guillermo D Mazzolini; Mary Kate McBrayer; Kimberly McCall; Craig McCormick; Gerald M McInerney; Skye C McIver; Sharon McKenna; John J McMahon; Iain A McNeish; Fatima Mechta-Grigoriou; Jan Paul Medema; Diego L Medina; Klara Megyeri; Maryam Mehrpour; Jawahar L Mehta; Yide Mei; Ute-Christiane Meier; Alfred J Meijer; Alicia Meléndez; Gerry Melino; Sonia Melino; Edesio Jose Tenorio de Melo; Maria A Mena; Marc D Meneghini; Javier A Menendez; Regina Menezes; Liesu Meng; Ling-Hua Meng; Songshu Meng; Rossella Menghini; A Sue Menko; Rubem Fs Menna-Barreto; Manoj B Menon; Marco A Meraz-Ríos; Giuseppe Merla; Luciano Merlini; Angelica M Merlot; Andreas Meryk; Stefania Meschini; Joel N Meyer; Man-Tian Mi; Chao-Yu Miao; Lucia Micale; Simon Michaeli; Carine Michiels; Anna Rita Migliaccio; Anastasia Susie Mihailidou; Dalibor Mijaljica; Katsuhiko Mikoshiba; Enrico Milan; Leonor Miller-Fleming; Gordon B Mills; Ian G Mills; Georgia Minakaki; Berge A Minassian; Xiu-Fen Ming; Farida Minibayeva; Elena A Minina; Justine D Mintern; Saverio Minucci; Antonio Miranda-Vizuete; Claire H Mitchell; Shigeki Miyamoto; Keisuke Miyazawa; Noboru Mizushima; Katarzyna Mnich; Baharia Mograbi; Simin Mohseni; Luis Ferreira Moita; Marco Molinari; Maurizio Molinari; Andreas Buch Møller; Bertrand Mollereau; Faustino Mollinedo; Marco Mongillo; Martha M Monick; Serena Montagnaro; Craig Montell; Darren J Moore; Michael N Moore; Rodrigo Mora-Rodriguez; Paula I Moreira; Etienne Morel; Maria Beatrice Morelli; Sandra Moreno; Michael J Morgan; Arnaud Moris; Yuji Moriyasu; Janna L Morrison; Lynda A Morrison; Eugenia Morselli; Jorge Moscat; Pope L Moseley; Serge Mostowy; Elisa Motori; Denis Mottet; Jeremy C Mottram; Charbel E-H Moussa; Vassiliki E Mpakou; Hasan Mukhtar; Jean M Mulcahy Levy; Sylviane Muller; Raquel Muñoz-Moreno; Cristina Muñoz-Pinedo; Christian Münz; Maureen E Murphy; James T Murray; Aditya Murthy; Indira U Mysorekar; Ivan R Nabi; Massimo Nabissi; Gustavo A Nader; Yukitoshi Nagahara; Yoshitaka Nagai; Kazuhiro Nagata; Anika Nagelkerke; Péter Nagy; Samisubbu R Naidu; Sreejayan Nair; Hiroyasu Nakano; Hitoshi Nakatogawa; Meera Nanjundan; Gennaro Napolitano; Naweed I Naqvi; Roberta Nardacci; Derek P Narendra; Masashi Narita; Anna Chiara Nascimbeni; Ramesh Natarajan; Luiz C Navegantes; Steffan T Nawrocki; Taras Y Nazarko; Volodymyr Y Nazarko; Thomas Neill; Luca M Neri; Mihai G Netea; Romana T Netea-Maier; Bruno M Neves; Paul A Ney; Ioannis P Nezis; Hang Tt Nguyen; Huu Phuc Nguyen; Anne-Sophie Nicot; Hilde Nilsen; Per Nilsson; Mikio Nishimura; Ichizo Nishino; Mireia Niso-Santano; Hua Niu; Ralph A Nixon; Vincent Co Njar; Takeshi Noda; Angelika A Noegel; Elsie Magdalena Nolte; Erik Norberg; Koenraad K Norga; Sakineh Kazemi Noureini; Shoji Notomi; Lucia Notterpek; Karin Nowikovsky; Nobuyuki Nukina; Thorsten Nürnberger; Valerie B O'Donnell; Tracey O'Donovan; Peter J O'Dwyer; Ina Oehme; Clara L Oeste; Michinaga Ogawa; Besim Ogretmen; Yuji Ogura; Young J Oh; Masaki Ohmuraya; Takayuki Ohshima; Rani Ojha; Koji Okamoto; Toshiro Okazaki; F Javier Oliver; Karin Ollinger; Stefan Olsson; Daniel P Orban; Paulina Ordonez; Idil Orhon; Laszlo Orosz; Eyleen J O'Rourke; Helena Orozco; Angel L Ortega; Elena Ortona; Laura D Osellame; Junko Oshima; Shigeru Oshima; Heinz D Osiewacz; Takanobu Otomo; Kinya Otsu; Jing-Hsiung James Ou; Tiago F Outeiro; Dong-Yun Ouyang; Hongjiao Ouyang; Michael Overholtzer; Michelle A Ozbun; P Hande Ozdinler; Bulent Ozpolat; Consiglia Pacelli; Paolo Paganetti; Guylène Page; Gilles Pages; Ugo Pagnini; Beata Pajak; Stephen C Pak; Karolina Pakos-Zebrucka; Nazzy Pakpour; Zdena Palková; Francesca Palladino; Kathrin Pallauf; Nicolas Pallet; Marta Palmieri; Søren R Paludan; Camilla Palumbo; Silvia Palumbo; Olatz Pampliega; Hongming Pan; Wei Pan; Theocharis Panaretakis; Aseem Pandey; Areti Pantazopoulou; Zuzana Papackova; Daniela L Papademetrio; Issidora Papassideri; Alessio Papini; Nirmala Parajuli; Julian Pardo; Vrajesh V Parekh; Giancarlo Parenti; Jong-In Park; Junsoo Park; Ohkmae K Park; Roy Parker; Rosanna Parlato; Jan B Parys; Katherine R Parzych; Jean-Max Pasquet; Benoit Pasquier; Kishore Bs Pasumarthi; Daniel Patschan; Cam Patterson; Sophie Pattingre; Scott Pattison; Arnim Pause; Hermann Pavenstädt; Flaminia Pavone; Zully Pedrozo; Fernando J Peña; Miguel A Peñalva; Mario Pende; Jianxin Peng; Fabio Penna; Josef M Penninger; Anna Pensalfini; Salvatore Pepe; Gustavo Js Pereira; Paulo C Pereira; Verónica Pérez-de la Cruz; María Esther Pérez-Pérez; Diego Pérez-Rodríguez; Dolores Pérez-Sala; Celine Perier; Andras Perl; David H Perlmutter; Ida Perrotta; Shazib Pervaiz; Maija Pesonen; Jeffrey E Pessin; Godefridus J Peters; Morten Petersen; Irina Petrache; Basil J Petrof; Goran Petrovski; James M Phang; Mauro Piacentini; Marina Pierdominici; Philippe Pierre; Valérie Pierrefite-Carle; Federico Pietrocola; Felipe X Pimentel-Muiños; Mario Pinar; Benjamin Pineda; Ronit Pinkas-Kramarski; Marcello Pinti; Paolo Pinton; Bilal Piperdi; James M Piret; Leonidas C Platanias; Harald W Platta; Edward D Plowey; Stefanie Pöggeler; Marc Poirot; Peter Polčic; Angelo Poletti; Audrey H Poon; Hana Popelka; Blagovesta Popova; Izabela Poprawa; Shibu M Poulose; Joanna Poulton; Scott K Powers; Ted Powers; Mercedes Pozuelo-Rubio; Krisna Prak; Reinhild Prange; Mark Prescott; Muriel Priault; Sharon Prince; Richard L Proia; Tassula Proikas-Cezanne; Holger Prokisch; Vasilis J Promponas; Karin Przyklenk; Rosa Puertollano; Subbiah Pugazhenthi; Luigi Puglielli; Aurora Pujol; Julien Puyal; Dohun Pyeon; Xin Qi; Wen-Bin Qian; Zheng-Hong Qin; Yu Qiu; Ziwei Qu; Joe Quadrilatero; Frederick Quinn; Nina Raben; Hannah Rabinowich; Flavia Radogna; Michael J Ragusa; Mohamed Rahmani; Komal Raina; Sasanka Ramanadham; Rajagopal Ramesh; Abdelhaq Rami; Sarron Randall-Demllo; Felix Randow; Hai Rao; V Ashutosh Rao; Blake B Rasmussen; Tobias M Rasse; Edward A Ratovitski; Pierre-Emmanuel Rautou; Swapan K Ray; Babak Razani; Bruce H Reed; Fulvio Reggiori; Markus Rehm; Andreas S Reichert; Theo Rein; David J Reiner; Eric Reits; Jun Ren; Xingcong Ren; Maurizio Renna; Jane Eb Reusch; Jose L Revuelta; Leticia Reyes; Alireza R Rezaie; Robert I Richards; Des R Richardson; Clémence Richetta; Michael A Riehle; Bertrand H Rihn; Yasuko Rikihisa; Brigit E Riley; Gerald Rimbach; Maria Rita Rippo; Konstantinos Ritis; Federica Rizzi; Elizete Rizzo; Peter J Roach; Jeffrey Robbins; Michel Roberge; Gabriela Roca; Maria Carmela Roccheri; Sonia Rocha; Cecilia Mp Rodrigues; Clara I Rodríguez; Santiago Rodriguez de Cordoba; Natalia Rodriguez-Muela; Jeroen Roelofs; Vladimir V Rogov; Troy T Rohn; Bärbel Rohrer; Davide Romanelli; Luigina Romani; Patricia Silvia Romano; M Isabel G Roncero; Jose Luis Rosa; Alicia Rosello; Kirill V Rosen; Philip Rosenstiel; Magdalena Rost-Roszkowska; Kevin A Roth; Gael Roué; Mustapha Rouis; Kasper M Rouschop; Daniel T Ruan; Diego Ruano; David C Rubinsztein; Edmund B Rucker; Assaf Rudich; Emil Rudolf; Ruediger Rudolf; Markus A Ruegg; Carmen Ruiz-Roldan; Avnika Ashok Ruparelia; Paola Rusmini; David W Russ; Gian Luigi Russo; Giuseppe Russo; Rossella Russo; Tor Erik Rusten; Victoria Ryabovol; Kevin M Ryan; Stefan W Ryter; David M Sabatini; Michael Sacher; Carsten Sachse; Michael N Sack; Junichi Sadoshima; Paul Saftig; Ronit Sagi-Eisenberg; Sumit Sahni; Pothana Saikumar; Tsunenori Saito; Tatsuya Saitoh; Koichi Sakakura; Machiko Sakoh-Nakatogawa; Yasuhito Sakuraba; María Salazar-Roa; Paolo Salomoni; Ashok K Saluja; Paul M Salvaterra; Rosa Salvioli; Afshin Samali; Anthony Mj Sanchez; José A Sánchez-Alcázar; Ricardo Sanchez-Prieto; Marco Sandri; Miguel A Sanjuan; Stefano Santaguida; Laura Santambrogio; Giorgio Santoni; Claudia Nunes Dos Santos; Shweta Saran; Marco Sardiello; Graeme Sargent; Pallabi Sarkar; Sovan Sarkar; Maria Rosa Sarrias; Minnie M Sarwal; Chihiro Sasakawa; Motoko Sasaki; Miklos Sass; Ken Sato; Miyuki Sato; Joseph Satriano; Niramol Savaraj; Svetlana Saveljeva; Liliana Schaefer; Ulrich E Schaible; Michael Scharl; Hermann M Schatzl; Randy Schekman; Wiep Scheper; Alfonso Schiavi; Hyman M Schipper; Hana Schmeisser; Jens Schmidt; Ingo Schmitz; Bianca E Schneider; E Marion Schneider; Jaime L Schneider; Eric A Schon; Miriam J Schönenberger; Axel H Schönthal; Daniel F Schorderet; Bernd Schröder; Sebastian Schuck; Ryan J Schulze; Melanie Schwarten; Thomas L Schwarz; Sebastiano Sciarretta; Kathleen Scotto; A Ivana Scovassi; Robert A Screaton; Mark Screen; Hugo Seca; Simon Sedej; Laura Segatori; Nava Segev; Per O Seglen; Jose M Seguí-Simarro; Juan Segura-Aguilar; Ekihiro Seki; Christian Sell; Iban Seiliez; Clay F Semenkovich; Gregg L Semenza; Utpal Sen; Andreas L Serra; Ana Serrano-Puebla; Hiromi Sesaki; Takao Setoguchi; Carmine Settembre; John J Shacka; Ayesha N Shajahan-Haq; Irving M Shapiro; Shweta Sharma; Hua She; C-K James Shen; Chiung-Chyi Shen; Han-Ming Shen; Sanbing Shen; Weili Shen; Rui Sheng; Xianyong Sheng; Zu-Hang Sheng; Trevor G Shepherd; Junyan Shi; Qiang Shi; Qinghua Shi; Yuguang Shi; Shusaku Shibutani; Kenichi Shibuya; Yoshihiro Shidoji; Jeng-Jer Shieh; Chwen-Ming Shih; Yohta Shimada; Shigeomi Shimizu; Dong Wook Shin; Mari L Shinohara; Michiko Shintani; Takahiro Shintani; Tetsuo Shioi; Ken Shirabe; Ronit Shiri-Sverdlov; Orian Shirihai; Gordon C Shore; Chih-Wen Shu; Deepak Shukla; Andriy A Sibirny; Valentina Sica; Christina J Sigurdson; Einar M Sigurdsson; Puran Singh Sijwali; Beata Sikorska; Wilian A Silveira; Sandrine Silvente-Poirot; Gary A Silverman; Jan Simak; Thomas Simmet; Anna Katharina Simon; Hans-Uwe Simon; Cristiano Simone; Matias Simons; Anne Simonsen; Rajat Singh; Shivendra V Singh; Shrawan K Singh; Debasish Sinha; Sangita Sinha; Frank A Sinicrope; Agnieszka Sirko; Kapil Sirohi; Balindiwe Jn Sishi; Annie Sittler; Parco M Siu; Efthimios Sivridis; Anna Skwarska; Ruth Slack; Iva Slaninová; Nikolai Slavov; Soraya S Smaili; Keiran Sm Smalley; Duncan R Smith; Stefaan J Soenen; Scott A Soleimanpour; Anita Solhaug; Kumaravel Somasundaram; Jin H Son; Avinash Sonawane; Chunjuan Song; Fuyong Song; Hyun Kyu Song; Ju-Xian Song; Wei Song; Kai Y Soo; Anil K Sood; Tuck Wah Soong; Virawudh Soontornniyomkij; Maurizio Sorice; Federica Sotgia; David R Soto-Pantoja; Areechun Sotthibundhu; Maria João Sousa; Herman P Spaink; Paul N Span; Anne Spang; Janet D Sparks; Peter G Speck; Stephen A Spector; Claudia D Spies; Wolfdieter Springer; Daret St Clair; Alessandra Stacchiotti; Bart Staels; Michael T Stang; Daniel T Starczynowski; Petro Starokadomskyy; Clemens Steegborn; John W Steele; Leonidas Stefanis; Joan Steffan; Christine M Stellrecht; Harald Stenmark; Tomasz M Stepkowski; Stęphan T Stern; Craig Stevens; Brent R Stockwell; Veronika Stoka; Zuzana Storchova; Björn Stork; Vassilis Stratoulias; Dimitrios J Stravopodis; Pavel Strnad; Anne Marie Strohecker; Anna-Lena Ström; Per Stromhaug; Jiri Stulik; Yu-Xiong Su; Zhaoliang Su; Carlos S Subauste; Srinivasa Subramaniam; Carolyn M Sue; Sang Won Suh; Xinbing Sui; Supawadee Sukseree; David Sulzer; Fang-Lin Sun; Jiaren Sun; Jun Sun; Shi-Yong Sun; Yang Sun; Yi Sun; Yingjie Sun; Vinod Sundaramoorthy; Joseph Sung; Hidekazu Suzuki; Kuninori Suzuki; Naoki Suzuki; Tadashi Suzuki; Yuichiro J Suzuki; Michele S Swanson; Charles Swanton; Karl Swärd; Ghanshyam Swarup; Sean T Sweeney; Paul W Sylvester; Zsuzsanna Szatmari; Eva Szegezdi; Peter W Szlosarek; Heinrich Taegtmeyer; Marco Tafani; Emmanuel Taillebourg; Stephen Wg Tait; Krisztina Takacs-Vellai; Yoshinori Takahashi; Szabolcs Takáts; Genzou Takemura; Nagio Takigawa; Nicholas J Talbot; Elena Tamagno; Jerome Tamburini; Cai-Ping Tan; Lan Tan; Mei Lan Tan; Ming Tan; Yee-Joo Tan; Keiji Tanaka; Masaki Tanaka; Daolin Tang; Dingzhong Tang; Guomei Tang; Isei Tanida; Kunikazu Tanji; Bakhos A Tannous; Jose A Tapia; Inmaculada Tasset-Cuevas; Marc Tatar; Iman Tavassoly; Nektarios Tavernarakis; Allen Taylor; Graham S Taylor; Gregory A Taylor; J Paul Taylor; Mark J Taylor; Elena V Tchetina; Andrew R Tee; Fatima Teixeira-Clerc; Sucheta Telang; Tewin Tencomnao; Ba-Bie Teng; Ru-Jeng Teng; Faraj Terro; Gianluca Tettamanti; Arianne L Theiss; Anne E Theron; Kelly Jean Thomas; Marcos P Thomé; Paul G Thomes; Andrew Thorburn; Jeremy Thorner; Thomas Thum; Michael Thumm; Teresa Lm Thurston; Ling Tian; Andreas Till; Jenny Pan-Yun Ting; Vladimir I Titorenko; Lilach Toker; Stefano Toldo; Sharon A Tooze; Ivan Topisirovic; Maria Lyngaas Torgersen; Liliana Torosantucci; Alicia Torriglia; Maria Rosaria Torrisi; Cathy Tournier; Roberto Towns; Vladimir Trajkovic; Leonardo H Travassos; Gemma Triola; Durga Nand Tripathi; Daniela Trisciuoglio; Rodrigo Troncoso; Ioannis P Trougakos; Anita C Truttmann; Kuen-Jer Tsai; Mario P Tschan; Yi-Hsin Tseng; Takayuki Tsukuba; Allan Tsung; Andrey S Tsvetkov; Shuiping Tu; Hsing-Yu Tuan; Marco Tucci; David A Tumbarello; Boris Turk; Vito Turk; Robin Fb Turner; Anders A Tveita; Suresh C Tyagi; Makoto Ubukata; Yasuo Uchiyama; Andrej Udelnow; Takashi Ueno; Midori Umekawa; Rika Umemiya-Shirafuji; Benjamin R Underwood; Christian Ungermann; Rodrigo P Ureshino; Ryo Ushioda; Vladimir N Uversky; Néstor L Uzcátegui; Thomas Vaccari; Maria I Vaccaro; Libuše Váchová; Helin Vakifahmetoglu-Norberg; Rut Valdor; Enza Maria Valente; Francois Vallette; Angela M Valverde; Greet Van den Berghe; Ludo Van Den Bosch; Gijs R van den Brink; F Gisou van der Goot; Ida J van der Klei; Luc Jw van der Laan; Wouter G van Doorn; Marjolein van Egmond; Kenneth L van Golen; Luc Van Kaer; Menno van Lookeren Campagne; Peter Vandenabeele; Wim Vandenberghe; Ilse Vanhorebeek; Isabel Varela-Nieto; M Helena Vasconcelos; Radovan Vasko; Demetrios G Vavvas; Ignacio Vega-Naredo; Guillermo Velasco; Athanassios D Velentzas; Panagiotis D Velentzas; Tibor Vellai; Edo Vellenga; Mikkel Holm Vendelbo; Kartik Venkatachalam; Natascia Ventura; Salvador Ventura; Patrícia St Veras; Mireille Verdier; Beata G Vertessy; Andrea Viale; Michel Vidal; Helena L A Vieira; Richard D Vierstra; Nadarajah Vigneswaran; Neeraj Vij; Miquel Vila; Margarita Villar; Victor H Villar; Joan Villarroya; Cécile Vindis; Giampietro Viola; Maria Teresa Viscomi; Giovanni Vitale; Dan T Vogl; Olga V Voitsekhovskaja; Clarissa von Haefen; Karin von Schwarzenberg; Daniel E Voth; Valérie Vouret-Craviari; Kristina Vuori; Jatin M Vyas; Christian Waeber; Cheryl Lyn Walker; Mark J Walker; Jochen Walter; Lei Wan; Xiangbo Wan; Bo Wang; Caihong Wang; Chao-Yung Wang; Chengshu Wang; Chenran Wang; Chuangui Wang; Dong Wang; Fen Wang; Fuxin Wang; Guanghui Wang; Hai-Jie Wang; Haichao Wang; Hong-Gang Wang; Hongmin Wang; Horng-Dar Wang; Jing Wang; Junjun Wang; Mei Wang; Mei-Qing Wang; Pei-Yu Wang; Peng Wang; Richard C Wang; Shuo Wang; Ting-Fang Wang; Xian Wang; Xiao-Jia Wang; Xiao-Wei Wang; Xin Wang; Xuejun Wang; Yan Wang; Yanming Wang; Ying Wang; Ying-Jan Wang; Yipeng Wang; Yu Wang; Yu Tian Wang; Yuqing Wang; Zhi-Nong Wang; Pablo Wappner; Carl Ward; Diane McVey Ward; Gary Warnes; Hirotaka Watada; Yoshihisa Watanabe; Kei Watase; Timothy E Weaver; Colin D Weekes; Jiwu Wei; Thomas Weide; Conrad C Weihl; Günther Weindl; Simone Nardin Weis; Longping Wen; Xin Wen; Yunfei Wen; Benedikt Westermann; Cornelia M Weyand; Anthony R White; Eileen White; J Lindsay Whitton; Alexander J Whitworth; Joëlle Wiels; Franziska Wild; Manon E Wildenberg; Tom Wileman; Deepti Srinivas Wilkinson; Simon Wilkinson; Dieter Willbold; Chris Williams; Katherine Williams; Peter R Williamson; Konstanze F Winklhofer; Steven S Witkin; Stephanie E Wohlgemuth; Thomas Wollert; Ernst J Wolvetang; Esther Wong; G William Wong; Richard W Wong; Vincent Kam Wai Wong; Elizabeth A Woodcock; Karen L Wright; Chunlai Wu; Defeng Wu; Gen Sheng Wu; Jian Wu; Junfang Wu; Mian Wu; Min Wu; Shengzhou Wu; William Kk Wu; Yaohua Wu; Zhenlong Wu; Cristina Pr Xavier; Ramnik J Xavier; Gui-Xian Xia; Tian Xia; Weiliang Xia; Yong Xia; Hengyi Xiao; Jian Xiao; Shi Xiao; Wuhan Xiao; Chuan-Ming Xie; Zhiping Xie; Zhonglin Xie; Maria Xilouri; Yuyan Xiong; Chuanshan Xu; Congfeng Xu; Feng Xu; Haoxing Xu; Hongwei Xu; Jian Xu; Jianzhen Xu; Jinxian Xu; Liang Xu; Xiaolei Xu; Yangqing Xu; Ye Xu; Zhi-Xiang Xu; Ziheng Xu; Yu Xue; Takahiro Yamada; Ai Yamamoto; Koji Yamanaka; Shunhei Yamashina; Shigeko Yamashiro; Bing Yan; Bo Yan; Xianghua Yan; Zhen Yan; Yasuo Yanagi; Dun-Sheng Yang; Jin-Ming Yang; Liu Yang; Minghua Yang; Pei-Ming Yang; Peixin Yang; Qian Yang; Wannian Yang; Wei Yuan Yang; Xuesong Yang; Yi Yang; Ying Yang; Zhifen Yang; Zhihong Yang; Meng-Chao Yao; Pamela J Yao; Xiaofeng Yao; Zhenyu Yao; Zhiyuan Yao; Linda S Yasui; Mingxiang Ye; Barry Yedvobnick; Behzad Yeganeh; Elizabeth S Yeh; Patricia L Yeyati; Fan Yi; Long Yi; Xiao-Ming Yin; Calvin K Yip; Yeong-Min Yoo; Young Hyun Yoo; Seung-Yong Yoon; Ken-Ichi Yoshida; Tamotsu Yoshimori; Ken H Young; Huixin Yu; Jane J Yu; Jin-Tai Yu; Jun Yu; Li Yu; W Haung Yu; Xiao-Fang Yu; Zhengping Yu; Junying Yuan; Zhi-Min Yuan; Beatrice Yjt Yue; Jianbo Yue; Zhenyu Yue; David N Zacks; Eldad Zacksenhaus; Nadia Zaffaroni; Tania Zaglia; Zahra Zakeri; Vincent Zecchini; Jinsheng Zeng; Min Zeng; Qi Zeng; Antonis S Zervos; Donna D Zhang; Fan Zhang; Guo Zhang; Guo-Chang Zhang; Hao Zhang; Hong Zhang; Hong Zhang; Hongbing Zhang; Jian Zhang; Jian Zhang; Jiangwei Zhang; Jianhua Zhang; Jing-Pu Zhang; Li Zhang; Lin Zhang; Lin Zhang; Long Zhang; Ming-Yong Zhang; Xiangnan Zhang; Xu Dong Zhang; Yan Zhang; Yang Zhang; Yanjin Zhang; Yingmei Zhang; Yunjiao Zhang; Mei Zhao; Wei-Li Zhao; Xiaonan Zhao; Yan G Zhao; Ying Zhao; Yongchao Zhao; Yu-Xia Zhao; Zhendong Zhao; Zhizhuang J Zhao; Dexian Zheng; Xi-Long Zheng; Xiaoxiang Zheng; Boris Zhivotovsky; Qing Zhong; Guang-Zhou Zhou; Guofei Zhou; Huiping Zhou; Shu-Feng Zhou; Xu-Jie Zhou; Hongxin Zhu; Hua Zhu; Wei-Guo Zhu; Wenhua Zhu; Xiao-Feng Zhu; Yuhua Zhu; Shi-Mei Zhuang; Xiaohong Zhuang; Elio Ziparo; Christos E Zois; Teresa Zoladek; Wei-Xing Zong; Antonio Zorzano; Susu M Zughaier Journal: Autophagy Date: 2016 Impact factor: 16.016