Literature DB >> 4059050

Modification of guanine bases by nucleoside phosphoramidite reagents during the solid phase synthesis of oligonucleotides.

R T Pon, M J Damha, K K Ogilvie.   

Abstract

Nucleoside 3'-phosphoramidite and chlorophosphite reagents have been found to react with the lactam function of guanine. This reaction caused unsatisfactory results when oligodeoxyribonucleotides containing a large number of guanine bases were prepared in an automated solid phase synthesizer. The guanine modification is unstable, and leads to depurination and chain cleavage. This side reaction can be eliminated by protecting the O6-position. A new O6-p-nitrophenylethyldeoxyguanosine phosphoramidite derivative, 8, was used to prepare sequences containing up to 24 guanine bases with greatly improved results. A hexatriacontanucleotide, d(CGCGGGGTGGAGCAGCCTGGTAGCTCGTCGGGCTCA), was also prepared using O6-protected deoxyguanosine nucleosides.

Entities:  

Mesh:

Substances:

Year:  1985        PMID: 4059050      PMCID: PMC321970          DOI: 10.1093/nar/13.18.6447

Source DB:  PubMed          Journal:  Nucleic Acids Res        ISSN: 0305-1048            Impact factor:   16.971


  9 in total

1.  Automated synthesis of gene fragments.

Authors:  G Alvarado-Urbina; G M Sathe; W C Liu; M F Gillen; P D Duck; R Bender; K K Ogilvie
Journal:  Science       Date:  1981-10-16       Impact factor: 47.728

2.  Synthesis of oligodeoxyribonucleotides on silica gel support.

Authors:  F Chow; T Kempe; G Palm
Journal:  Nucleic Acids Res       Date:  1981-06-25       Impact factor: 16.971

Review 3.  Synthesis and use of synthetic oligonucleotides.

Authors:  K Itakura; J J Rossi; R B Wallace
Journal:  Annu Rev Biochem       Date:  1984       Impact factor: 23.643

4.  Solid-phase synthesis of the self-complementary hexamer d(c7GpCpc7GpCpc7GpC) via the O-3'-phosphoramidite of 7-deaza-2'-deoxyguanosine.

Authors:  F Seela; H Driller
Journal:  Nucleic Acids Res       Date:  1985-02-11       Impact factor: 16.971

5.  A rapid deprotection procedure for phosphotriester DNA synthesis.

Authors:  T P Patel; M A Chauncey; T A Millican; C C Bose; M A Eaton
Journal:  Nucleic Acids Res       Date:  1984-09-11       Impact factor: 16.971

6.  Studies on transfer ribonucleic acids and related compounds. XLV. Block condensation of ribooligonucleotides containing 2'-O-tetrahydrofuranyl-5'-O-dimethoxytritylnucleosides.

Authors:  E Ohtsuka; A Yamane; M Ikehara
Journal:  Nucleic Acids Res       Date:  1983-03-11       Impact factor: 16.971

7.  Methylation of thymine residues during oligonucleotide synthesis.

Authors:  X Gao; B L Gaffney; M Senior; R R Riddle; R A Jones
Journal:  Nucleic Acids Res       Date:  1985-01-25       Impact factor: 16.971

8.  Construction and evaluation of an instrument for the automated synthesis of oligodeoxyribonucleotides.

Authors:  B D Warner; M E Warner; G A Karns; L Ku; S Brown-Shimer; M S Urdea
Journal:  DNA       Date:  1984-10

9.  DNA chain length markers and the influence of base composition on electrophoretic mobility of oligodeoxyribonucleotides in polyacrylamide-gels.

Authors:  R Frank; H Köster
Journal:  Nucleic Acids Res       Date:  1979       Impact factor: 16.971

  9 in total
  16 in total

1.  Evaluation of 3-ethoxy-1,2,4-dithiazoline-5-one (EDITH) as a new sulfurizing reagent in combination with labile exocyclic amino protecting groups for solid-phase oligonucleotide synthesis.

Authors:  M Y Ma; J C Dignam; G W Fong; L Li; S H Gray; B Jacob-Samuel; S T George
Journal:  Nucleic Acids Res       Date:  1997-09-15       Impact factor: 16.971

2.  The synthesis and stability of oligodeoxyribonucleotides containing the deoxyadenosine mimic 1-(2'-deoxy-beta-D-ribofuranosyl)imidazole-4-carboxamide.

Authors:  W T Johnson; P Zhang; D E Bergstrom
Journal:  Nucleic Acids Res       Date:  1997-02-01       Impact factor: 16.971

3.  RNA-mediated gene assembly from DNA arrays.

Authors:  Cheng-Hsien Wu; Matthew R Lockett; Lloyd M Smith
Journal:  Angew Chem Int Ed Engl       Date:  2012-03-30       Impact factor: 15.336

4.  5-Fluorodeoxyuridine as an alternative to the synthesis of mixed hybridization probes for the detection of specific gene sequences.

Authors:  J F Habener; C D Vo; D B Le; G P Gryan; L Ercolani; A H Wang
Journal:  Proc Natl Acad Sci U S A       Date:  1988-03       Impact factor: 11.205

5.  Application of 2-cyanoethyl N,N,N',N'-tetraisopropylphosphorodiamidite for in situ preparation of deoxyribonucleoside phosphoramidites and their use in polymer-supported synthesis of oligodeoxyribonucleotides.

Authors:  J Nielsen; M Taagaard; J E Marugg; J H van Boom; O Dahl
Journal:  Nucleic Acids Res       Date:  1986-09-25       Impact factor: 16.971

6.  Synthesis and structure assignments of amide protected nucleosides and their use as phosphoramidites in deoxyoligonucleotide synthesis.

Authors:  M Mag; J W Engels
Journal:  Nucleic Acids Res       Date:  1988-04-25       Impact factor: 16.971

7.  Solid-phase synthesis of DNA fragments containing the modified base 7-hydro-8-oxo-2'-deoxyguanosine.

Authors:  H C Roelen; C P Saris; H F Brugghe; H van den Elst; J G Westra; G A van der Marel; J H van Boom
Journal:  Nucleic Acids Res       Date:  1991-08-25       Impact factor: 16.971

8.  Large scale, liquid phase synthesis of oligonucleotides by the phosphoramidite approach.

Authors:  G M Bonora; G Biancotto; M Maffini; C L Scremin
Journal:  Nucleic Acids Res       Date:  1993-03-11       Impact factor: 16.971

9.  Guanine modification during chemical DNA synthesis.

Authors:  J S Eadie; D S Davidson
Journal:  Nucleic Acids Res       Date:  1987-10-26       Impact factor: 16.971

10.  Synthesis of DNA via deoxynucleoside H-phosphonate intermediates.

Authors:  B C Froehler; P G Ng; M D Matteucci
Journal:  Nucleic Acids Res       Date:  1986-07-11       Impact factor: 16.971

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.