Initiator tRNA lacking 1-methyladenosine is targeted by the rapid tRNA decay pathway in evolutionarily distant yeast species.

All tRNAs have numerous modifications, lack of which often results in growth defects in the budding yeast Saccharomyces cerevisiae and neurological or other disorders in humans. In S. cerevisiae, lack of tRNA body modifications can lead to impaired tRNA stability and decay of a subset of the hypomodified tRNAs. Mutants lacking 7-methylguanosine at G46 (m7G46), N2,N2-dimethylguanosine (m2,2G26), or 4-acetylcytidine (ac4C12), in combination with other body modification mutants, target certain mature hypomodified tRNAs to the rapid tRNA decay (RTD) pathway, catalyzed by 5'-3' exonucleases Xrn1 and Rat1, and regulated by Met22. The RTD pathway is conserved in the phylogenetically distant fission yeast Schizosaccharomyces pombe for mutants lacking m7G46. In contrast, S. cerevisiae trm6/gcd10 mutants with reduced 1-methyladenosine (m1A58) specifically target pre-tRNAiMet(CAU) to the nuclear surveillance pathway for 3'-5' exonucleolytic decay by the TRAMP complex and nuclear exosome. We show here that the RTD pathway has an unexpected major role in the biology of m1A58 and tRNAiMet(CAU) in both S. pombe and S. cerevisiae. We find that S. pombe trm6Δ mutants lacking m1A58 are temperature sensitive due to decay of tRNAiMet(CAU) by the RTD pathway. Thus, trm6Δ mutants had reduced levels of tRNAiMet(CAU) and not of eight other tested tRNAs, overexpression of tRNAiMet(CAU) restored growth, and spontaneous suppressors that restored tRNAiMet(CAU) levels had mutations in dhp1/RAT1 or tol1/MET22. In addition, deletion of cid14/TRF4 in the nuclear surveillance pathway did not restore growth. Furthermore, re-examination of S. cerevisiae trm6 mutants revealed a major role of the RTD pathway in maintaining tRNAiMet(CAU) levels, in addition to the known role of the nuclear surveillance pathway. These findings provide evidence for the importance of m1A58 in the biology of tRNAiMet(CAU) throughout eukaryotes, and fuel speculation that the RTD pathway has a major role in quality control of body modification mutants throughout fungi and other eukaryotes.

Introduction

tRNAs are central to the process of translation, a role that is enabled by their extensive and highly conserved post-transcriptional modifications [1-3]. Lack of any of a number of modifications causes growth defects in the budding yeast Saccharomyces cerevisiae [3], as well as a number of neurological or mitochondrial disorders in humans [4, 5]. Lack of modifications in and around the anticodon loop (ACL) frequently reduces the efficiency and/or fidelity of mRNA decoding [6-8], disrupts reading-frame maintenance [9, 10], or decreases charging efficiency and/or fidelity [11]. Lack of modifications in the main tRNA body (outside the ACL) often results in altered folding [12] or reduced tRNA stability, leading to degradation of a subset of the hypomodified tRNAs by one of two characterized decay pathways [13-15].

The rapid tRNA decay (RTD) pathway degrades a subset of the tRNA species lacking any of several body modifications. Degradation of tRNAs by the RTD pathway is catalyzed by the 5’-3’ exonucleases Rat1 and Xrn1, and inhibited by a met22Δ mutation [16] due to accumulation of the Met22 substrate adenosine 3’,5’ bisphosphate (pAp) [17, 18]. In S. cerevisiae, lack of m7G46, m2,2G26, or ac4C12 is known to trigger RTD, and is associated with temperature sensitivity, particularly in combination with lack of other tRNA body modifications. Thus, an S. cerevisiae trm8Δ trm4Δ mutant (lacking m7G46 and m5C), is temperature sensitive due to decay of mature tRNAVal(AAC) by the RTD pathway [14, 16]. Similarly, an S. cerevisiae tan1Δ trm44Δ mutant (lacking ac4C12 and Um44) and a trm1Δ trm4Δ mutant (lacking m2,2G26 and m5C) are each temperature sensitive due to decay of tRNASer(CGA) and tRNASer(UGA) [16, 19, 20]. Moreover, each of the corresponding trm8Δ, tan1Δ, and trm1Δ single mutants has an RTD signature, as their temperature sensitivity is suppressed by a met22Δ mutation, and is associated with decay of one or more hypomodified tRNA substrates [20].

In addition, recent results show that the RTD pathway also acts on a subset of tRNA species lacking m7G46 in the phylogenetically distant fission yeast Schizosaccharomyces pombe. Thus, the temperature sensitivity of S. pombe trm8Δ mutants is due to decay of tRNATyr(GUA) and to some extent tRNAPro(AGG), and both the decay and the temperature sensitivity are suppressed by mutations in the RAT1 ortholog dhp1 [15].

The other major decay pathway that targets tRNAs lacking a body modification in S. cerevisiae is the nuclear surveillance pathway, which degrades the precursor of initiator tRNA (pre-tRNAiMet(CAU)) lacking m1A58 [13, 21]. Degradation by this pathway is catalyzed by Trf4 of the TRAMP complex, which oligoadenylates the 3’ end of pre-tRNAiMet(CAU), followed by its 3’-5’ exonucleolytic degradation by Rrp6 and Rrp44 of the nuclear exosome [13, 22–25]. The m1A58 modification is found on numerous tRNA species in S. cerevisiae, but tRNAiMet(CAU) is uniquely different from other tRNAs due in part to its non-canonical nucleotides at A20, A54, and A60 and an unusual substructure involving these residues and m1A58 [26], presumably accounting for its unique sensitivity to decay in strains lacking m1A58 [13]. In addition, the nuclear surveillance pathway is also known to target about 50% of all tRNA transcripts, possibly due to stochastic errors during transcription, mis-folding, or natural competition between decay and processing [27].

Understanding the quality control of tRNAiMet(CAU) is crucial because of its central role in translation initiation. In this role, tRNAiMet(CAU) is a component of the eukaryotic ternary complex that binds the 40S ribosome subunit to form the 43S pre-initiation complex, which in turn binds capped mRNAs and scans their sequence for an appropriate AUG start codon [28]. Moreover, tRNAiMet(CAU) is only involved in translation initiation and has its own dedicated set of factors for its delivery to the 40S subunit [29], whereas all other tRNAs participate only in elongation, and their delivery only involves the elongation factor eEF-1A [30], which does not participate in translation initiation. In addition, tRNAiMet(CAU) levels are important in regulating the general amino acid control pathway (integrated stress response in humans) by regulation of translation of the transcription factor Gcn4 (human ATF4), which re-programs gene expression in the cell [31, 32]. Furthermore, in human breast epithelial cells, overexpression of tRNAiMet(CAU) causes increased cell proliferation and metabolic activity [33], and in mouse, elevated expression of tRNAiMet(CAU) stimulates cell migration and drives melanoma invasion [34].

Despite the importance of tRNAiMet(CAU) levels in S. cerevisiae and humans, it is not clear how tRNAiMet(CAU) levels are regulated in eukaryotes. Although there is compelling evidence in S. cerevisiae that the nuclear surveillance pathway targets pre-tRNAiMet(CAU) for decay in trm6/gcd10 or trm61/gcd14 mutants with reduced m1A58, available information in other eukaryotes suggests the possibility of alternative pathways. HeLa cells that are heat shocked at 43°C undergo decay of tRNAiMet(CAU) by Xrn1 and Rat1 over several hours, but it is not clear why decay occurred, as there was no obvious change in the modifications or physical stability of the remaining tRNAiMet(CAU) [35]. Moreover, tRNAiMet(CAU) levels in human cells were upregulated by knockdown of ALKBH1, which has an m1A-demethylase activity, and glucose starvation led to increased ALKBH1, linked to reduced tRNAiMet(CAU) and reduced translation [36]. Although the mechanisms by which tRNAiMet(CAU) levels are regulated are not known, it is clear that there is a link between m1A58 modification status and tRNAiMet(CAU) levels in eukaryotes. Thus, depletion of TRM6 or TRM61 in human cells results in reduced levels of tRNAiMet(CAU) and slow growth, which is partially rescued by overexpression of tRNAiMet(CAU) [37]. Similarly, Arabidopsis thaliana trm61 mutants have reduced tRNAiMet(CAU) levels, which is associated with shortened siliques [38].

To address the evolutionary role and mechanisms by which m1A58 influences tRNAiMet(CAU) levels and function, we have compared m1A58 biology in the fission yeast S. pombe with that in S. cerevisiae, which diverged ~600 million years ago (Mya) [39]. We show here that the RTD pathway has an unexpected major role in the biology of m1A58 and tRNAiMet(CAU) in both S. pombe and S. cerevisiae. We find that S. pombe trm6Δ mutants lack m1A58 and are temperature sensitive due to the decay of tRNAiMet(CAU) by the RTD pathway, as spontaneous suppressors that restored tRNAiMet(CAU) levels had mutations in the RAT1 ortholog dhp1 or the MET22 ortholog tol1, whereas mutation of the TRF4 ortholog cid14 did not suppress the growth defect. Moreover, we found a major role of the RTD pathway in S. cerevisiae TRM6 biology, as mutation of the RTD pathway components MET22, RAT1, or XRN1 each suppressed the temperature sensitivity of S. cerevisiae trm6-504 mutants and restored tRNAiMet(CAU) levels. Furthermore, we found that the lethality of S. cerevisiae trm6Δ mutants was suppressed by inhibition of both the RTD pathway and the nuclear surveillance pathway, but not by inhibition of either pathway alone.

Thus, our results show the importance of tRNAiMet(CAU) as a target for m1A58 modification by Trm6:Trm61 across evolutionarily distant fungal species. Our results also uncover an unexpected conserved evolutionary role of the RTD pathway in tRNAiMet(CAU) quality control in trm6 mutants of both fungal species, as previously found for all three other body modification mutants studied in S. cerevisiae [16, 20], and the only other body modification mutant studied in S. pombe [15]. These findings fuel speculation that the RTD pathway has a major role in quality control of other body modification mutants in these organisms, as well as in metazoans.

Results

S. pombe trm6Δ and trm61Δ mutants are temperature sensitive, and lack m1A58 in their tRNA

To begin analysis of the biology of S. pombe Trm6 and Trm61, we investigated the growth phenotype of trm6Δ and trm61Δ mutants which, unlike the corresponding S. cerevisiae mutants, are reported to be viable [40]. To guard against background mutations that might have accumulated in the deletion collection, we first re-made the trm6Δ and trm61Δ mutants in a wild type (WT) strain, using appropriate kanamycin resistance cassettes, and then compared the growth of two independent trm6Δ and trm61Δ transformants relative to the WT parent. Each tested S. pombe trm6Δ and trm61Δ mutant grew nearly as well as WT at lower temperatures, but was temperature sensitive on rich (YES) media at 38°C, and on minimal complete media lacking histidine (EMMC-His) at 33°C (Fig 1A). As expected if these trm6Δ and trm61Δ phenotypes were due to the corresponding deletions, the growth defects were fully complemented after introduction of an S. pombe [leu2] plasmid expressing P trm6 or P trm61 respectively (S1A and S1B Fig).

Fig 1

S. pombe trm6Δ mutants and trm61Δ mutants are temperature sensitive and lack m1A58.

S. pombe trm6Δ mutants, trm61Δ mutants, and WT cells were grown overnight in YES media at 30°C, diluted to OD600 ~0.5, serially diluted 10-fold in YES media, and then 2 μL were spotted onto plates containing YES or EMMC-his media and incubated at the indicated temperatures for 3 days. ( from A, as measured by HPLC separation of nucleosides. S. pombe trm6Δ mutants, trm61Δ mutants, and WT cells were grown in biological triplicate in YES media at 30°C and tRNATyr(GUA) was purified, and digested to nucleosides, and then nucleosides were separated by HPLC as described in Materials and Methods. ( in The chart shows average moles/mol of nucleosides with associated standard deviations; WT, blue; trm6Δ, orange; trm61Δ, gray. ( and tRNA from A. Bulk RNA from the growth for Fig 1B was analyzed by poison primer extension assay, as described in Materials and Methods, with primer OMT 775 (complementary to tRNAiMet(CAU) nt 76–61) and primer OMT 477 (complementary to tRNATyr(GUA) 76–61) in the presence of ddGTP. The poison primer extension produces a stop at C56 for both tRNAiMet(CAU) and tRNATyr(GUA), and the presence of m1A58 results in a stop at N59. A sequencing ladder is shown at the left. and tRNA. For each primer extension, the signals at N59 and C56 were first corrected by subtraction of the signals at A58 and N57 respectively.

Because the Trm6:Trm61 complex is essential in S. cerevisiae for m1A58 modification of substrate tRNAs [21, 41], we examined S. pombe trm6Δ and trm61Δ mutants for m1A58, to guard against the possibility that the mutants were alive because there is another protein that can catalyze some m1A58 modification. Examination by HPLC of the nucleoside composition of purified tRNATyr(GUA) from trm6Δ and trm61Δ mutants revealed that m1A levels were less than 0.03 moles/mole, compared to 0.60 moles/mole in WT cells, whereas levels of Ψ, m5C, and m7G were very similar in the tRNATyr(GUA) from both mutant and WT cells (Fig 1B and 1C). Poison primer extension of tRNATyr(GUA) from WT bulk RNA showed a complete block at U59 (98%) due to the presence of m1A58, which was virtually undetectable in trm6Δ and trm61Δ mutants (0.1% for trm6Δ and 0.8% in trm61Δ) (Fig 1D and 1E). Similarly, poison primer extension showed that tRNAiMet(CAU) was nearly completely modified with m1A58 in WT cells (97%), but not visibly modified in trm6Δ and trm61Δ mutants (although quantification with the high background gave 2.0% for trm6Δ and 2.8% in trm61Δ). Furthermore, analysis of bulk tRNA modifications revealed that m1A modification was less than 0.03% of the levels of cytidine in the trm6Δ mutant, compared to 2.5% for WT, whereas levels of Ψ were similar in both strains (16.8% vs 17.9%), as were levels of m5C, m2G, m7G, and inosine (I) (S2 Fig). These results show that S. pombe trm6 and trm61 are required for all detectable m1A58 modification of cytoplasmic tRNAs.

S. pombe trm6Δ mutants are temperature sensitive due to reduced levels of tRNAiMet(CAU)

Since the temperature sensitive growth defect of S. cerevisiae trm6-504 mutants is caused by decreased levels of tRNAiMet(CAU) [21], we analyzed levels of tRNAiMet(CAU) and other tRNAs in S. pombe trm6Δ mutants at low and high temperatures to determine if this property was conserved. We sampled cells grown in rich media in triplicate at 30°C and at 3-hour intervals after shift to 38.5°C, and analyzed tRNA levels by northern blot hybridization. We quantified tRNA levels by normalizing relative to tRNAGly(GCC) at the corresponding temperature and time point, and then relative to the normalized amount in WT cells at 30°C. Note that, as shown previously [15], levels of the usual standards 5S and 5.8S rRNA are significantly affected by temperature changes in S. pombe, and tRNAGly(GCC) levels were not affected in WT cells. Note also that in this and all other temperature shift experiments described in this report, cells were shown quantitatively to survive the temperature shift, based on spot tests of the cells on plates.

The northern analysis revealed that tRNAiMet(CAU) levels were substantially reduced in the S. pombe trm6Δ mutants, both at 30°C and 38.5°C. At 30°C, tRNAiMet(CAU) levels were 49% of those in WT cells, whereas each of the other eight tRNAs had levels between 82% and 121% of those in WT cells (Figs 2A, 2B and S3). At 38.5°C, tRNAiMet(CAU) levels decreased further in the trm6Δ mutants, to 30% of WT levels after 3 hours, whereas levels of each of the other 8 tRNAs ranged from 78% to 114% of WT levels. Furthermore, although tRNA levels generally decreased after longer times at 38.5°C, tRNAiMet(CAU) levels decreased the most, to 19% of those in WT after 9 hours, compared to 53% to 90% for the other eight tRNAs. These results indicate that S. pombe trm6Δ mutants are associated with reduced levels of tRNAiMet(CAU) at 30°C, and with further reduced tRNAiMet(CAU) levels at 38.5°C.

Fig 2

S. pombe trm6Δ temperature sensitivity is associated with reduced tRNAiMet(CAU) levels.

Strains were grown in YES media at 30°C, shifted to 38.5°C for 9 hours as described in Materials and Methods, and RNA was isolated at the indicated times, and analyzed by northern blotting, with probes as indicated. tMi(CAU), tRNAiMet(CAU); tF(GAA), tRNAPhe(GAA); tP(AGG), tRNAPro (AGG); tA(AGC), tRNAAla(AGC); tG(GCC), tRNAGly(GCC). The bar chart depicts relative levels of tRNA species at each temperature, relative to their levels in the WT strain at 30°C (each itself first normalized to levels of the control tG(GCC)). For each tRNA, the dark shade indicates 30°C, and progressively lighter shades indicate time points (3, 6, 9 hours) Standard deviations for each tRNA measurement are indicated. The statistical significance of tRNA levels was evaluated using a two-tailed Student’s t-test assuming equal variance. ns, not significant; *, p < 0.05; **, p < 0.01; ***, p < 0.001; ****, p<0.0001. tMi(CAU), blue; tF(GAA), green; tP(AGG), orange; tA(AGC), yellow. suppresses the ts growth defects of Strains with plasmids as indicated were grown overnight in EMMC-Leu media at 30°C and analyzed for growth as in Fig 1A on indicated plates and temperatures. restores tRNA levels in Strains containing plasmids as indicated were grown in EMMC-Leu at 30°C and shifted to 38.5°C for 8 hours as described in Materials and Methods, and RNA from cells grown at 38.5°C was isolated and analyzed by northern blotting as in Fig 2A. . tRNA levels were quantified as in Fig 2B.

To test if the temperature sensitivity of S. pombe trm6Δ mutants is caused by decreased levels of tRNAiMet(CAU), we examined suppression of the trm6Δ growth defect upon tRNAiMet(CAU) overexpression. In S. pombe, only one of the four genes encoding tRNAiMet(CAU) is expressed in the usual manner, as a stand-alone tRNA gene. By contrast, the other three tRNAiMet(CAU) genes are expressed in tandem with a tRNASer species as a tRNASer-tRNAiMet dimeric transcript, which is then processed into single tRNAs [42], similar to the tRNAArg-tRNAAsp tandem genes in S. cerevisiae [43, 44]. To test for suppression of the trm6Δ growth defect, we overexpressed either the stand-alone SPBTRNAMET.06 (imt06) gene, or the tandem tRNASer-tRNAiMet gene pair with sup9 and SPCTRNAMET.07 (imt07), each on a [leu2] plasmid. We found that the temperature sensitive growth defect of S. pombe trm6Δ mutants on EMMC-leu media was completely suppressed by expression of the stand-alone imt06 gene, growing identically to that of an S. pombe trm6Δ [P trm6] strain at high temperature (Fig 2C), whereas expression of imt07 from the tRNASer-tRNAiMet tandem gene only modestly suppressed the trm6Δ temperature sensitivity. Consistent with this result, northern analysis showed that levels of tRNAiMet(CAU) are much higher in strains overexpressing imt06 than in strains overexpressing imt07 (S4 Fig). Similarly, the temperature sensitivity of the S. pombe trm61Δ strain was completely suppressed by expression of the stand-alone imt06 gene (S5 Fig). As expected, northern analysis showed that trm6Δ strains expressing [imt06 leu2] had substantially more tRNAiMet(CAU) than the trm6Δ [leu2] vector control strains at 38.5°C (6.3 fold; relative levels of 1.51 vs 0.24) while the levels of other tested tRNAs remained unchanged (Fig 2D and 2E). These results suggest strongly that the temperature sensitivity of S. pombe trm6Δ mutants is caused by the loss of tRNAiMet(CAU) and that this tRNA is the major physiologically important tRNA substrate of Trm6:Trm61 methyltransferase.

Mutations in the Rapid tRNA decay pathway restore growth and tRNAiMet(CAU) levels in S. pombe trm6Δ mutants

To identify potential mechanisms that contribute to the loss of tRNAiMet(CAU) in S. pombe trm6Δ mutants, we isolated and analyzed spontaneous suppressors of the temperature sensitivity. Among 25 temperature resistant suppressors from 14 cultures, we found three with increased levels of tRNAiMet(CAU) but not of a control tRNA, and whole genome sequencing revealed that two of these had mutations in dhp1 (dhp1-5 and dhp1-6) and one had a mutation in tol1 (tol1-1). dhp1 is the ortholog of S. cerevisiae RAT1, which encodes one of the two 5’-3’ exonucleases involved in RTD, and tol1 is the ortholog of S. cerevisiae MET22, deletion of which inhibits RTD by inhibiting 5’-3’ exonucleases [16-18].

Growth analysis on plates showed that the trm6Δ dhp1-5 and trm6Δ dhp1-6 mutants were nearly as healthy at high temperatures as the WT strain on both YES and EMMC-his media, whereas the trm6Δ tol1-1 mutant was slightly less healthy at higher temperatures (Fig 3A). Northern analysis of tRNA from strains grown at 30°C and after temperature shift to 38.5°C showed that the dhp1 and tol1 suppressors substantially restored tRNAiMet(CAU) levels at both high and low temperatures, without affecting any of a number of other tRNAs (Fig 3B and 3C). At 38.5°C, tRNAiMet(CAU) levels increased from 27% in trm6Δ strains (relative to WT at 30°C) to 55%, 45%, and 32% in the trm6Δ dhp1-5, trm6Δ dhp1-6, and trm6Δ tol1-1 mutants respectively, with no significant change in the levels of tRNAPhe(GAA), tRNAPro(AGG), and tRNAAla(AGC) (Fig 3B and 3C). This increase in tRNAiMet(CAU) levels at 38.5°C accounts for the temperature resistance of the strains, and reflects the weaker suppression in the trm6Δ tol1-1 strain. At 30°C, tRNAiMet(CAU) levels also increased, from 53% of WT in the trm6Δ strains to 75%, 82%, and 82% in the trm6Δ dhp1-5, trm6Δ dhp1-6, and trm6Δ tol1-1 mutants, again with little change in the levels of other tRNAs. Thus, it appears that the observed decay is occurring at both temperatures.

Fig 3

Spontaneous suppressors of S. pombe trm6Δ mutants with mutations in dhp1 and tol1 restore growth and increase tRNAiMet(CAU) levels of S. pombe trm6Δ mutants.

Strains as indicated were grown overnight in YES media at 30°C and analyzed for growth as in Fig 1A on indicated plates and temperatures. levels after growth at 38.5°C. Strains were grown in YES media at 30°C and shifted to 38.5°C for 8 hours as described in Materials and Methods, and RNA was isolated and analyzed by northern blotting as in Fig 2A. tRNA levels were quantified as in Fig 2B, with dark and light shades as indicated for 30°C and 38.5°C.

Two lines of evidence suggest that the dhp1 mutations were responsible for the suppression in the trm6Δ dhp1 mutants. First, the isolation of two different dhp1 missense mutations in genetically independent suppressors argues strongly that the relevant suppressing mutation is that in dhp1. Whole genome sequencing typically results in only a few mutations, and finding two independent suppressors with different dhp1 mutations would be highly unlikely to occur by chance. Furthermore, like S. cerevisiae RAT1, dhp1 is an essential gene in S. pombe, and thus there are limited mutations that would reduce function without killing the cell. Indeed, alignments show that neither of the dhp1 mutations is completely conserved, although each is likely to be important; the S737P (dhp1-5) mutation is predicted to disrupt the central portion of an α-helix, and the Y669C (dhp1-6) mutation is within a highly conserved block of amino acids (S6A and S6B Fig). Second, complementation experiments showed that introduction of an additional chromosomal copy of dhp1 at ura4 restored the temperature sensitivity of the trm6Δ dhp1-5 mutant, to a level similar to that of a trm6Δ control strain. The increased gene dosage of dhp1 had no effect on growth of the WT strain, and a barely detectable inhibitory effect on growth of the trm6Δ strain (S6C Fig), which we attribute to the 2-fold overproduction of Dhp1 and the presumed sensitivity of the trm6Δ strain to any further reduction in tRNAiMet(CAU) levels. We therefore conclude that the isolated dhp1 mutations were responsible for the suppression of the temperature sensitive growth defect of S. pombe trm6Δ mutants.

Similarly, we infer that the tol1-1 mutation is responsible for suppression because expression of P tol1 on a [leu2] plasmid restored temperature sensitivity to the trm6Δ tol1-1 strain, with no effect on growth of the trm6Δ or the WT strain (S7 Fig). The tol1-A151D (tol1-1) point mutation is located in a highly conserved region of the essential tol1 gene [45], presumably resulting in a partial loss of function variant (S8A and S8B Fig).

The discovery of dhp1 and tol1 mutations as suppressors of the S. pombe trm6Δ temperature sensitivity demonstrates the involvement of the RTD pathway in decay of tRNAiMet(CAU) lacking m1A58 in S. pombe. However, this result was unexpected, because it is well established in S. cerevisiae that trm6 mutants trigger decay of pre-tRNAiMet(CAU) by the nuclear surveillance pathway in vivo [13, 22, 24, 46] and in vitro [47].

The exacerbated growth defect of an S. pombe trm6Δ imt06Δ mutant is due to further reduction in tRNAiMet(CAU) levels, and suppressors of the growth defect are in the RTD pathway

To obtain a more robust set of suppressors of the trm6Δ temperature sensitivity, we further reduced tRNAiMet(CAU) levels in the trm6Δ mutants by introduction of an imt06Δ mutation, decreasing the number of tRNAiMet(CAU) genes from four to three. As anticipated, the resulting trm6Δ imt06Δ strain grew very poorly at 30°C, and was temperature sensitive at higher temperatures, not growing at all at 37°C, whereas the imt06Δ mutant had no growth defect at any tested temperature (Figs 4A and S9A). Moreover, the trm6Δ imt06Δ growth defect was strictly due to the loss of tRNAiMet(CAU) because the trm6Δ imt06Δ strains expressing both an integrated copy of imt06 and a [leu2 imt06] plasmid grew as well as WT on YES media at all temperatures up to 39°C (S9B Fig). As anticipated, tRNAiMet(CAU) levels in the trm6Δ imt06Δ strain at 30°C were substantially reduced from those in the trm6Δ mutants (40% vs 70% of WT), consistent with the 44% reduction in tRNAiMet(CAU) levels in the imt06Δ strains (Figs 4B and S9C). As also expected, the levels of other tested tRNAs in these strains were virtually unaffected. These results show a prominent synthetic growth defect in the S. pombe trm6Δ imt06Δ strain, due only to reduced levels of tRNAiMet(CAU).

Fig 4

Deletion of one of the four S. pombe genes encoding tRNAiMet(CAU) in an S. pombe trm6Δ mutant exacerbates its growth defect and further reduces tRNAiMet(CAU) levels.

gene encoding tRNA in an Strains were grown overnight in YES media at 30°C and analyzed for growth as in Fig 1A on indicated plates and temperatures for 4 days. levels in tRNA levels were quantified as in Fig 2B.

Analysis of spontaneous suppressors of the severe growth defect of trm6Δ imt06Δ mutants revealed additional mutations in the RTD pathway. Of fifteen suppressors isolated from six independent cultures of trm6Δ imt06Δ strains after plating on YES media at 35°C, eleven had increased tRNAiMet(CAU) levels at both 30°C and 38.5°C, relative to a control tRNA, and whole genome sequencing of nine of these eleven suppressors revealed eight with dhp1 mutations (six alleles; dhp1-7 to dhp1-12), and one with a tol1 mutation (tol1-2). All six new dhp1 mutations and the tol1-2 mutation were in conserved regions of the respective proteins (S10 Fig). Growth comparisons showed that the dhp1-7, dhp1-8, and tol1-2 mutations each efficiently rescued the trm6Δ imt06Δ growth defect at 35°C, with the trm6Δ imt06Δ tol1-2 strain growing almost as well as the original trm6Δ strain at 37°C (Fig 5A). Moreover, the growth phenotype of the trm6Δ imt06Δ tol1-2 mutant was fully complemented upon introduction of a [leu2 P tol1] plasmid (S11 Fig). Consistent with the growth suppression, tRNAiMet(CAU) levels were increased from 26% of WT in the trm6Δ imt06Δ mutant at 30°C to 49% and 55% in the corresponding dhp1-7 and the tol1-2 suppressors, and from 12% at 38.5°C to 35% and 34% in the suppressors, whereas control tRNA levels were largely unchanged at each temperature (Fig 5B and 5C).

Fig 5

Spontaneous suppressors of S. pombe trm6Δ imt06Δ mutants with mutations in dhp1 and tol1 restore growth and increase tRNAiMet(CAU) levels.

Strains were grown overnight in YES media at 30°C and analyzed for growth as in Fig 1A on indicated plates and temperatures. levels at low and high temperatures. Strains were grown in YES media at 30°C and shifted to 38.5°C for 6 hours as described in Materials and Methods, and RNA was isolated and analyzed by northern blotting as in Fig 2A. levels in tRNA levels were quantified as in Fig 2B.

These findings underscore the crucial role of Dhp1 and Tol1, and thus of the RTD pathway, in quality control of tRNAiMet(CAU) in S. pombe trm6Δ mutants. Indeed, the isolation of eight genetically distinct dhp1/rat1 alleles (two in trm6Δ mutants and six in trm6Δ imt06Δ mutants) and two distinct tol1/met22 alleles (one each in the trm6Δ mutant and the trm6Δ imt06Δ mutant) argues that the genetic landscape of trm6Δ suppressors has been nearly saturated, particularly considering that both dhp1 and tol1 are essential in S. pombe.

Further examination suggests the lack of participation of the Trf4 ortholog Cid14 of the nuclear surveillance pathway [48-50] in quality control of tRNAiMet(CAU) in S. pombe trm6Δ mutants. A cid14Δ mutation was introduced into WT and trm6Δ strains and independent isolates were confirmed by PCR (Materials and Methods), after which the resulting strains were shown to be sensitive to 5-fluorouracil (5-FU) (S12A and S12B Fig), as previously reported [48, 51]. We observed little, if any, suppression of the trm6Δ growth defect in the trm6Δ cid14Δ strains (S13A Fig), and only very minor restoration of tRNAiMet(CAU) levels at high temperature, relative to levels in trm6Δ mutants (21% vs 18%, compared to 39% in the trm6Δ dhp1-5 strain) (S13B and S13C Fig). Thus, we infer that tRNAiMet(CAU) is degraded in S. pombe trm6Δ and trm6Δ imt06Δ mutants primarily by the RTD pathway, and not appreciably by the TRAMP complex of the nuclear surveillance pathway.

A met22Δ mutation substantially suppresses the S. cerevisiae trm6-504 temperature sensitivity and partially restores tRNAiMet(CAU) levels at low and high temperatures

Because of our discovery of the predominant role of the RTD pathway in tRNAiMet(CAU) quality control in S. pombe trm6Δ mutants, we examined the participation of the RTD pathway in tRNAiMet(CAU) quality control in the well-studied S. cerevisiae trm6-504 mutant, which had previously been shown to trigger tRNAiMet(CAU) decay by the nuclear surveillance pathway [13, 22, 23]. We found that deletion of MET22 substantially suppressed the temperature sensitive growth defect of an S. cerevisiae trm6-504 mutant, both in its original background (Y190) and in the BY4741 (BY) background, with obvious suppression at 36°C in both backgrounds and at 37°C in the BY background (Fig 6A). Consistent with the growth suppression, tRNAiMet(CAU) levels were increased from 12% of WT in the BY trm6-504 strain to 35% in the met22Δ derivative at 34°C, and from 38% to 54% at 27°C, with little effect on other tested tRNAs (Fig 6B and 6C). Similar restoration of tRNAiMet(CAU) levels was observed in the met22Δ derivative of the original Y190 trm6-504 strain, with no effect on other tested tRNAs (S14 Fig). These results show that MET22 regulates tRNAiMet(CAU) levels in trm6-504 strains regardless of their genetic background and suggest the involvement of the RTD pathway in tRNAiMet(CAU) quality control in S. cerevisiae trm6-504 mutants.

Fig 6

The temperature sensitivity and reduced tRNAiMet(CAU) levels in S. cerevisiae trm6-504 mutants are suppressed by a met22Δ mutation.

Strains were grown overnight in YPD media at 30°C and analyzed for growth on indicated plates and temperatures. BY; standard BY4741 WT strain background; Y190, background of original trm6-504 mutant levels in Strains were grown in YPD media at 27°C and shifted to 34°C for 8 hours as described in Materials and Methods, and RNA was isolated and analyzed by northern blotting. levels in tRNA levels were quantified as in Fig 2B. m, trm6-504 mutant.

Each of the RTD pathway exonucleases has a significant role in tRNAiMet(CAU) quality control in S. cerevisiae BY trm6-504 mutants

Although the restoration of growth and tRNAiMet(CAU) levels in a BY trm6-504 met22Δ mutant suggested the involvement of the RTD pathway, we sought to provide additional evidence by directly testing the roles of the RTD pathway exonucleases Rat1 and Xrn1 in tRNAiMet(CAU) quality control in the trm6-504 mutant. As Rat1 is essential [52], we tested the role of Rat1 using the rat1-107 mutation, which we had previously isolated as a suppressor of RTD in trm8Δ trm4Δ mutants [16].

We found that mutation of each of the RTD exonucleases efficiently suppressed both the temperature sensitivity and the reduced tRNAiMet(CAU) levels of the BY trm6-504 mutant. Whereas the trm6-504 mutant was impaired for growth at 33°C and above, the trm6-504 rat1-107 strain had healthy growth at 37°C and visible growth at 39°C, which was similar to that of the trm6-504 met22Δ strain, and the trm6-504 xrn1Δ strain grew up to 37°C (Fig 7A), despite the known growth defect of xrn1Δ mutants [16]. This growth suppression by mutation of each RTD component was nearly as efficient as that due to mutation of the nuclear surveillance components RRP6 or TRF4 (Fig 7A) [13]. Moreover, consistent with the suppression results, the temperature dependent decay of tRNAiMet(CAU) in trm6-504 mutants was efficiently suppressed by mutation of RTD components. Thus, after 6-hour temperature shift to 34°C, relative tRNAiMet(CAU) levels in trm6-504 mutants were restored from 16% to 32%, 67%, and 32% by met22Δ, xrn1Δ, and rat1-107 mutations respectively, comparable to the 52% observed in a trm6-504 trf4Δ mutant (Fig 7B and 7C). Significant suppression of tRNAiMet(CAU) levels was also found at 27°C. A parsimonious interpretation of these results is that all components of the RTD pathway are involved in tRNAiMet(CAU) quality control in trm6-504 mutants, and that the nuclear surveillance pathway and RTD pathway each contribute substantially to this tRNAiMet(CAU) quality control.

Fig 7

The RTD and nuclear surveillance pathways are each involved in tRNAiMet(CAU) quality control in S. cerevisiae trm6-504 mutants.

Strains were grown overnight in YPD media at 30°C and analyzed for growth on indicated plates and temperatures. levels are substantially restored in Strains were grown in YPD at 27°C and shifted to 34°C for 6 hours as described in Materials and Methods, and RNA was isolated and analyzed by northern blotting. levels in Dark and light colors indicate growth at 27°C and 34°C.

tRNAiMet(CAU) in S. cerevisiae trm6-504 mutants and suppressors is fully modified to m1A58 at both low and high temperatures

As trm6-504 mutants are known to have reduced, but not absent, m1A modification levels [13], we wanted to determine if m1A levels were altered in tRNAiMet(CAU) as a result of the temperature shift in trm6-504 mutants. By using poison primer extension to measure m1A58 modification, we found that A58 of tRNAiMet(CAU) was nearly fully modified at both 27°C and 34°C in both trm6-504 mutants (96% and 94%) and WT strains (98% and 97%) (S15 Fig), although tRNAiMet(CAU) levels are reduced in trm6-504 mutants. By contrast, A58 of tRNAPhe(GAA) was substantially hypomodified at low temperature in trm6-504 mutants compared to WT strains (25% vs 83%), and also at high temperature (27% vs 68%) (S15 Fig). As tRNAiMet(CAU) is 96% modified at low temperature and present at 39% of WT levels, whereas tRNAPhe(GAA) is 25% modified and present at 97% of WT levels, these findings suggest that tRNAiMet(CAU) is the preferred substrate of Trm6:Trm61. In addition, comparison of the tRNAPhe(GAA) modification levels in trm6-504 mutants at low and high temperature suggests that there is little or no temperature-dependent reduction in the Trm6:Trm61 methyltransferase activity.

To further assess the connection between m1A58 modification and tRNA decay, we measured m1A levels in tRNAiMet(CAU) in trm6-504 strains with mutations in the nuclear surveillance or the RTD pathway. We found that tRNAiMet(CAU) was still nearly fully modified to m1A58 at 34°C in trm6-504 mutants with suppressing mutations in any of the components of the RTD pathway (met22Δ, rat1-107 or xrn1Δ) or the nuclear surveillance pathway (trf4Δ or rrp6Δ), with modification levels ranging from 92.6% to 95.2%, compared to 97.6% in WT cells (S16A and S16C Fig). As anticipated, A58 modification of tRNAPhe(GAA) was similarly reduced in trm6-504 mutants and in derivatives with suppressing mutations in the RTD or nuclear surveillance pathway, compared to WT cells (S16B and S16C Fig). Thus, although tRNAiMet(CAU) decay at 34°C is inhibited in trm6-504 strains with mutations in the nuclear surveillance or the RTD pathway, the nearly complete modification of the remaining, undegraded tRNAiMet(CAU) in all of these trm6-504 derivative strains argues for competition between the Trm6:Trm61 enzyme and the decay pathways.

The lethality of S. cerevisiae trm6Δ mutants is suppressed by mutation of both the RTD and the nuclear surveillance pathways, but not either one alone

To separate the effects of the decay pathways from the presumed competition with Trm6:Trm61, we determined if the lethality of S. cerevisiae trm6Δ mutants could be rescued by inhibition of either or both of the RTD and nuclear surveillance pathways. As previously shown, the S. cerevisiae trm6Δ lethality is due to lack of tRNAiMet(CAU) [21], as a trm6Δ [TRM6 URA3] [2μ IMT1 LEU2] strain was healthy when the URA3 plasmid was selected against on media containing 5-FOA, but the corresponding strain with a [2μ LEU2] vector died (S17 Fig). We found that deletion of both MET22 and TRF4 suppressed the lethality of the S. cerevisiae trm6Δ mutant on 5-FOA-containing media at 30°C and 33°C, but neither single deletion could rescue the lethality of the trm6Δ mutant alone (Fig 8A and 8B). Thus, we conclude that both the RTD pathway and the nuclear surveillance pathway significantly contribute to tRNAiMet(CAU) quality control in mutants lacking m1A58 modification. As tRNAiMet(CAU) levels in trm6Δ met22Δ trf4Δ strains were only 48% of WT levels, comparable to the tRNAiMet(CAU) levels in trm6-504 mutants and somewhat less than tRNAiMet(CAU) levels in mutants lacking one of the four IMT genes (Fig 8C and 8D), we infer that tRNAiMet(CAU) lacking m1A58 modification is still being degraded in this strain.

Fig 8

The lethality of an S. cerevisiae trm6Δ mutant is suppressed by deletion of both MET22 and TRF4, but not by either deletion alone, and results in modest tRNAiMet(CAU) levels.

Strains were grown overnight in YPD media at 30°C, diluted to OD600~3, serially diluted 10-fold in water, and 2 μL were spotted onto YPD or 5-FOA plates as indicated, and grown for 4 days. Strains were grown overnight in YPD media at 30°C, and then 2 μl of each of the cultures was streaked on 5-FOA plates for single colonies, and then incubated at 30°C for 7 days. in Strains were grown in YPD at 30°C for 6 hours as described in Materials and Methods, and RNA was isolated and analyzed by northern blotting. levels in tRNA levels were quantified as in Fig 2B.

Discussion

We have provided strong evidence that the rapid tRNA decay pathway has a major role in decay of tRNAiMet(CAU) lacking m1A58 in both S. pombe and S. cerevisiae. In S. pombe, dhp1 and tol1 mutations in the RTD pathway suppress the temperature sensitivity and decay of tRNAiMet(CAU) in trm6Δ and trm6Δ imt06Δ mutants. In S. cerevisiae, met22, rat1, and xrn1 mutations in the RTD pathway suppress the temperature sensitivity and tRNAiMet(CAU) decay in trm6-504 mutants, and a met22Δ mutation is required, together with a trf4Δ mutation in the nuclear surveillance pathway, to restore viability of S. cerevisiae trm6Δ mutants.

The finding that reduced tRNAiMet(CAU) levels are the cause of the defect in both S. pombe and S. cerevisiae trm6 mutants lacking m1A58 is consistent with the unique structural properties of eukaryotic tRNAiMet(CAU) in the D-loop and the T-loop. In this region, eukaryotic initiator tRNA differs from that of canonical elongator tRNAs in the absence of N17, the replacement of canonical residues with A20, A54, and A60, and a unique substructure involving these residues and m1A58, as well as G57 and A59 [26, 53]. As Trm6:Trm61 are conserved in eukaryotes [38, 54], we infer that tRNAiMet(CAU) levels will be similarly subject to decay in other eukaryotes lacking m1A58.

These findings establish that the RTD pathway acts on all body modification mutants that have been shown to result in decay of tRNAs in fungi, including S. cerevisiae mutants lacking m7G46, ac4C12, or m2,2G26, particularly in combination with other body modification mutants [16, 20], S. pombe mutants lacking m7G46 [15], and now mutants lacking m1A58 in both organisms. This set of results suggests that the RTD pathway will mediate decay of other body modification mutants in S. pombe and S. cerevisiae. Furthermore, as S. cerevisiae and S. pombe diverged about 600 Mya [39], these findings suggest that body modification mutants in other eukaryotes will also undergo decay by the RTD pathway. In support of this suggestion, we note that Rat1/Dhp1, Met22/Tol1, and Xrn1 of the RTD pathway are all conserved in eukaryotes [55, 56], and that WT HeLa cells (without a modification defect) that are incubated at 43°C undergo decay of tRNAiMet(CAU) by Rat1 and Xrn1 [35]. As a subset of hypomodified tRNAs are known to be reduced in mammalian cells lacking m7G46 [57, 58] or m5C [59], it is likely that tRNA decay is occurring in these cells, and based on our results, we speculate that this decay is due to the RTD pathway.

It was surprising to find that the decay of tRNAiMet(CAU) in S. pombe trm6Δ mutants was not due to the nuclear surveillance pathway, because of its well established role in decay of tRNAiMet(CAU) in S. cerevisiae trm6-504 mutants [13, 22, 23]. We argued above that in S. pombe, tRNAiMet(CAU) lacking m1A58 is primarily degraded by the RTD pathway, because we had essentially saturated the genetic landscape of suppressors of S. pombe trm6Δ or trm6Δ imt06Δ strains with mutations in dhp1 or tol1 of the RTD pathway, and because a cid14Δ mutation in the nuclear surveillance pathway did not restore growth or tRNAiMet(CAU) levels to an S. pombe trm6Δ mutant. It is known that the other components of the nuclear surveillance pathway are present and functional in S. pombe [48, 49, 60, 61]. It is possible that the lack of participation of the nuclear surveillance pathway in decay of tRNAiMet(CAU) in S. pombe trm6Δ mutants is due in some way to the structure of three of the four tRNAiMet(CAU) genes, each of which is present as a dimeric tRNA gene, and expressed as a tandem tRNASer- tRNAiMet transcript that is then processed into individual tRNAs [42]. Alternatively, it is possible that the lack of participation of the nuclear surveillance pathway in S. pombe trm6Δ mutants is due to some, as yet unappreciated, difference in the structure or folding between S. pombe and S. cerevisiae tRNAiMet(CAU), or to differences in the activity of the nuclear surveillance pathway.

Our finding that dhp1 and tol1 mutations significantly restore tRNAiMet(CAU) levels at 30°C and 38.5°C in S. pombe trm6Δ and trm6Δ imt06Δ mutants underscores that the RTD pathway is active at all temperatures in S. pombe, as we also found in S. cerevisiae trm6-504 mutants, and previously found in S. cerevisiae mutants lacking m7G46 and m5C [16] and in fully modified variants of tRNATyr [62]. The relatively healthy growth of S. pombe trm6Δ mutants and the poor growth of trm6Δ imt06Δ mutants at 30°C, with tRNAiMet(CAU) levels at ~50% and 26% of WT respectively, is consistent with prior results that S. cerevisiae strains are healthy with three of four tRNAiMet(CAU) genes, generally grow slowly with two of four genes, and can survive with as little as 40% of WT fully modified tRNAiMet(CAU) [63, 64].

Our results provide evidence that the nuclear surveillance and the RTD pathways in S. cerevisiae are in competition with the Trm6:Trm61 m1A methyltransferase, as tRNAiMet(CAU) was fully modified in S. cerevisiae trm6-504 mutants at both 27°C and 34°C, and inhibition of either decay pathway resulted in more tRNAiMet(CAU) that was fully modified. Moreover, as Trm6:Trm61 is a nuclear enzyme [21], and Xrn1 is cytoplasmic [65], the increased levels of fully modified tRNAiMet(CAU) in trm6-504 xrn1Δ mutants argues that unmodified tRNAiMet(CAU) is not immediately degraded, but rather that tRNAiMet(CAU) goes to the cytoplasm without m1A and returns to the nucleus for another chance at m1A modification by Trm6:Trm61. This second chance for m1A modification is analogous to the second chance pathway suggested earlier for tRNAs lacking m2,2G26 [66].

Our finding that tRNAPhe(GAA) in S. cerevisiae trm6-504 mutants had very similar m1A58 modification at both 27°C and 34°C suggests that Trm6:Trm61 is not temperature sensitive in this strain. If so, the reduced tRNAiMet(CAU) levels at high temperature in trm6-504 mutants would imply that tRNAiMet(CAU) lacking m1A58 is itself temperature sensitive, perhaps becoming partially unfolded at high temperature. One could envision a model in which tRNAiMet(CAU) lacking m1A58 is functioning in the cell cytoplasm (consistent with the viability of S. pombe trm6Δ mutants and of S. cerevisiae trm6Δ trf4Δ met22Δ mutants), but is in equilibrium with a state in which the tertiary structure is partially or completely unfolded due to lack of the modification [21, 26]. As tertiary structure unfolding precedes unfolding of the individual helices of tRNA [67], the disrupted tertiary structure due to lack of m1A58 could lead to unfolding of the acceptor stem and increased availability of the 5’ end to the RTD pathway. This model is very similar to that we proposed previously to explain the increased Xrn1 susceptibility of S. cerevisiae tRNASer(CGA) lacking ac4C12 and Um44 and for tRNAVal(AAC) lacking m7G46 and m5C49 [68], and could be tested in subsequent experiments.

Materials and methods

Yeast strains

All S. pombe and S. cerevisiae strains with integrated markers that are described in this work were made in biological triplicate. S. pombe strains are shown in S1 Table. S. pombe trm6Δ::KanMX strains were constructed in the S. pombe WT strain derived from SP286 (ade6-M210/ade6-M216, leu1-32/leu1-32, ura4-D18/ura4-D18 h+/h+) by PCR amplification of the trm6Δ::kanMX cassette from the S. pombe trm6Δ::kanMX strain of the genomic knockout collection [40], followed by linear transformation using lithium acetate [69], and PCR screening of transformants for the presence of the deletion. Other S. pombe deletion strains were made similarly, but the DNA containing the drug marker (KanMX or HygR) was obtained by Gibson assembly of ~ 500 nt 5’ of the target site, the drug marker, and ~ 500 nt 3’ of the target site [70]. The dhp1 and imt06 genes were integrated at the chromosomal ura4-D18 locus using a single ura4integrating vector containing the corresponding gene under its promoter [71]. S. cerevisiae deletion strains are shown in S2 Table, and were constructed by linear transformation with PCR amplified DNA from the appropriate knockout strain, followed by PCR amplification to confirm the knockout.

The S. cerevisiae trm6-504 mutant strain was obtained in two ways. We obtained the original trm6-504 (Y200) and its WT parent (Y190) from Dr. James Anderson. The BY trm6-504 strain was reconstructed essentially as previously described [72], with three DNA components constructed in a plasmid vector: first, nt 893–1434 of the TRM6 coding sequence (containing the C1292G mutation of the trm6-504 mutant) and 204 nt of the 3’ UTR; second, K. lactis URA5; third, nt 1384–1434 of the TRM6 coding region. The DNA construct was removed from the vector, transformed into S. cerevisiae WT cells by linear transformation, confirmed by PCR, and then strains were plated onto media containing 5-FOA to select for Ura- cells obtained by homologous recombination, which were sequence verified.

Plasmids

Plasmids used in this study are listed in S3 Table. The S. pombe plasmid expressing S. pombe P trm6, S. pombe P trm61, and P tol1 contained ~ 1000 bp and 500 bp of flanking 5’ and 3’ DNA and were cloned into a pREP3X-derived plasmid, removing the P promoter, as described [15]. Plasmids expressing S. pombe tRNA genes contained ~ 300 bp of flanking 5’ and 3’ DNA. The S. pombe ura4 single integrating vectors [71] expressing imt06 or P dhp1 were constructed similarly.

Yeast media and growth conditions

S. pombe strains were grown in rich (YES) media or Edinburgh minimal complete (EMMC) media, or corresponding dropout media, as described [15]. For temperature shift experiments, cells were grown in YES or EMMC-leu media at 30°C to OD600 ~ 0.5, and then diluted to OD600 0.1 in pre-warmed media at the desired temperature, and grown to OD600 ~ 0.5, and then aliquots were chilled, harvested at 4°C, washed with ice cold water, frozen on dry ice, and stored at -80°C. S. cerevisiae strains were grown in rich (YPD) media or minimal complete (SDC) media as described [15], and temperature shift experiments were performed as described for S. pombe. All experiments with measurements were performed in biological triplicate.

Spontaneous suppressor isolation

Spontaneous suppressors of S. pombe trm6Δ and trm6Δ imt06Δ mutants were isolated by growing cultures of individual colonies in YES media at 30°C, followed by plating 107 cells on YES and EMMC plates at 39°C (for trm6Δ mutants) and on YES plates at 35°C (for trm6Δ imt06Δ mutants).

Bulk RNA preparation and northern blot analysis

For northern analysis, biological triplicates were grown in parallel, aliquots of 3–5 OD were harvested, and then bulk RNA was prepared with glass beads and phenol as described [73], resolved on a 10% polyacrylamide (19:1), 7M urea, 1X TBE gel, transferred to Amersham Hybond-N+ membrane (Cytiva, Marlborough, MA cat# RPN303B), and hybridized with 5’ 32P-labeled DNA probes (S4 Table) as described [14], followed by exposure and imaging on an Amersham Typhoon phosphorimager (Cytiva, Marlborough, MA), and quantification using Image Quant v5.2

Isolation and purification of bulk tRNA

S. pombe WT and trm6Δ mutant strains were grown to ~ 0.5 OD in YES media at 30°C, and then bulk low molecular weight RNA was extracted from ~ 300 OD of pellets by using hot phenol [74], and resolved on an 8% polyacrylamide (19:1) 7M urea, 1X TBE gel to purify bulk tRNA by elution of tRNA from the excised gel slice.

Isolation and purification of tRNATyr(GUA)

tRNATyr(GUA) was purified from S. pombe WT strains, and trm6Δ and trm61Δ mutant strains using 1 mg of bulk RNA (prepared using hot phenol), and the 5’-biotinylated oligonucleotide (TDZ 365; tY(GUA) 76–64; 5’ TGGTCTCCTGAGCCAGAATCGAACTA 3’), as described [74].

HPLC analysis of nucleosides

Purified tRNATyr(GUA) (~ 1.25 μg) was digested to nucleosides by treatment with P1 nuclease, followed by phosphatase, as described [74], and nucleosides were analyzed by HPLC (Waters, Millford, MA) at pH 7.0 as described [75]. To quantify nucleosides in bulk tRNA, relative amounts of modified nucleosides were compared to cytidine.

Poison primer extension assays

Oligomers used for primer extension are shown in S5 Table. Primers were 5’-end labeled essentially as described [74], with excess label removed using a MicroSpin G-25 chromatography column (Cytiva, Marlborough, MA cat#27532501), and poison primer extension was done as described [76], in 10 μL reactions containing 2 U AMV reverse transcriptase (Promega, Madison, WI cat# M5101), 1X AMV RT buffer, 1 mM ddNTP, and 1 mM of the other three dNTPs. Following extension for 1 h at 50°C, aliquots were resolved on a 15% polyacrylamide gel (29:1) containing 7 M urea in 1× TBE, and the gel was dried on a Model 583 Biorad gel dryer, exposed and analyzed on an Amersham Typhoon phosphorimager, and quantified using Image Quant v5.2.

Whole genome sequencing

Whole genome sequencing was performed by the University of Rochester Genomics Center at 25–50 fold coverage of the genome, and reads were compared to the corresponding parent strain, and to the reference genome.

The temperature sensitivity of S. pombe trm6Δ and trm61Δ mutants is complemented by expression of the corresponding gene.

] on EMMC-leu media. WT and trm6Δ cells expressing P trm6+ were grown overnight in EMMC-leu media 30°C and analyzed for growth at the indicated temperatures. ] on EMMC-leu media. WT and trm61Δ cells expressing P trm61+ were grown overnight in EMMC-leu media 30°C and analyzed for growth.

(PDF)

Click here for additional data file.

S. pombe trm6Δ mutants lack m1A in their bulk tRNA.

A. S. pombe trm6Δ mutants and WT cells were grown in biological triplicate in YES media at 30°C and bulk tRNA was purified, digested to nucleosides, and analyzed for modifications by HPLC as described in Materials and Methods. of eluted nucleosides of bulk tRNA. (. The bar chart depicts the average moles/mol of nucleosides (expressed as a percentage of the moles of cytidine), with associated standard deviation; WT, gray; S. pombe trm6Δ, red. The data is also tabulated in the table below (.

(PDF)

Click here for additional data file.

Northern analysis of all tested tRNAs in S. pombe trm6Δ and WT cells after shift from 30°C to 38.5°C.

(A) Northern blot. Full analysis is shown of tRNAs analyzed in the northern blot shown in Fig 2A. The bar chart depicts relative levels of tRNA species at each temperature, relative to their levels in WT at 30°C.

(PDF)

Click here for additional data file.

Northern analysis of tRNAiMet(CAU) levels in WT and trm6Δ strains expressing imt06 or sup9-imt07 from a [LEU2] plasmid.

(A) Northern blot. Strains were grown and analyzed as in Fig 2D. (B) Quantification of tRNA levels. tRNA levels were quantified as in Fig 2B.

(PDF)

Click here for additional data file.

Overproduction of tRNAiMet(CAU) suppresses the temperature sensitive growth defects of S. pombe trm61Δ mutants.

Strains with plasmids as indicated were grown overnight in EMMC-Leu media at 30°C and analyzed for growth as in Fig 1A on indicated plates and temperatures.

(PDF)

Click here for additional data file.

The dhp1-5 and dhp1-6 mutations that suppress the S. pombe trm6Δ growth defect disrupt conserved regions or structures of Dhp1.

S. pombe Dhp1 was aligned with putative Rat1/Dhp1 orthologs from 12 evolutionarily distinct eukaryotes, using Multalin [77]; http://multalin.toulouse.inra.fr/multalin/). red, more than 80% conservation; blue 40% - 80% conservation. magenta, residues in the catalytic center; blue, residues interacting with Rai1. WT, trm6Δ, and trm6Δ dhp1-5 cells expressing a chromosomally integrated copy of P dhp1+ in the ura4+ locus or the control vector integrant, were grown overnight in YES media at 30°C, and analyzed for growth.

(PDF)

Click here for additional data file.

The suppression of the S. pombe trm6Δ growth defect by a tol1-1 mutation is complemented by expression of tol1 on a [P tol1 leu2] plasmid.

trm6Δ tol1-1 mutants, trm6Δ mutants and WT strains were transformed with either [P tol1 leu2] or empty vector, grown in EMMC-leu, and spotted.

(PDF)

Click here for additional data file.

The isolated tol1-1 mutation that restores growth of an S. pombe trm6Δ mutant is in a conserved region of the protein.

S. pombe Tol1 was aligned with putative Tol1 orthologs from 12 evolutionarily distinct eukaryotes, as in S5 Fig. red, more than 80% conservation; blue 40% - 80% conservation. orange, active site residues.

(PDF)

Click here for additional data file.

in an Strains from the growth test in Fig 4A are shown after 2 days of growth ] plasmid. trm6Δ imt06Δ and WT cells expressing tRNAiMet(CAU) from a chromosomally integrated copy of imt06+ and from a [leu2 imt06+] plasmid, and controls were grown overnight in EMMC or EMMC-leu media at 30°C, and analyzed for growth. are significantly reduced in The Northern blot from Fig 4B is shown.

(PDF)

Click here for additional data file.

Suppressor mutations isolated in S. pombe trm6Δ imt06Δ strains are in conserved regions of Dhp1 and Tol1. (A) Alignment of regions around the dhp1 suppressor mutations.

The alignment of S. pombe Dhp1 was done as in S5A Fig. magenta, residues in the catalytic center; blue, residues interacting with Rai1. The alignment of S. pombe Tol1 was done as in S7 Fig. orange, active site residues.

(PDF)

Click here for additional data file.

Expression of [P tol1 leu2] fully complements the S. pombe trm6Δ imt06Δ tol1-2 mutants.

WT, trm6Δ imt06Δ, and trm6Δ imt06Δ tol1-2 cells expressing P tol1+ or a vector [80] were grown overnight in EMMC-Leu media at 30°C, and analyzed for growth

(PDF)

Click here for additional data file.

A cid14Δ mutation causes 5-FU sensitivity in S. pombe WT and trm6Δ strains.

Strains were grown overnight in YES media at 30°C and analyzed for growth as in Fig 1A on indicated plates and temperatures. Strains were grown overnight in EMMC-Leu media at 30°C and analyzed for growth on indicated plates and temperatures.

(PDF)

Click here for additional data file.

A cid14Δ mutation does not suppress the growth defect of S. pombe trm6Δ mutants and has only a minimal effect on tRNAiMet(CAU) levels.

Strains were grown overnight in YES media at 30°C and analyzed for growth as in Fig 1A on indicated plates and temperatures. levels in

(PDF)

Click here for additional data file.

A met22Δ mutation partially restores tRNAiMet(CAU) levels in S. cerevisiae Y190 trm6-504 mutants.

Strains were grown in YPD at 27°C and shifted to 33°C for 6 hours as described in Materials and Methods, and RNA was isolated and analyzed by northern blotting. B; standard BY4741 WT strain background; Y, Y190 background of original trm6-504 mutant; m, trm6-504 mutant.

(PDF)

Click here for additional data file.

In S. cerevisiae trm6-504 mutants, tRNAiMet(CAU) is fully modified to m1A58 at 27°C and 34°C, while tRNAPhe(GAA) is hypomodified to a similar extent at both temperatures.

A modification in tRNA and tRNA. Bulk RNA from S. cerevisiae trm6-504 mutants and WT cells grown for Fig 7B was analyzed by poison primer extension assay, as described in Materials and Methods, with the P1 primer (complementary to tRNAiMet(CAU) nt 76–61) and P2 primer (complementary to tRNAPhe(GAA) 76–60) in the presence of ddCTP, producing a stop at G57 for both tRNAiMet(CAU) and tRNAPhe(GAA), and a stop at N59 for m1A58. Values were calculated by first subtracting background levels, as in Fig 1E.

(PDF)

Click here for additional data file.

In S. cerevisiae trm6-504 mutants grown at 34°C, tRNAiMet(CAU) is fully modified to m1A58 in derivatives with mutations in the RTD and nuclear surveillance pathways.

A modification in tRNA. Bulk RNA from the growth done for Fig 7B was analyzed by poison primer extension assay with the P1 primer in the presence of ddATP, producing a stop at U55 or at A59 for m1A58. A modification in tRNA. Bulk RNA from the growth done for Fig 7B was analyzed by poison primer extension assay with the P2 primer in the presence of ddCTP, producing a stop at G57 and for m1A58 at U59.

(PDF)

Click here for additional data file.

Overexpression of S. cerevisiae IMT1 fully suppresses trm6Δ mutant lethality.

S. cerevisiae WT, trm6-504, and trm6Δ strains containing [2μ PTRM6 URA3] plasmid [81] and [2μ IMT1 LEU2] plasmids or empty vector, as indicated, were grown overnight in SD-leu media at 30°C and analyzed by spotting on SD-Leu media containing 5-FOA. Then cells from the 5-FOA plates were streaked for colonies, inoculated into SD-Leu media and grown overnight, and re-spotted on SD-Leu media.

(PDF)

Click here for additional data file.

S. pombe strains used in this study.

(PDF)

Click here for additional data file.

S. cerevisiae strains used in this study.

(PDF)

Click here for additional data file.

Plasmids used in this study.

(PDF)

Click here for additional data file.

Oligomers used for northern analysis.

(PDF)

Click here for additional data file.

Oligomers used for primer extension analysis.

(PDF)

Click here for additional data file.

23 May 2022

Dear Dr Phizicky,

Thank you very much for submitting your Research Article entitled 'Initiator tRNA lacking 1-methyladenosine is unexpectedly targeted by the rapid tRNA decay pathway in evolutionarily distant yeast species' to PLOS Genetics.

The manuscript was fully evaluated at the editorial level and by independent expert peer reviewers. As you will see, the reviewers appreciated the importance of the work and were enthusiastic about publication but identified some valid constructive concerns that we ask you to address in a revised manuscript.  One reviewer noted that the claim that decay of tRNAiMet(CAU) in S. pombe trm6Δ mutants does not involve the nuclear surveillance pathway is not fully justified by the results in Fig. S11 and suggested measuring tRNAiMet(CAU) levels in the appropriate mutants and controls.

We therefore ask you to modify the manuscript according to the review recommendations. Your revisions should address the specific points made by each reviewer.

In addition we ask that you:

1) Provide a detailed list of your responses to the review comments and a description of the changes you have made in the manuscript.

2) Upload a Striking Image with a corresponding caption to accompany your manuscript if one is available (either a new image or an existing one from within your manuscript). If this image is judged to be suitable, it may be featured on our website. Images should ideally be high resolution, eye-catching, single panel square images. For examples, please browse our archive. If your image is from someone other than yourself, please ensure that the artist has read and agreed to the terms and conditions of the Creative Commons Attribution License. Note: we cannot publish copyrighted images.

We hope to receive your revised manuscript within the next 30 days. If you anticipate any delay in its return, we would ask you to let us know the expected resubmission date by email to plosgenetics@plos.org.

If present, accompanying reviewer attachments should be included with this email; please notify the journal office if any appear to be missing. They will also be available for download from the link below. You can use this link to log into the system when you are ready to submit a revised version, having first consulted our Submission Checklist.

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org.

Please be aware that our data availability policy requires that all numerical data underlying graphs or summary statistics are included with the submission, and you will need to provide this upon resubmission if not already present. In addition, we do not permit the inclusion of phrases such as "data not shown" or "unpublished results" in manuscripts. All points should be backed up by data provided with the submission.

To enhance the reproducibility of your results, we recommend that you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. Additionally, PLOS ONE offers an option to publish peer-reviewed clinical study protocols. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols

Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article’s retracted status in the References list and also include a citation and full reference for the retraction notice.

PLOS has incorporated Similarity Check, powered by iThenticate, into its journal-wide submission system in order to screen submitted content for originality before publication. Each PLOS journal undertakes screening on a proportion of submitted articles. You will be contacted if needed following the screening process.

To resubmit, you will need to go to the link below and 'Revise Submission' in the 'Submissions Needing Revision' folder.

[LINK]

Please let us know if you have any questions while making these revisions.

Yours sincerely,

Richard J. Maraia, M.D.

Guest Editor

PLOS Genetics

Gregory P. Copenhaver

Editor-in-Chief

PLOS Genetics

Reviewer's Responses to Questions

Comments to the Authors:

Please note here if the review is uploaded as an attachment.

Reviewer #1: This paper provides strong evidence that the rapid tRNA decay (RTD) pathway has a major role in decay of initiator tRNA (tRNAiMet(CAU)) lacking m1A58 methylation in both S. pombe and S. cerevisiae, appearing to be the sole pathway in S. pombe, and functioning independently of the nuclear surveillance pathway in S. cerevisiae. It was not known previously that the RTD pathway functions on the tRNAiMet(CAU) lacking m1A58 in S. cerevisiae, in which the instability of this hypomodified tRNAiMet(CAU) has been well established. These findings are significant in showing that RTD pathway acts on all tRNA body modification mutations that evoke decay in fungi; and the evolutionary conservation of the RTD enzymes in mammalian cells suggests its involvement in controlling tRNAiMet(CAU) degradation in mammals, which has medical importance.

In general, the work was extremely well done, the quality of the data very high, and the presentation of results and interpretations very clear. There are however a few issues to be addressed.

Major comments:

-line 280-281: shouldn’t the trm6Δ imt06Δ mutant with the integrated imt06+ gene show poor growth at 39C compared to WT cells (the phenotype of trm6∆?)

-lines 417-419: The claim that decay of tRNAiMet(CAU) in S. pombe trm6Δ mutants does not involve the nuclear surveillance pathway is not fully justified by the results in Fig. S11. They need to measure tRNAiMet(CAU) levels in the trm6∆ and trm6∆cid14∆ mutants examined for growth in Fig. S11 and show no detectable increase in tRNA level in the trm6∆cid14∆ double mutant vs trm6∆ mutant, including a trm6∆dhp1-7 double mutant as a positive control. Also, can they verify the successful deletion of CID14 in their double mutant by showing a growth or biochemical phenotype of cid14∆ that can be complemented by WT CID14?

--lines 303-306: no mutations in the MET22 ortholog were recovered. Doesn’t this argue against saturation ot trm6∆ suppressors in S. pombe? Does deletion of the MET22 ortholog suppress the trm6∆ growth defect in S. pombe?

-the finding in Fig. S13A-B, that A58 of tRNAiMet(CAU) is nearly fully modified at both 27°C and 34°C in trm6-504 mutants is initially surprising, considering the genetic and biochemical evidence for reduced stability of tRNAiMet(CAU) in this strain, shown here and previously.

They state that “The nearly complete modification of tRNAiMet(CAU) in all of the trm6-504 strains with mutations in the nuclear surveillance or the RTD pathway argues for competition between the Trm6:Trm61 enzyme and the decay pathways.” It would be helpful to elaborate on this conclusion by reminding the reader in this context that the levels of tRNAiMet(CAU) are greatly reduced by trm6-504, to <20% of WT levels, and that the remaining ~20% is fully modified. This would be expected if trm6-504 strongly impairs, but does not abolish, m1A modification of tRNAiMet(CAU) and the unmodified species are essentially eliminated from the cells by degradation. Otherwise, there is an impression from the data in Fig. S13A-B that trm6-504 has no impact on tRNAiMet(CAU) methylation.

-There are unexplained data in Fig. 8C-D involving deletions of IMT1, 2, 3 genes. Also, the data for the trm6-504 mutant in this experiment were not mentioned in the text.

Other comments:

-p. 9: Is the failure of high-copy imt07+ to suppress the trm6/61 mutants due to a lack of overexpression of tRNAiMet(CAU, as judged by Northern?

-the methods used for isolating the spontaneous suppressors of trm6∆ should be described.

-Fig. 5B: typo: met06∆ should be imt06∆

Reviewer #2: Post-transcriptional modifications of tRNAs play critical roles in tRNA stability and translation. Previous studies established that the m1A58 modification, which occurs on multiple tRNAs, is critical for the stability of the initiator methionyl-tRNA (tRNA(iMet)). The genes encoding the enzymes responsible for the m1A58 modification, TRM6/GCD10 and TRM61/GCD14, are essential in S cerevisiae but can be deleted in S pombe. Whereas previous studies in S cerevisiae demonstrated that tRNA(iMet) turnover occurred through the nuclear surveillance pathway, a key finding of the present study is that turnover of tRNAs lacking the m1A58 modification in S pombe occurs through the cytoplasmic rapid tRNA decay (RTD) pathway. The authors first characterized the roles of TRM6 and TRM61 in S pombe and discovered that loss of these genes causes a temperature-sensitive growth defect due to reduced levels of tRNA(iMet). Characterization of spontaneous fast-growing suppressors of a trm6 mutant revealed mutations in dhp1, encoding a 5’-3’ exonuclease in the RTD pathway, and in tol1, encoding a phosphatase/nucleotidase that degrades a byproduct that feedback inhibits the RTD pathway. These mutations stabilized tRNAs in the absence of the m1A58 modification, indicating that tRNAs lacking the modification are typically degraded by the RTD pathway. Next, the authors asked if the RTD pathway also contributed to turnover of tRNA(iMet) in S cerevisiae trm6 mutants. Consistent with this possibility, the authors found that mutation of MET22, the tol1 ortholog in S cerevisiae, as well as mutations in the RTD exonucleases RAT1 and XRN1, suppressed the growth defect and loss of tRNA(iMet) in a trm6 mutant. Finally, the authors show that simultaneous inhibition of both the nuclear surveillance pathway (trf4 mutation) and the RTD pathway (met22 mutation) is sufficient to suppress the lethal phenotype of a trm6 deletion mutant in S cerevisiae. Thus, the authors conclude that both the nuclear surveillance pathway and the RTD pathway function in S cerevisiae to turnover tRNAs lacking the m1A58 modification.

This is an impressive and well-controlled study. The paper is well-written and the data support the authors’ conclusions.

Specific comments:

1. I wonder if it would be good to mention to readers the original names for TRM6 (GCD10) and TRM61 (GCD14) in yeast. Perhaps the field has fully adapted to the TRM nomenclature; however, some readers might still search for papers using the old GCD names.

2. Lines 270-1: editorial issue, should “(13, 22) (24, 46)” be combined to a single citation for all four papers?

3. Line 309: is there a positive control that could be used to confirm the cid14-deletion mutation? While PCR assays were used to confirm the mutations, it would be reassuring to see an expected phenotypic effect of the cid14-deletion. However, I am not aware if such a test exists.

4. Lines 347-348: At this point in the paper, is it possible that the RTD mutants might be indirectly affecting tRNA(iMet) levels through the nuclear surveillance pathway? While later data rule this out, it seems possible that RTD mutants could impair the nuclear surveillance pathway (perhaps impair expression of an enzyme in the pathway) and thereby affect tRNA(iMet) levels. Might want to word soften the conclusion here.

5. Lines 359-360: based on the observation that all tRNA(iMet) has the m1A58 modification, the authors posit that tRNA(iMet) is a preferred substrate of Trm6:Trm61. However, an alternative hypothesis is that tRNA(iMet) lacking the m1A58 modification is turned over more rapidly than other tRNAs lacking this modification. Thus, it is not more rapid modification, but more rapid turnover of unmodified tRNA that is responsible for high levels of modified tRNA(iMet) in the mutant cells.

6. Lines 386-387: while the results in the trm6-deletion mutant demonstrate that both the RTD and nuclear surveillance pathways contribute to turnover of hypomodified tRNA(iMet), I am wondering if the two pathways are fully separate or if there might be some overlap. In Figure 7C it is shown that tRNA(iMet) levels are at 0.16 in the trm6-504 mutant and increase to 0.32 in the met22 mutant, 0.67 in the xrn1 mutant, and 0.52 in the trf4 mutant. I am wondering what happens in the trm6-504 background when both pathways are inactivated (met22 trf4 or xrn1 trf4 double mutants). Are the effects of the mutants additive or perhaps less than additive because the two pathways, even though physically separated, can sometimes act on the same tRNAs?

Reviewer #3: The manuscript by Tasak and Phizickyand titled “Initiator tRNA lacking 1-methyladenosine is unexpectedly targeted by the rapid tRNA decay pathway in evolutionarily distant yeast species” provides important new information to the field of tRNA biology. There work provides insights into the regulation of tRNA, translation initiation and the competition between modification and degradation, with the yeast conservation informing human tRNA biology. They have used elegant genetic, molecular and biochemical studies highlighting he importance of writers and modifications on tRNA stability. They have also used well developed mutant strains and whole genome sequencing for suppressor mutations as a powerful tool, and to provide finer details on tRNA degradation pathways and new details on a key substrate for the RTD pathway. This was a well-planned and executed study with an extensive set of logical and well controlled experiments. Their data rich manuscript has 8 regular and 15 supplementary figure panels, which highlights the rigor of their work. I am enthusiastic about the manuscript and believe that the findings that both the RTD and nuclear surveillance pathways contribute to tRNAiMet(CAU) quality control warrants publication in PloS Genetics. I suggest that the manuscript be accepted pending minor revisions (below).

Line 455 – the authors should include a figure for their model.

Line 546 - Details on how whole genome sequencing was done at UofR and should be included in the Materials and methods.

As m1A is regulated by Alkbh in humans and these are not found in budding yeast (not sure about fission yeast), the authors could speculate on these differences. Is that a potential rational for why S pombe do not use the nuclear surveillance pathway in decay of tRNAiMet(CAU)?

Minor comments.

I suggest removing “unexpected” from the title.

I suggest the authors omit or refine this sentence from the abstract “In contrast studies have shown that S. cerevisiae trm6 mutants with reduced 1-methyladenosine (m1A58) specifically target pre-tRNAiMet(CAU) to the nuclear surveillance pathway for 3’-5’ exonucleolytic decay 35 by the TRAMP complex and nuclear exosome. “ Keep it simple in the abstract and address the re-examined findings in the introduction.

In materials and methods please include city, state for all company names and catalog numbers for specific products.

Line 164: move “fig” to before the numbers. Similar for lines 264, 266, 293 and 297. Check throughout.

Line 168 – indicate how the tRNA modification was examined.

Line 180 – delete “all” as there may be some very minor residual m1A (0.03%)

Line 209 – Define for clarity – stand-alone tRNA met gene? - SPBTRNAMET.06 (imt06+) gene

**********

Have all data underlying the figures and results presented in the manuscript been provided?

Large-scale datasets should be made available via a public repository as described in the PLOS Genetics data availability policy, and numerical data that underlies graphs or summary statistics should be provided in spreadsheet form as supporting information.

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: Yes

**********

PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: No

Reviewer #3: No

22 Jun 2022

Submitted filename: response to reviewers 06-20-22b.docx

Click here for additional data file.

5 Jul 2022

Dear Dr Phizicky,

We are pleased to inform you that your manuscript entitled "Initiator tRNA lacking 1-methyladenosine is targeted by the rapid tRNA decay pathway in evolutionarily distant yeast species" has been editorially accepted for publication in PLOS Genetics. Congratulations!

Before your submission can be formally accepted and sent to production you will need to complete our formatting changes, which you will receive in a follow up email. Please be aware that it may take several days for you to receive this email; during this time no action is required by you. Please note: the accept date on your published article will reflect the date of this provisional acceptance, but your manuscript will not be scheduled for publication until the required changes have been made.

Once your paper is formally accepted, an uncorrected proof of your manuscript will be published online ahead of the final version, unless you’ve already opted out via the online submission form. If, for any reason, you do not want an earlier version of your manuscript published online or are unsure if you have already indicated as such, please let the journal staff know immediately at plosgenetics@plos.org.

In the meantime, please log into Editorial Manager at https://www.editorialmanager.com/pgenetics/, click the "Update My Information" link at the top of the page, and update your user information to ensure an efficient production and billing process. Note that PLOS requires an ORCID iD for all corresponding authors. Therefore, please ensure that you have an ORCID iD and that it is validated in Editorial Manager. To do this, go to ‘Update my Information’ (in the upper left-hand corner of the main menu), and click on the Fetch/Validate link next to the ORCID field.  This will take you to the ORCID site and allow you to create a new iD or authenticate a pre-existing iD in Editorial Manager.

If you have a press-related query, or would like to know about making your underlying data available (as you will be aware, this is required for publication), please see the end of this email. If your institution or institutions have a press office, please notify them about your upcoming article at this point, to enable them to help maximise its impact. Inform journal staff as soon as possible if you are preparing a press release for your article and need a publication date.

Thank you again for supporting open-access publishing; we are looking forward to publishing your work in PLOS Genetics!

Yours sincerely,

Richard J. Maraia, M.D.

Guest Editor

PLOS Genetics

Gregory P. Copenhaver

Editor-in-Chief

PLOS Genetics

www.plosgenetics.org

Twitter: @PLOSGenetics

----------------------------------------------------

Comments from the reviewers (if applicable):

Reviewer's Responses to Questions

Comments to the Authors:

Please note here if the review is uploaded as an attachment.

Reviewer #1: I am fully satisfied with the thorough responses to all of my questions and criticisms, which were completely resolved.

Reviewer #2: The authors have satisfactorily addressed all of my concerns.

Reviewer #3: The authors have addressed my concerns.

**********

Have all data underlying the figures and results presented in the manuscript been provided?

Large-scale datasets should be made available via a public repository as described in the PLOS Genetics data availability policy, and numerical data that underlies graphs or summary statistics should be provided in spreadsheet form as supporting information.

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: None

**********

PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: No

Reviewer #3: No

----------------------------------------------------

Data Deposition

If you have submitted a Research Article or Front Matter that has associated data that are not suitable for deposition in a subject-specific public repository (such as GenBank or ArrayExpress), one way to make that data available is to deposit it in the Dryad Digital Repository. As you may recall, we ask all authors to agree to make data available; this is one way to achieve that. A full list of recommended repositories can be found on our website.

The following link will take you to the Dryad record for your article, so you won't have to re‐enter its bibliographic information, and can upload your files directly:

http://datadryad.org/submit?journalID=pgenetics&manu=PGENETICS-D-22-00494R1

More information about depositing data in Dryad is available at http://www.datadryad.org/depositing. If you experience any difficulties in submitting your data, please contact help@datadryad.org for support.

Additionally, please be aware that our data availability policy requires that all numerical data underlying display items are included with the submission, and you will need to provide this before we can formally accept your manuscript, if not already present.

----------------------------------------------------

Press Queries

If you or your institution will be preparing press materials for this manuscript, or if you need to know your paper's publication date for media purposes, please inform the journal staff as soon as possible so that your submission can be scheduled accordingly. Your manuscript will remain under a strict press embargo until the publication date and time. This means an early version of your manuscript will not be published ahead of your final version. PLOS Genetics may also choose to issue a press release for your article. If there's anything the journal should know or you'd like more information, please get in touch via plosgenetics@plos.org.

22 Jul 2022

PGENETICS-D-22-00494R1

Initiator tRNA lacking 1-methyladenosine is targeted by the rapid tRNA decay pathway in evolutionarily distant yeast species

Dear Dr Phizicky,

We are pleased to inform you that your manuscript entitled "Initiator tRNA lacking 1-methyladenosine is targeted by the rapid tRNA decay pathway in evolutionarily distant yeast species" has been formally accepted for publication in PLOS Genetics! Your manuscript is now with our production department and you will be notified of the publication date in due course.

The corresponding author will soon be receiving a typeset proof for review, to ensure errors have not been introduced during production. Please review the PDF proof of your manuscript carefully, as this is the last chance to correct any errors. Please note that major changes, or those which affect the scientific understanding of the work, will likely cause delays to the publication date of your manuscript.

Soon after your final files are uploaded, unless you have opted out or your manuscript is a front-matter piece, the early version of your manuscript will be published online. The date of the early version will be your article's publication date. The final article will be published to the same URL, and all versions of the paper will be accessible to readers.

Thank you again for supporting PLOS Genetics and open-access publishing. We are looking forward to publishing your work!

With kind regards,

Zsofia Freund

PLOS Genetics

On behalf of:

The PLOS Genetics Team

Carlyle House, Carlyle Road, Cambridge CB4 3DN | United Kingdom

plosgenetics@plos.org | +44 (0) 1223-442823

plosgenetics.org | Twitter: @PLOSGenetics