Literature DB >> 34797858

High-quality whole-genome sequence analysis of Lactobacillus paragasseri UBLG-36 reveals oxalate-degrading potential of the strain.

Yogita Mehra1, Pragasam Viswanathan1.   

Abstract

Lactobacillus paragasseri was identified as a novel sister taxon of L. gasseri in 2018. Since the reclassification of L. paragasseri, there has been hardly any report describing the probiotic properties of this species. In this study, an L. paragasseri strain UBLG-36 was sequenced and analyzed to determine the molecular basis that may confer the bacteria with probiotic potential. UBLG-36 was previously documented as an L. gasseri strain. Average nucleotide identity and phylogenomic analysis allowed accurate taxonomic identification of UBLG-36 as an L. paragasseri strain. Analysis of the draft genome (~1.94 Mb) showed that UBLG-36 contains 5 contigs with an average G+C content of 34.85%. Genes essential for the biosynthesis of bacteriocins, adhesion to host epithelium, stress resistance, host immunomodulation, defense, and carbohydrate metabolism were identified in the genome. Interestingly, L. paragasseri UBLG-36 also harbored genes that code for enzymes involved in oxalate catabolism, such as formyl coenzyme A transferase (frc) and oxalyl coenzyme A decarboxylase (oxc). In vitro oxalate degradation assay showed that UBLG-36 is highly effective in degrading oxalate (averaging more than 45% degradation), a feature that has not been reported before. As a recently identified bacterium, there are limited genomic reports on L. paragasseri, and our draft genome sequence analysis is the first to describe and emphasize the probiotic potential and oxalate degrading ability of this species. With results supporting the probiotic functionalities and oxalate catabolism of UBLG-36, we propose that this strain is likely to have immense biotechnological applications upon appropriate characterization.

Entities:  

Mesh:

Substances:

Year:  2021        PMID: 34797858      PMCID: PMC8604369          DOI: 10.1371/journal.pone.0260116

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

The presence of oxalate degrading bacteria in the human gut microbiome is essential as humans lack the enzymes required to metabolize endogenous and dietary oxalate. Free oxalate in the gut is mostly eliminated via urine or feces (as insoluble calcium oxalate conjugate) or metabolized by oxalate degrading gut bacteria. However, disruption of oxalate homeostasis leads to over-accumulation of oxalate, which is a notable cause of several pathological conditions such as hyperoxaluria [1], calcium oxalate urolithiasis [2], cardiomyopathy [3], and renal failure [4]. Consequently, in recent years, there has been an increased focus on the use of probiotics for the prevention of oxalate related disorders [5], mostly those that belong to the genera Lactobacillus and Bifidobacterium [6], perhaps because they are considered generally recognized as safe (GRAS) for human consumption. Among the Lactobacillus species, strains of L. acidophilus and L. gasseri have been most widely studied for their general ability to utilize oxalate and other substrates such as glucose as a source of energy. L. gasseri is an obligate homofermentative, facultative anaerobe in the family of lactic acid bacteria (LAB) first identified in 1980 [7]. Since the availability of the first complete genome sequence of L. gasseri, several draft-phase or complete genomes of this organism have been deposited in public databases. In a recent study by Tanizawa and colleagues [8], a distinct species of L. gasseri was identified based on whole-genome average nucleotide identity (ANI) analysis. This new species of bacteria was termed L. paragasseri, and it represents a novel sister taxon of L. gasseri. A study comparing the genetic diversity of 13 strains of L. gasseri and 79 strains of L. paragasseri showed a clear distinction between these two species, particularly in their clustered regularly interspaced short palindromic repeats (CRISPR), bacteriocins, and their carbohydrate utilization patterns [9]. However, despite the genetic differences, the comparative pan-genome analysis also indicates a higher rate of interspecies gene exchange between L. gasseri and L. paragasseri [9]. Like its sister taxon, L. paragasseri harbors genes that code for enzymes involved in oxalate catabolism. In this two-step process, formyl coenzyme A transferase (EC 2.8.3.16) encoded by the frc gene catalyzes the transfer of CoA from formyl-CoA to oxalate [10]. This activated oxalate molecule is then decarboxylated by the enzyme oxalyl coenzyme A decarboxylase (EC 4.1.1.8) encoded by the oxc gene [10]. While the oxalate utilizing abilities of L. gasseri and its probiotic relevance has been studied [11, 12], there is hardly any evidence on L. paragasseri for the same. In this study, UBLG-36, a commercially available strain hitherto identified as L. gasseri, was sequenced and re-classified as L. paragasseri based on whole-genome relatedness. We performed several bioinformatic analyses to better understand its genomic features, specifically those that may likely contribute to the probiotic properties of the strain. We also identified genes putatively associated with oxalate catabolism and analyzed the ability of the strain to degrade oxalate in vitro.

Materials and methods

Bacterial source and identification

A commercial probiotic strain UBLG-36, initially identified as L. gasseri, was purchased from Unique Biotech Limited (Hyderabad, India). L. acidophilus DSM 20079 and L. casei ATCC 334 were purchased from the German Collection of Microorganisms and Cell Cultures GmbH (Germany) and American Type Culture Collection (USA), respectively. Strains were cultured in Lactobacillus De Man, Rogosa, and Sharpe (MRS) selective medium at 37°C under the aerobic condition for 18–24 hours. UBLG-36 was subjected to 16S rRNA sequencing, and verification of its accurate taxonomic identification was performed on the EzBiocloud (https://www.ezbiocloud.net/) online platform.

Genome sequencing, assembly, and annotation

Unless otherwise mentioned, only the default parameters were used in the software. Whole-genome sequencing of the strain UBLG-36 was performed on Illumina Miseq platform by Illume Gene India LLP Company (Bengaluru, India), and the raw sequencing reads were uploaded to Galaxy Europe genome analysis tool (http://usegalaxy.eu/). De novo assembly of the trimmed reads was performed on Unicycler 0.4.8.0 [13] using the normal bridging mode. Contigs shorter than 100 base pairs were excluded, and the assembly quality was improved using the Multi-Draft-based Scaffolder (MeDuSa) [14]. Annotation of the draft assembly was performed by the NCBI Prokaryotic Genome annotation pipeline (PGAP) [15]. The assembled genome was also analyzed using the RASTtk pipeline of the Rapid Annotations using Subsystems Technology (RAST) online platform (http//rast.nmpdr.org) [16]. EggNOG mapper 4.5 [17] was used to determine the clusters of orthologous groups (COGs) of proteins. Carbohydrate-active enzymes (CAZymes) were searched against the CAZy database using the dbCAN2 meta server [18]. Secondary metabolite-related genes/gene clusters were predicted using antiSMASH 3.0 [19]. ResFinder tool [20] and the Comprehensive Antibiotic Resistance Database (CARD) [21] was used to test for antibiotic resistance genes. Prophage genes were searched using PHASTER [22], and the prediction of the CRISPR-Cas system was carried out using CRISPRCas Finder [23]. Protein sequences that were likely to determine the putative probiotic properties of UBLG-36 were searched individually against the NCBI Conserved Domain Database [24].

Phylogenomic analysis

Representative complete genome sequences of L. gasseri and L. paragasseri were obtained from the NCBI database (S1 Table). 16S rDNA sequences were mined from these complete representative genomes, and together with the 16S rDNA sequence of UBLG-36, pairwise sequence similarities were calculated via the Type (Strain) Genome Server (TYGS) [25] available at https://tygs.dsmz.de/. Phylogenies based on maximum likelihood and maximum parsimony were inferred by the TYGS web server. Draft genome sequence of UBLG-36 and eleven representative complete genome data were uploaded to the JspeciesWS server [26] and the TYGS [25] for calculating ANI values and pairwise comparison of genome sequences, respectively. Coding sequences (CDS) of oxc and frc from the UBLG-36 genome and the eleven representative complete genomes of L. gasseri and L. paragasseri were mined from the NCBI database. These CDS were aligned using the MAFFT webtool [27], and the residue-wise confidence scores were obtained using the GUIDANCE2 [28] application. Phylogenetic tree construction was performed by the MAFFT tool using the Neighbor-Joining method with 1000 bootstrap resampling. Default software parameters were used for all phylogenomic analyses.

Oxalate degradation assay

The oxalate degrading ability of UBLG-36 was determined in vitro. Two MRS culture media with 10 mM and 20 mM sodium oxalate (MRS-ox) (pH 5.5) were prepared as described earlier [29]. Culture broths were inoculated with 1% bacterial culture grown overnight and incubated at 37°C for 1, 5 and 10 days under aerobic conditions. MRS-ox broth without bacterial inoculum was used as a control. L. acidophillus DSM 20079 (NZ_CP020620; harboring both oxc and frc) was used as the positive control, while L. casei ATCC 334 (NC_008526; lacking oxc and frc) served as the negative control. Before the analysis, culture broth and control media were centrifuged at 4000 g for 10 minutes, and the supernatant was filtered through a 0.45-micron filter. Oxalate concentration in the filtrate was measured in triplicates using an oxalate assay kit (Sigma, USA) as per the manufacturer’s instructions.

Statistical analysis

The results are presented as mean ± standard error of mean (SEM). A one-way analysis of variance (ANOVA) followed by Tukey’s test was performed to compare the concentration of oxalate degraded by the bacterial strains. A two-way analysis of variance (ANOVA) followed by Tukey’s test was performed to compare percentage oxalate degradation at 10 mM and 20 mM MRS-Ox at three different time points by the bacterial strains. Comparison between datasets were considered statistically significant at p<0.05 (indicated as ***p<0.001, ###p<0.001, and ##p<0.01). Statistical analysis was performed on Graph Pad Prism 9.2.0 for Windows, GraphPad Software, San Diego, California USA (www.graphpad.com).

Results and discussion

Initial identification

The commercially purchased L. gasseri UBLG-36 strain was subjected to an initial verification by 16S rRNA sequencing. Sequencing identified UBLG-36 as a strain belonging to L. paragasseri and not L. gasseri. To better understand the reason behind the misidentification of species assignment, we performed a detailed phylogenomic analysis (see below) after sequencing the draft genome. To verify the result of the initial 16S rRNA sequencing, we compared the 16S rDNA sequence of UBLG-36 (obtained from the draft genome) to those of the reference genomes (comprising complete genome sequences of 4 L. paragasseri and 7 L. gasseri strains). Although UBLG-36 formed a separate clade with high similarity to four other L. paragasseri strains (JCM 5343, JV V03, NCK1347, and NCTC13720), four L. gasseri strains (EJL, MGYG-HGUT-02387, HL70, and HL75) were also found within this clade (Fig 1A). As whole-genome comparison can yield better microbial resolution and identification than 16S rDNA analysis, we performed a pairwise comparison of the UBLG-36 draft genome with all eleven available complete genome sequences. Consistent with the results of the 16S rDNA comparison, UBLG-36 showed high whole-genome relatedness with three L. gasseri strains (EJL, MGYG-HGUT-02387, and HL70) than the L. paragasseri strains (Fig 1B). ANI calculation also showed that UBLG-36 shared more than 98% identity with L. gasseri EJL, L. gasseri MGYG-HGUT-02387, L. gasseri HL70, and L. gasseri HL75 (S2 Table). According to a previous report, several strains of L. gasseri available in the public databases are misidentified and are likely members of L. paragasseri species [30]. To investigate the likelihood of the four L. gasseri strains (EJL, MGYG-HGUT-02387, HL70 and HL75HL70 and HL75) belonging to L. paragasseri species, we calculated the ANI values of their genomes on the JspeciesWS server through pairwise comparison at the 95% threshold with all other publicly available complete genomes of L. gasseri and L. paragasseri. ANI values indicated that EJL and MGYG-HGUT-02387 shared more than 97% identity with L. paragasseri strains, whereas, with L. gasseri strains, the identity was less than 95%, which is less than the widely accepted threshold (Table 1). Although UBLG-36 was purchased as an L. gasseri strain, our analyses thus provide evidence for the taxonomic identification of UBLG-36 as L. paragasseri. Also, strains EJL, MGYG-HGUT-02387, HL70, and HL75, currently identified as L. gasseri, should be considered for reclassification into L. paragasseri.
Fig 1

Phylogenomic analysis of Lactobacillus paragasseri UBLG-36.

(a) Phylogenetic relationship between Lactobacillus paragasseri UBLG-36 and other L. gasseri and L. paragasseri strains. Phylogenetic tree construction was based on the pairwise sequence similarities of the 16S rDNA sequences mined from the complete representative genome sequences and draft genome sequence of UBLG-36. Tree calculation and inference were carried out on the TYGS web server (http://tygs.dsmz.de/). L. paragasseri UBLG-36 is depicted in bold. (b) Phylogenomic comparison of Lactobacillus paragasseri UBLG-36 with representative complete genomes of other L. gasseri and L. paragasseri strains. A pairwise comparison of the whole genomes was carried out on the TYGS web server, and the tree was inferred from GBDP distances calculated from the genome sequences. L. paragasseri UBLG-36 is depicted in bold.

Table 1

ANI values of Lactobacillus gasseri EJL, L. gasseri MGYG-HGUT-02387, L. gasseri HL70 and L. gasseri HL75 with other L. gasseri and L. paragasseri strains.

GenomesEJLMGYG-HGUT-02387HL70HL75
ANIba [%]Aligned [%]ANIba [%]Aligned [%]ANIba [%]Aligned [%]ANIba [%]Aligned [%]
Lactobacillus paragasseri JCM 534398.3978.9798.3980.6798.3082.6097.8684.45
Lactobacillus paragasseri NCTC1372097.8677.8398.1079.4897.9483.1497.8185.22
Lactobacillus paragasseri JV-V0398.1776.2498.1778.3698.1780.7697.9285.16
Lactobacillus paragasseri strain NCK134797.9775.7297.9877.8997.9380.3097.0085.78
Lactobacillus gasseri ATCC 3332393.2672.4993.1174.6893.2776.9092.8982.40
Lactobacillus gasseri DSM 1486993.0771.5293.1175.3493.0576.0693.1382.05
Lactobacillus gasseri HL2093.2371.5393.1473.8893.3176.2793.0780.85

aANIb refers to Average Nucleotide Identity Blast.

Phylogenomic analysis of Lactobacillus paragasseri UBLG-36.

(a) Phylogenetic relationship between Lactobacillus paragasseri UBLG-36 and other L. gasseri and L. paragasseri strains. Phylogenetic tree construction was based on the pairwise sequence similarities of the 16S rDNA sequences mined from the complete representative genome sequences and draft genome sequence of UBLG-36. Tree calculation and inference were carried out on the TYGS web server (http://tygs.dsmz.de/). L. paragasseri UBLG-36 is depicted in bold. (b) Phylogenomic comparison of Lactobacillus paragasseri UBLG-36 with representative complete genomes of other L. gasseri and L. paragasseri strains. A pairwise comparison of the whole genomes was carried out on the TYGS web server, and the tree was inferred from GBDP distances calculated from the genome sequences. L. paragasseri UBLG-36 is depicted in bold. aANIb refers to Average Nucleotide Identity Blast.

General genome features

The bacterial strain UBLG-36 (henceforth referred to as L. paragasseri UBLG-36), when subjected to whole-genome sequencing using Illumina MiSeq platform generated 4,313,094 paired-end reads (2 x 151 bp) sequences. The reads were uploaded to Galaxy Europe web genome analysis platform for quality assessment and read trimming. The resulting 3,513,720 paired-end reads were de novo assembled using Unicycler 0.4.8.0, and the assembly was further improved using MeDuSa. The final draft genome sequence of UBLG-36 showed 5 contigs covering a total length of 1,941,907 bp, with a G + C content of 34.85% and an N50 of 77,703 bp (Table 2). Annotation of the draft genome using the NCBI PGAP predicted a total of 1918 genes, including 1766 protein-coding genes, 3 rRNAs, 52 tRNAs, 3 ncRNAs, 1 tmRNA and 94 pseudogenes (Table 2). There were no plasmid sequences identified in the genome. Both ResFinder and CARD revealed that the genome of UBLG-36 harbored no antibiotic-resistant genes. Analysis of the genome on RAST using the annotated genes provided a general overview of the coded biological features with a subsystem coverage of 27% (Table 3).
Table 2

General genome features of Lactobacillus paragasseri UBLG-36.

AttributeValue
Genome size (bp)1,941,907
Number of contigs5
DNA G + C content (%)34.85
N50 (bp)77,703
Total number of genes1,918
Total number of protein-coding genes1,766
rRNAs3
tRNAs52
ncRNAs3
tmRNAs1
Pseudogenes94
Plasmid0
Prophages (intact)1
CRISPR arrays1
Table 3

General overview of biological subsystem distribution of the annotated genes.

DescriptionValuePercent (%)
Cofactors, vitamins, prosthetic groups, pigments466.9
Cell wall and capsule487.2
Virulence, disease and defense406
Potassium metabolism91.3
Miscellaneous30.4
Phages, prophages, transposable elements, plasmids182.7
Membrane transport253.7
Iron acquisition and metabolism40.6
RNA metabolism314.6
Nucleosides and nucleotides6710
Protein metabolism12318.4
Cell division and Cell cycle40.6
Regulation and cell signaling142.1
Secondary metabolism20.3
DNA metabolism578.5
Fatty acids, lipids, and isoprenoids253.7
Dormancy and sporulation50.7
Respiration131.9
Stress response60.9
Metabolism of aromatic compounds20.3
Amino acids and derivatives395.8
Sulfur metabolism20.3
Carbohydrates8312.4

Functional classification

Of the predicted protein sequences queried in EggNOG mapper 4.5, 1636 proteins (92.64%) were assigned to 18 clusters of orthologous groups (COG) classes (Fig 2). Function unknown (S, 362 proteins) was the most common among all categories. Other proteins were classified into functional categories such as translation, ribosomal structure and biogenesis (J, 157 proteins); transcription (K, 146 proteins); replication, recombination and repair (L, 123 proteins); cell cycle control, cell division, chromosome partitioning (D, 31 proteins); defense mechanisms (V, 53 proteins); signal transduction mechanisms (T, 29 proteins); cell wall/membrane/envelope biogenesis (M, 93 proteins); Cell motility (N, 7 proteins); intracellular trafficking, secretion, and vesicular transport (U, 42 proteins); posttranslational modification, protein turnover, chaperones (O, 38 proteins); energy production and conversion (C, 54 proteins); carbohydrate transport and metabolism (G, 142 proteins); amino acid transport and metabolism (E, 92 proteins); nucleotide transport and metabolism (F, 87 proteins); coenzyme transport and metabolism (H, 39 proteins); lipid transport and metabolism (I, 36 proteins); inorganic ion transport and metabolism (P, 97 proteins); secondary metabolites biosynthesis, transport and catabolism (Q, 8 proteins).
Fig 2

COG functional categories assigned to the proteins of Lactobacillus paragasseri UBLG-36.

Carbohydrate-active enzymes (CAZymes)

Carbohydrate metabolism is gaining popularity as a trait supporting the probiotic potential of LAB [31]. Carbohydrate metabolism provides the main source of metabolic energy in LAB and plays an important role in the survival and fitness of Lactobacillus in their ecological niche by contributing to cellular processes such as energy production and stress response [32]. For example, in L. paragasseri presence of CAZymes have been shown to degrade non-digestible oligosaccharide, such as ketose and fructo-oligosaccharides thereby, selectively promoting growth and survival of the species within the host [33]. The genome of UBLG-36 was searched for CAZymes, and only those annotations that matched two or more tools in the dbCAN meta server were considered (S1 Fig). CAZymes analysis showed that UBLG-36 contains 29 genes that encode glycoside hydrolases (GHs), 26 genes that encode glycosyltransferases (GTs), 1 gene for carbohydrate esterase (CE), and 1 gene for carbohydrate-binding modules (CBMs) (S3 Table). These genes are essential for the bacteria’s adaptation to the gastrointestinal environment and its interaction with the host since they are involved in the metabolism and assimilation of complex non-digestible carbohydrates [34]. For example, O-linked glycosylation on serines catalyzed by GTs can produce structures that are similar to mucins and may also facilitate adhesion to host cell mucoproteins [35]. Therefore, we believe that the presence of these enzymes will aid UBLG-36 in its survival, competitiveness, and persistence within the host.

Secondary metabolites

Bacteriocins constitute a significant class of antimicrobial peptides produced by LAB [36]. These heat-labile, antimicrobial peptides have been used in the diary and cosmetic industry and in human and veterinary medicine for their ability to inhibit spoilage and pathogenic bacteria [37]. Prediction of secondary metabolites related genes or gene clusters using antiSMASH showed three biosynthetic clusters of bacteriocins with high overall similarity to Gassericin-T, Gassericin-S, and Acidocin-B (S4 Table).

Prophages

Prophages are commonly found in genomes of Lactobacillus species [38]. Only one complete intact prophage locus (204,490 bp– 244,972 bp) was identified with a GC content of 36.41% (S5 Table). A 61 bp direct repeats (5’-CGGAGCGTCATATCAGTGATTTGGGTGAGATTCGAACTCACGACCCACGGTTTAG—AAGACC-3’) flanking the phage region was also identified. This represented the core regions of phage attachment sites (attL and attR). Although the exact role of phage elements in Lactobacillus is unknown, their presence may confer to the variation in the genome during the evolution of UBLG-36.

CRISPR-Cas system

CRISPR refers to the short and highly conserved repeat regions in the genome that are interspaced with variable sequences (spacers) and are often located adjacent to CRISPR-associated (Cas) genes [39]. More than 40% of sequenced bacterial genomes show the presence of CRISPR, which provides immunity to the bacteria against foreign genetic elements [40]. The genome of UBLG-36 was analyzed for the presence of the CRISPR-Cas9 system using the CRISPRcas finder. UBLG-36 genome contains 1 CRISPR locus consisting of a 761-nucleotide region with 11 spacers (S6 Table). A Cas system of Type II-A (1,626,757 bp- 1,632,979 bp) was detected with four Cas genes; cas1, cas2, cas9, and csn2.

Putative probiotic properties

The genome of UBLG-36 carries several protein-coding genes, which may determine its putative probiotic properties. Genes or proteins involved in acid and bile tolerance, adherence to the intestinal mucosa, resistance to temperature changes, host immunomodulation, antimicrobial activity, and intrinsic defense were identified (Table 4). These features can provide selective survival advantages and are important in supporting the probiotic potential of the strain [41]. The genome of UBLG-36 contains genes such as Nhac that codes for Na+-H+ antiporter (MBO3730586) as well as genes for F0F1 ATPase synthase (MBO3730797-MBO3730804), both of which are essential for tolerance to low pH [42]. Genes that code for proteins associated with bile tolerance, such as choloylglycine hydrolase (MBO3729487, MBO3730178, MBO3730995), were also found in the genome. LPXTG (MBO3730086, MBO3730467, MBO3731156), a cell wall anchor domain-containing protein and membrane lipoprotein for attachment to peptidoglycan (MBO3729742), were also identified. These proteins confer bacteria the ability to interact with the surrounding environment [43]. The bioinformatic analysis also showed that UBLG-36 encode several other adhesion proteins such as mucin binding (MucBP) proteins (MBO3731150), exopolysaccharide biosynthesis protein (EPS, MBO3730885, MBO3730887), capsular polysaccharides (CPS, MBO3730886), glyceraldehyde 3-phosphate dehydrogenase (GAPDH, MBO3730740), triosephosphate isomerase (MBO3730742) and elongation factor Tu (MBO3730873). EPS and CPS can facilitate binding to biotic and abiotic surfaces [44]. Although GAPDH and triosephosphate isomerase participates in the glycolysis pathway, they can be released by the cell, facilitating the adhesion of bacteria to the host during colonization [45]. Molecular chaperones DnaK (MBO3729503), DnaJ (MBO3729502), GroES (MBO3729844), and GroEL (MBO3729843) were identified in the genome of UBLG-36. These chaperones have been studied for their ability to provide bacteria with resistance to temperature shocks [46] and to function in bacterial adhesion to the host [47]. Apart from bacteriocins that act as strong antimicrobial agents, UBLG-36 also had gene coding for pyruvate oxidase (MBO3730233). Pyruvate oxidase in bacteria plays a major role in increasing ATP production and can also provide a fitness advantage by producing hydrogen peroxide [48]. UBLG-36 harbors genes that encode for lipoteichoic acid (LTA) synthesis (MBO3730517, MBO3730785) and D-alanyl-lipoteichoic acid biosynthesis protein (MBO3730324, MBO3730326). LTA can elicit host innate immune response by interacting with membrane toll-like receptor 2, activating nuclear transcription factor-kappa B [49]. Genes such as GlmS that code for the enzyme glucosaminefructose-6-phosphate aminotransferase (MBO3729602) and LysM that code for lysing motif domain (MBO3730936) were identified in the genome. GlmS and LysM are involved in catalyzing and binding peptidoglycan, respectively, in the bacterial cell wall [50]. GTs identified by CAZyme analysis are also crucial in the formation of bacterial surface structures [51]. Surface exposed cell wall protein (MBO3730913) that is known to play an important role in bacterial interaction with the host [52] was also found in UBLG-36.
Table 4

Proteins involved in the potential probiotic properties of Lactobacillus paragasseri UBLG-36.

Putative functionProtein/gene nameNCBI protein accession number
pH tolerance Na+-H+ antiporterMBO3730586
F0F1 ATP SynthaseMBO3730797—MBO3730804
Bile tolerance MFS transporterMBO3729588, MBO3729710, MBO3729735, MBO3729745, MBO3729780, MBO3729802, MBO3729892, MBO3730088, MBO3730176, MBO3730177, MBO3730237, MBO3730245, MBO3730263, MBO3730265, MBO3730328, MBO3730357, MBO3730588, MBO3730672
Choloylglycine hydrolaseMBO3729487, MBO3730178, MBO3730995
Adhesion LPXTG cell wall anchor domain-containing proteinMBO3730086, MBO3730467, MBO3731156
Membrane lipoprotein lipid attachment site-containing proteinMBO3729742
Triose phosphate isomeraseMBO3730742
Exopolysaccharide biosynthesis proteinMBO3730885, MBO3730887
CpsD/CapB family tyrosine-protein kinaseMBO3730886
Glyceraldehyde-3-phosphate dehydrogenaseMBO3730740
MucBP domain-containing proteinMBO3731150
Elongation factor TuMBO3730873
Temperature Co-chaperone GroESMBO3729844
Chaperonin GroELMBO3729843
Molecular chaperone DnaJMBO3729502
Molecular chaperone DnaKMBO3729503
Cold shock proteinMBO3730847
Immunomodulation LTA synthase family proteinMBO3730517, MBO3730785
D-alanyl-lipoteichoic acid biosynthesis protein (DltB)MBO3730324
D-alanyl-lipoteichoic acid biosynthesis protein (DltD)MBO3730326
Surface exposed cell wall proteinMBO3730913
GlycosyltransferasesMBO3730551, MBO3730574
Glucosaminefructose-6-phosphate aminotransferase (GlmS)MBO3729602
Peptidoglycan-binding domain-containing protein (LysM)MBO3730936
Antimicrobial substances BacteriocinMBO3729785, MBO3731108
Pyruvate oxidaseMBO3730233
Defense mechanism Type II CRISPR-associated endonuclease Cas1MBO3730903
CRISPR-associated -endonuclease Cas2MBO3730904
Type II CRISPR RNA-guided endonuclease Cas9MBO3730902
Type II-A CRISPR-associated protein Csn2MBO3730905

Oxalate degradation

Inspecting the whole genome sequence of L. paragasseri UBLG-36 revealed the presence of both oxc (H5J37_003070) and frc (H5J37_003075) whose products (MBO3729990, MBO3729991) are putatively involved in oxalate catabolism [10]. Having shared this unique feature with other LAB such as L. gasseri [12] and L. acidophilus [10] further emphasizes the capability of L. paragasseri UBLG-36 to degrade oxalate. To test the ability of UBLG-36 to degrade oxalate in vitro, the bacteria were grown in 10 mM and 20 mM MRS-Ox and assayed at three different time points (Fig 3). UBLG-36 showed an average of 47% and 44% degradation on day 1 in 10 mM and 20 mM MRS-Ox, respectively. There was no significant difference (p>0.05) in percentage oxalate degradation by UBLG-36 on day 1 between 10 mM and 20 mM MRS-Ox. When incubated in 10 mM MRS-Ox, UBLG-36 showed an average of 53% and 55% oxalate degradation on days 5 and 10, respectively. However, when incubated in 20 mM MRS-Ox, the average degradation significantly reduced to 48% on day 5 (p<0.01) and 10 (p<0.001) compared to that observed in 10 mM MRS-Ox on the same days. Overall, the percentage oxalate degradation in 10 mM and 20 mM MRS-Ox by UBLG-36 was significantly higher (p<0.001) than the positive control, L. acidophillus DSM 20079, at all three time points. As expected, L. casei ATCC 334 that served as the negative control, showed no degradation of oxalate.
Fig 3

Evaluation of in vitro oxalate degradation.

(a) The concentration of oxalate degraded by Lactobacillus paragasseri UBLG-36 and (b) percent oxalate degradation by Lactobacillus paragasseri UBLG-36 when incubated for 1, 5, and 10 days in 10 mM and 20 mM MRS-Ox. L. acidophilus DSM 20079 served as the positive control whereas, L. Casei ATCC 334 served as the negative control. L. Casei ATCC 334 showed no oxalate degradation. Data are presented as mean ± SEM from three experimental replicates. ***p<0.001, ###p<0.001, and ##p<0.01 denotes statistical significance. ns denotes non-significant.

Evaluation of in vitro oxalate degradation.

(a) The concentration of oxalate degraded by Lactobacillus paragasseri UBLG-36 and (b) percent oxalate degradation by Lactobacillus paragasseri UBLG-36 when incubated for 1, 5, and 10 days in 10 mM and 20 mM MRS-Ox. L. acidophilus DSM 20079 served as the positive control whereas, L. Casei ATCC 334 served as the negative control. L. Casei ATCC 334 showed no oxalate degradation. Data are presented as mean ± SEM from three experimental replicates. ***p<0.001, ###p<0.001, and ##p<0.01 denotes statistical significance. ns denotes non-significant. To study the relatedness of oxc and frc found in UBLG-36 with all other representative L. gasseri and L. paragasseri strains, we performed a multiple sequence alignment and constructed a phylogenetic tree of all oxc and frc CDS. Phylogenetic analysis shows that CDS of oxc and frc in UBLG-36 is more closely related to L. gasseri strains HL70, EJL, and MGYG-HGUT-02387 (Fig 4), all of which have been identified as L. paragasseri strains based on our analysis (mentioned earlier in Fig 1 and Table 1). The oxc and frc CDS of UBLG-36 and other L. paragasseri strains (including L. gasseri strain HL70, HL75, EJL, and MGYG-HGUT-02387) together form a distinct sub-group (Fig 4), away from the three L. gasseri strains (HL20, ATCC33323, and DSM 14869) However, their degree of relatedness indicates a possible evolutionary inter-species exchange of oxalate catabolizing genes between L. gasseri and L. paragasseri. This observation is also supported by the result of the comparative study performed by Zhou et al. [9] that indicated a high rate of interspecies gene exchange between these sister taxa.
Fig 4

Relatedness of oxc and frc of Lactobacillus paragasseri UBLG-36 with all other representative genomes.

(a) Phylogenetic relationship of the oxc coding sequence of Lactobacillus paragasseri UBLG-36 and other L. gasseri and L. paragasseri strains. (b) Phylogenetic relationship of the frc coding sequence of Lactobacillus paragasseri UBLG-36 and other L. gasseri and L. paragasseri strains. Phylogenetic tree construction was based on the Neighbor-Joining method with 1000 bootstrap resampling performed on MAFFT webtool. L. paragasseri UBLG-36 is depicted in bold.

Relatedness of oxc and frc of Lactobacillus paragasseri UBLG-36 with all other representative genomes.

(a) Phylogenetic relationship of the oxc coding sequence of Lactobacillus paragasseri UBLG-36 and other L. gasseri and L. paragasseri strains. (b) Phylogenetic relationship of the frc coding sequence of Lactobacillus paragasseri UBLG-36 and other L. gasseri and L. paragasseri strains. Phylogenetic tree construction was based on the Neighbor-Joining method with 1000 bootstrap resampling performed on MAFFT webtool. L. paragasseri UBLG-36 is depicted in bold. To the best of our knowledge, this is the first report on the oxalate degrading activity of an L. paragasseri strain. Given the recent taxonomic identification of L. paragasseri, it is not surprising that there is no research on its oxalate degrading ability. As a sister taxon of L. gasseri, it is expected of L. paragasseri strains to harbor oxc and frc and show potential oxalate metabolizing capabilities. Thus, we have observed these features not only in the genome of UBLG-36 but also in all other complete representative L. gasseri and L. paragasseri strains. When analyzed for its oxalate degrading activity in vitro, the results of oxalate degradation by UBLG-36 are consistent but not uniform with those reported earlier with L. gasseri and L. acidophillus strains [53]. The lack of uniformity in oxalate degradation is attributed to both species-to-species and strain-to-strain variations, as evidenced by multiple studies [12, 53, 54]. However, the highlighting feature of UBLG-36 is that the presence of oxc and frc in its genome may be responsible for its ability to degrade oxalate and with comparable oxalate degradation like some of the L. gasseri strains [53], UBLG-36 may prove to be an important probiotic strain. With several potential probiotic traits discovered using bioinformatic tools, it is now essential that we also assess these traits in UBLG-36 using in vitro assays. Some critical in vitro assessments involve testing for acid and bile tolerance, cell-surface hydrophobicity, antibiotic susceptibility, immunomodulatory activity, auto-aggregation screening, production of vitamins, amines and toxins. Although our results suggest the perspective of L. paragasseri UBLG-36 as a new probiotic species with significant oxalate reducing capabilities, we should emphasize that further characterization of this strain in colon-simulated oxalate conditions and in vivo models of hyperoxaluria are necessary. Further, several other in vivo functional tests may be required before UBLG-36 can be classified as a probiotic strain. To this extent, we are currently performing transcriptional and functional analysis of oxc, frc, and other probiotic genes to determine whether L. paragasseri UBLG-36 is a probiotic strain and whether it will eventually be of use in the prophylactic treatment of renal oxalate stone.

Conclusion

In this study, analysis of the draft genome sequence has provided evidence of the potential probiotic properties of L. paragasseri UBLG-36. The presence of oxalate catabolizing genes and the ability to degrade oxalate in vitro necessitates deeper characterization of this species which is currently underway in our laboratory. Functional profiling has illustrated genes and proteins of UBLG-36 that are most commonly shared by several important lactic acid bacteria. As a sister taxon of L. gasseri, an already established probiotic bacteria of the human gut microbiome with immense commercial value, L. paragasseri UBLG-36 may also get its due recognition but would require extensive molecular and physiological characterization. The rapid development of sequencing technologies and bioinformatic analysis has made it easier to analyze and publish genomic information of a large number of microbial species. The increasing collection of genomes in public databases will provide a reliable platform for further comparative genomic analysis that will assist in expanding our knowledge on L. paragasseri UBLG-36.

Venn diagram distribution of CAZymes predicted by three different tools (diamond, HMMER, and hotpep) on dbCAN meta server.

(TIF) Click here for additional data file.

NCBI bioproject and biosample accession numbers of representative genomes.

(XLSX) Click here for additional data file.

Average nucleotide identity values of L. paragasseri UBLG-36 with other L. gasseri and L. paragasseri strains.

(XLSX) Click here for additional data file.

Genes associated with CAZymes gene families.

(XLSX) Click here for additional data file.

Bacteriocin producing secondary metabolite gene clusters.

(XLSX) Click here for additional data file.

Complete prophage regions of the UBLG-36 genome.

(XLSX) Click here for additional data file.

CRISPR locus of Lactobacillus paragasseri UBLG-36.

(XLSX) Click here for additional data file. 16 Jul 2021 PONE-D-21-19912 High quality whole-genome sequence analysis of Lactobacillus paragasseri UBLG-36 reveals oxalate-degrading potential of the strain PLOS ONE Dear Dr. Viswanathan, Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process. ============================== Reviewer #2 had some valuable suggestions to improve the paper. Please consider them carefully. ============================== Please submit your revised manuscript by Aug 30 2021 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file. Please include the following items when submitting your revised manuscript: A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'. A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'. An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'. If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter. If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols. We look forward to receiving your revised manuscript. Kind regards, Yanbin Yin Academic Editor PLOS ONE Journal Requirements: When submitting your revision, we need you to address these additional requirements. 1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at and https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf 2. We note that you have included the phrase “data not shown” in your manuscript. Unfortunately, this does not meet our data sharing requirements. PLOS does not permit references to inaccessible data. We require that authors provide all relevant data within the paper, Supporting Information files, or in an acceptable, public repository. Please add a citation to support this phrase or upload the data that corresponds with these findings to a stable repository (such as Figshare or Dryad) and provide and URLs, DOIs, or accession numbers that may be used to access these data. Or, if the data are not a core part of the research being presented in your study, we ask that you remove the phrase that refers to these data. [Note: HTML markup is below. Please do not edit.] Reviewers' comments: Reviewer's Responses to Questions Comments to the Author 1. Is the manuscript technically sound, and do the data support the conclusions? The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1: Yes Reviewer #2: Yes ********** 2. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1: Yes Reviewer #2: No ********** 3. Have the authors made all data underlying the findings in their manuscript fully available? The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #1: Yes Reviewer #2: Yes ********** 4. Is the manuscript presented in an intelligible fashion and written in standard English? PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #1: Yes Reviewer #2: Yes ********** 5. Review Comments to the Author Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #1: The authors of the manuscript clearly explained the discovery and characterization of a new Lactobacillus paragasseri strain UBLG-36. The genome of the new strain was sequenced and a draft genome was assembled. The authors throughly listed genomic features and performed bioinformatic analyses including functional classification, carbohydrate-active enzyme identification, prophage identification, secondary metabolites, CRISPR-Cas, and putative probiotic properties. Wet lab experiments also verified UBLG-36’s ability to degrade oxalate, highlighting the strain’s potential in being utilized as a probiotic. The genomic analysis conducted here are general and rather superficial, but as the authors stated, much more experiments and analysis are needed for the further verification of UBLG-36’s potential probiotic properties. Since there has yet to be a comprehensive probiotic associated genomic analysis study on the recently discovered Lactobacillus paragasseri, the results generated here may be useful to future related projects. However, I do have some minor suggestions and questions for the authors. 1. When performing the initial phylogenomic analysis, the complete genomes of 4 L. paragasseri and 4 L. gasseri strains were used. There are currently 8 complete genomes for Lactobacillus gasseri strains on NCBI, why not use all of them for the analysis? 2. In figure3, there are too many colors for the legends and it is making it a bit difficult to differentiate between the positive negative controls and the different time points. Maybe use more labels on the graph to make the figure easier to comprehend. Reviewer #2: This work provides a foundation to further study L. paragasseri as putative probiotic species. Genome characterization of the UBLG-36 strain through bioinformatics analyses were sufficient, although further interpretation and discussion is needed to explain the genomic results in the context of a putative probiotic strain. Line175: Should there be any concerns that these antibiotic resistance genes are present (in accordance with EFSA regulations)? Any flanking regions that suggest possible transfer of resistance genes? Line197: Why is carbohydrate metabolism an important trait and what might this imply towards the environmental niche whereby UBLG-36 is expected to survive? Does the CAZyme analysis imply preference for particular substrates? Line207: What are the implications of the discovery of these bacteriocin producing clusters? Are these expected from L. gasseri / L. paragasseri? While the title of the manuscript refers to the oxalate degrading potential of UBLG-36, there is an overall lack of emphasis in the text that describes the importance of oxalate degradation and why this is the focus of the manuscript. Perhaps, a few sentences are needed to highlight the importance of this trait and how it is valuable in probiotics and human health. In addition, it will be worth mentioning the general capability of probiotic LAB species in oxalate degradation and how this trait differs between species/strains. Besides, additional pangenomics analyses can be carried out between the 8 selected genomes (or more if publicly available), especially in the context of the oxc and frc genes that are of main interest in this manuscript. This should provide insights as to how frequent these oxalate degradative genes are present in L. gasseri / L. paragasseri species (highly conserved?), their homology and how their presence/absence affect oxalate utilization capabilities (Turroni et al. 2007: https://sfamjournals.onlinelibrary.wiley.com/doi/10.1111/j.1365-2672.2007.03388.x). Also, this can potentially reveal differences in the putative probiotic-associated genes that were investigated in the paper, perhaps even further differentiating L. paragasseri from its sister taxa. If these are already known from previous publications, it would be worth citing and discussing. Fig3: Statistical analysis required to show significant differences between UBLG-36 with the controls and between the two different concentrations at each time point. Line264: It would be insightful to discuss if the percentage of oxalate degradation reported here are consistent with other probiotic L. gasseri/L. paragasseri/LAB species that were previously reported, as oxalate degradation activity is highly variable (Turroni et al. 2007, Azcarate-Peril et al. 2008). With some strains reported to have 100% oxalate degradative activity, where does UBLG-36 stand? Line266: It appears that there are opposing trends between DSM 20079 and UBLG-36 with respect to different oxalate starting concentrations at all three timepoints. For DSM 20079, the percentage of oxalate degradation appears to be higher at 20mM compared to 10mM while for UBLG-36, the percentage of oxalate degradation appears to be lower at 20mM compared to 10mM. Was degradation at 20mM statistically different compared to 10mM for each strain? If yes, is there a proposed hypothesis as to why this difference in dose-dependent effects were observed? Line283: Briefly expand on what are some of the important assays/phenotyping that are needed in order to establish a strain as a probiotic. ********** 6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: No Reviewer #2: No [NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.] While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step. 30 Sep 2021 Response to reviewers We would like to thank the reviewers for their thorough reading of the manuscript and the thoughtful comments and constructive suggestions. Acting on the revisions prompted by the reviewers’ helped in improving the quality of the manuscript. Changes in the revised manuscript has been done with track change option in MS Word. Reviewer 1: Comment 1: When performing the initial phylogenomic analysis the complete genomes of 4 L. paragasseri and 4 L. gasseri strains were used. There are currently 8 genomes for L. gasseri strains on NCBI, why not use them all? Response: We could not use the new L. gasseri strains, namely, HL20, HL70, and HL75, as they were not available at the time, we performed the analysis. Further, ANI blast analysis on strains 4M13 and MGYG-HGUT-02387 indicated identical (duplicate genomes). Therefore, we only included MGYG-HGUT-02387 in our analysis. However, we thank the reviewer for his suggestion, and in our revised manuscript, we have included these new strains and performed a new set of phylogenomic analyses (see section “Phylogenomic analysis” under “Results and Discussion”). Comment 2. In figure3, there are too many colors for the legends and it is making it a bit difficult to differentiate between the positive negative controls and the different time points. Maybe use more labels on the graph to make the figure easier to comprehend. Response: As per the reviewer’s suggestion, we have modified the figure to make it more legible and comprehensible (See Fig3). Reviewer 2: Comment 1: Should there be any concerns that these antibiotic resistance genes are present (in accordance with EFSA regulations)? Any flanking regions that suggest possible transfer of resistance genes? Response: We thank the reviewer for raising this concern, as it prompted us to investigate these genes more closely. We realized that our initial assessment of antimicrobial-resistant genes (AMR) using PATRIC was wrong because the output of PATRIC is based only on the homology of the query sequence with genes of those organisms that are in the PATRIC AMR gene database (which does not include any Lactobacillus or probiotic species). Moreover, we realized that the PATRIC database is not the best tool to identify putative AMR genes as PATRIC only indicates the possible AMR mechanisms and does not provide the genes that can putatively confer AMR. Therefore, we repeated the analysis by submitting the draft genome of UBLG-36 to the ResFinder tool. No, AMR genes were identified in the genome of UBLG-36. To confirm this data, we aligned the annotated sequence of UBLG-36 against the protein sequences of AMR genes in the Comprehensive Antibiotic Resistance Database (CARD). Similar to ResFinder, no resistance phenotype or gene was observed in UBLG-36 when searched in the CARD database. We have, therefore, updated this information in both the “Materials and Method” and the “Result and Discussion” sections of the revised manuscript and sincerely apologize for this mistake. Comment 2: Why is carbohydrate metabolism an important trait and what might this imply towards the environmental niche whereby UBLG-36 is expected to survive? Does the CAZyme analysis imply preference for particular substrates? Response: While we were not emphasizing any particular substrate in our analysis, in our revised manuscript, we have included some brief points as to how the presence of these enzymes might be beneficial to UBLG-36 (see section “Carbohydrate-active enzymes (CAZymes)”). For example, Carbohydrate metabolism provides the main source of metabolic energy in LAB. It plays an important role in the survival and fitness of Lactobacillus in their ecological niche by contributing to cellular processes such as energy production and stress response. We believe that the presence of these enzymes will aid UBLG-36 in its survival, competitiveness, and persistence within the host. Comment 3: What are the implications of the discovery of these bacteriocin producing clusters? Are these expected from L. gasseri / L. paragasseri? Response: As mentioned in the “result and discussion” of the manuscript under the “Secondary Metabolites”, bacteriocins are essential antimicrobial peptides produced by LAB. Of particular interest amongst all classes of bacteriocins are the class V circular bacteriocins such as gassericin reported in our strain, L. paragasseri UBLG-36. As mentioned in the revised manuscript (line 233, “Secondary metabolites”), bacteriocins like gassericin are simple representatives of ubiquitous circular peptides with diverse physiological activities (Craik et al. 2006 Biopolymers 84:250–266). They were first identified in L. gasseri LA39 and have been shown to be active against several foodborne pathogenic bacteria (Kawai et al. 2001 Food Microbiol 18:407–415). As L. paragasseri strains are a sister taxon of L. gasseri, it is expected that L. paragasseri strains will also have bacteriocin clusters in their genome as described previously (see reference 9 in the revised manuscript). Comment 4: While the title of the manuscript refers to the oxalate degrading potential of UBLG-36, there is an overall lack of emphasis in the text that describes the importance of oxalate degradation and why this is the focus of the manuscript. Perhaps, a few sentences are needed to highlight the importance of this trait and how it is valuable in probiotics and human health. In addition, it will be worth mentioning the general capability of probiotic LAB species in oxalate degradation and how this trait differs between species/strains. Response: We agree with the reviewer’s comment that the manuscript lacks an emphasis on the importance of oxalate degradation, both in general and in the context of L. paragasseri UBLG-36. Therefore, in the revised manuscript, we have included several points under “Introduction” and the “Results and Discussion” sections highlighting the relevance of discovering oxalate degrading genes in UBLG-36 and the necessity for oxalate degradation. Comment 5: Besides, additional pangenomics analyses can be carried out between the 8 selected genomes (or more if publicly available), especially in the context of the oxc and frc genes that are of main interest in this manuscript. This should provide insights as to how frequent these oxalate degradative genes are present in L. gasseri / L. paragasseri species (highly conserved?) If these are already known from previous publications, it would be worth citing and discussing. Response: Although we understand that pangenomics results will be insightful, we are currently using the pangenomics data of UBLG-36 to perform several transcriptional and functional analyses on the strain in our laboratory. Therefore, we apologize for being unable to provide a comparative pangenomic analysis between UBLG-36 and other type strains, in this manuscript, at this point. However, in the “Introduction” to our revised manuscript, we have discussed few key points from a recently published pangenomic study by Zhou et al. (2020) compared the genetic diversity of 13 strains of L. gasseri and 79 strains of L. paragasseri (Line 76, see reference 9 in the revised manuscript). Further, we thank the reviewer for the suggestion and have performed analyses to determine the evolutionary conservation of oxc and frc between L. gassei and L. paragasseri species using complete genomes present in the NCBI database. We have included this new detail in the “Materials and Methods” and have discussed the results in the revised manuscript (See line 125 and 308, and Fig 4 in the revised manuscript) Comment 6: Fig3: Statistical analysis required to show significant differences between UBLG-36 with the controls and between the two different concentrations at each time point. Response: As per the reviewer’s suggestion, we have performed the statistical analysis and have updated the information under “Results and Discussion” in the revised manuscript (Line 294 and Fig 3) Comment 7: It would be insightful to discuss if the percentage of oxalate degradation reported here are consistent with other probiotic L. gasseri/L. paragasseri/LAB species that were previously reported, as oxalate degradation activity is highly variable (Turroni et al. 2007, Azcarate-Peril et al. 2008). With some strains reported to have 100% oxalate degradative activity, where does UBLG-36 stand? Response: We agree with the reviewer that some discussion on the presence of oxalate degrading genes and the results of oxalate degradation by UBLG-36 are necessary. Hence, in the revised manuscript, we have added a concise paragraph discussing the consistency of our results with other LAB strains (Line 325). We agree that the degree of oxalate degradation by LAB is highly variable and believe that it is most likely due to species- and strain-specific differences. Further, in their study, Turroni et al. (2007) showed that oxalate degradation as much as 40% was an effective trait in L. gasseri, although some strains showed 100% degradation. However, their study measured oxalate degradation over five days by inoculating the bacteria in 5 mM oxalate. Few significant differences in our study (apart from the strains used) is that UBLG-36 was subjected to higher concentrations of oxalate, and we have measured oxalate degradation for a longer duration than that reported by Turroni et al. Therefore, the notable differences in the levels of degradation between UBLG-36 and other L. gasseri or LAB species may not only be influenced by the type of strain or species but also the experimental setup. Also, to the best of our knowledge, this is the first report on the ability of an L. paragasseri strain in degrading oxalate. Therefore, based on the current results, we believe that UBLG-36 is an oxalate degrader with high potential and can show promising results when characterized further. Comment 8: It appears that there are opposing trends between DSM 20079 and UBLG-36 with respect to different oxalate concentrations at all three timepoints. For DSM 20079, the percentage of oxalate degradation appears to be higher at 20mM compared to 10mM while for UBLG-36, the percentage of oxalate degradation appears to be lower at 20mM compared to 10mM. Was degradation at 20mM statistically different compared to 10mM for each strain? If yes, is there a proposed hypothesis as to why this difference in dose-dependent effects were observed? Response: The opposing trends in oxalate degradation between DSM 20079 and UBLG-36 maybe due to species-wise differences in catabolizing oxalate. Such variability has been previously reported (Turroni et al. 2007, Azcarate-Peril et al. 2008). Further, as far as dose-dependent effect is concerned, the differences in the physiological state and adaptation of the cells to the oxalate medium may also be contributing to the observed effect. We want to add that DSM 20079 was only used as a positive control for the experiment (because it harbors oxc and frc), and our analysis did not compare this strain’s effectiveness against UBLG-36. However, as per the reviewer’s suggestion, in the revised manuscript, we have shown the statistical analysis (Line 294 and Fig 3) where we have statistically analyzed the difference in oxalate degradation between UBLG-36 and DSM 20079 (positive control) on all three-time points. We have also analyzed the oxalate degradation by UBLG-36 at 10 mM and 20 mM MRS-Ox at different time points. There was no significant difference in oxalate degradation by UBLG-36 on day 1 between 10 mM and 20 mM MRS-Ox. However, when incubated in 20 mM MRS-Ox, the average degradation significantly reduced on days 5 and 10 compared to that observed in 10 mM MRS-Ox on the same days. Further, the percentage oxalate degradation in 10 mM and 20 mM MRS-Ox by UBLG-36 was significantly higher than the positive control, L. acidophillus DSM 20079, at all three-time points. Comment 9: Briefly expand on what are some of the important assays/phenotyping that are needed to establish a strain as a probiotic. Response: As per the reviewer’s suggestion, we have briefly mentioned in our discussion few important functional assays that are necessary to classify a strain (or, in this case, UBLG-36) as a probiotic (Line 336) Submitted filename: Response to reviewers.docx Click here for additional data file. 14 Oct 2021 PONE-D-21-19912R1High-quality whole-genome sequence analysis of Lactobacillus paragasseri UBLG-36 reveals oxalate-degrading potential of the strainPLOS ONE Dear Dr. Viswanathan, Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process. ==============================Please address the reviewer #2's new comments.============================== Please submit your revised manuscript by Nov 28 2021 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file. Please include the following items when submitting your revised manuscript:If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter. A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'. A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'. An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'. If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols. We look forward to receiving your revised manuscript. Kind regards, Yanbin Yin Academic Editor PLOS ONE Journal Requirements: Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article’s retracted status in the References list and also include a citation and full reference for the retraction notice. Additional Editor Comments (if provided): [Note: HTML markup is below. Please do not edit.] Reviewers' comments: Reviewer's Responses to Questions Comments to the Author 1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation. Reviewer #1: All comments have been addressed Reviewer #2: All comments have been addressed ********** 2. Is the manuscript technically sound, and do the data support the conclusions? The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1: Yes Reviewer #2: Yes ********** 3. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1: Yes Reviewer #2: Yes ********** 4. Have the authors made all data underlying the findings in their manuscript fully available? The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #1: Yes Reviewer #2: Yes ********** 5. Is the manuscript presented in an intelligible fashion and written in standard English? PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #1: Yes Reviewer #2: Yes ********** 6. Review Comments to the Author Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #1: The authors addressed my previous concerns with the included additional data and experiments regarding the phylogenetic analysis of L. gasseri strains. Regarding concerns on Figure 3, the authors also made modifications and made the figure more comprehensible to readers. Reviewer #2: The authors' fully addressed previous comments. I commend the time and effort that the authors dedicated to re-visit certain analyses in the manuscript, especially pertaining to the antibiotic resistance genes. Minor comments: line 141: It is advisable to state the factors used for the two-way ANOVA. For figure 3a, since comparisons were not made across concentrations, was a two-way ANOVA still used here or a one-way ANOVA with bacteria strain as the factor? In addition, were the statistics done excluding the negative control? Although obvious, the negative control should be included. This would allow the authors to confidently state that oxalate degradation is significantly higher in both positive control and the test strain compared to the negative control, proving that the negative control worked as expected. line 305: Include the fact that no oxalate degradation was observed after indicating that L. casei ATCC 334 served as a negative control. This will help to avoid confusion as ATCC 334 is shown in the figure legends but is not visible in the graph itself due to lack of degradative activity. ********** 7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: No Reviewer #2: No [NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.] While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step. 27 Oct 2021 Response to reviewers We would again like to thank the reviewers for their thorough review of the manuscript and their constructive suggestions. Although the changes were minor, acting on the revisions prompted by the reviewers has immensely improved the manuscript. Changes in the revised manuscript have been done with the track change option in MS Word. Reviewer 2: Comment 1: Line 141-It is advisable to state the factors used for the two-way ANOVA. Was a two-way or one-way ANOVA used for comparison in Fig 3a? It is advisable to include the negative control in the statistical analysis. Response: We thank the reviewer for suggesting these changes. One-way ANOVA was used in figure 3a, and two-way ANOVA was used in figure 3b. We have stated these factors in the revised manuscript (line 140 under “Materials and methods”). Further, we have included the negative control in the statistical test, and the new figure 3 reflects these changes. Comment 2. Line 305-Include the fact that no oxalate degradation was observed after indicating that L. casei ATCC 334 served as a negative control. Response: As per the reviewer’s suggestion, we have included a line that L. casei 334 was used as the negative control and showed no oxalate degradation. (See line 306). Submitted filename: Response to reviewers.docx Click here for additional data file. 3 Nov 2021 High-quality whole-genome sequence analysis of Lactobacillus paragasseri UBLG-36 reveals oxalate-degrading potential of the strain PONE-D-21-19912R2 Dear Dr. Viswanathan, We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements. Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication. An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org. If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org. Kind regards, Yanbin Yin Academic Editor PLOS ONE Additional Editor Comments (optional): Reviewers' comments: 8 Nov 2021 PONE-D-21-19912R2 High-quality whole-genome sequence analysis of Lactobacillus paragasseri UBLG-36 reveals oxalate-degrading potential of the strain Dear Dr. Viswanathan: I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department. If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org. If we can help with anything else, please email us at plosone@plos.org. Thank you for submitting your work to PLOS ONE and supporting open access. Kind regards, PLOS ONE Editorial Office Staff on behalf of Dr. Yanbin Yin Academic Editor PLOS ONE
  53 in total

1.  Complete genome sequence analysis of a strain Lactobacillus pentosus ZFM94 and its probiotic characteristics.

Authors:  Kai Ye; Ping Li; Qing Gu
Journal:  Genomics       Date:  2020-05-22       Impact factor: 5.736

Review 2.  Primary and secondary hyperoxaluria: Understanding the enigma.

Authors:  Bhavna Bhasin; Hatice Melda Ürekli; Mohamed G Atta
Journal:  World J Nephrol       Date:  2015-05-06

Review 3.  Oxalate-degrading bacteria of the human gut as probiotics in the management of kidney stone disease.

Authors:  Valerie R Abratt; Sharon J Reid
Journal:  Adv Appl Microbiol       Date:  2010       Impact factor: 5.086

Review 4.  Kidney stones.

Authors:  Saeed R Khan; Margaret S Pearle; William G Robertson; Giovanni Gambaro; Benjamin K Canales; Steeve Doizi; Olivier Traxer; Hans-Göran Tiselius
Journal:  Nat Rev Dis Primers       Date:  2016-02-25       Impact factor: 52.329

5.  antiSMASH 3.0-a comprehensive resource for the genome mining of biosynthetic gene clusters.

Authors:  Tilmann Weber; Kai Blin; Srikanth Duddela; Daniel Krug; Hyun Uk Kim; Robert Bruccoleri; Sang Yup Lee; Michael A Fischbach; Rolf Müller; Wolfgang Wohlleben; Rainer Breitling; Eriko Takano; Marnix H Medema
Journal:  Nucleic Acids Res       Date:  2015-05-06       Impact factor: 16.971

6.  GUIDANCE2: accurate detection of unreliable alignment regions accounting for the uncertainty of multiple parameters.

Authors:  Itamar Sela; Haim Ashkenazy; Kazutaka Katoh; Tal Pupko
Journal:  Nucleic Acids Res       Date:  2015-04-16       Impact factor: 16.971

7.  CRISPRCasFinder, an update of CRISRFinder, includes a portable version, enhanced performance and integrates search for Cas proteins.

Authors:  David Couvin; Aude Bernheim; Claire Toffano-Nioche; Marie Touchon; Juraj Michalik; Bertrand Néron; Eduardo P C Rocha; Gilles Vergnaud; Daniel Gautheret; Christine Pourcel
Journal:  Nucleic Acids Res       Date:  2018-07-02       Impact factor: 16.971

8.  Hydrogen peroxide-producing pyruvate oxidase from Lactobacillus delbrueckii is catalytically activated by phosphotidylethanolamine.

Authors:  Louis P Cornacchione; Linden T Hu
Journal:  BMC Microbiol       Date:  2020-05-24       Impact factor: 3.605

9.  Comparative analysis of Lactobacillus gasseri from Chinese subjects reveals a new species-level taxa.

Authors:  Xingya Zhou; Bo Yang; Catherine Stanton; R Paul Ross; Jianxin Zhao; Hao Zhang; Wei Chen
Journal:  BMC Genomics       Date:  2020-02-03       Impact factor: 3.969

10.  JSpeciesWS: a web server for prokaryotic species circumscription based on pairwise genome comparison.

Authors:  Michael Richter; Ramon Rosselló-Móra; Frank Oliver Glöckner; Jörg Peplies
Journal:  Bioinformatics       Date:  2015-11-16       Impact factor: 6.937

View more
  2 in total

1.  Mechanism of gastrointestinal adaptability and antioxidant function of infant-derived Lactobacillus plantarum BF_15 through genomics.

Authors:  Xinyu Wang; Na Zhang; Dongyao Li; Miaoshu Wang; Chen Li; Hongtao Tian
Journal:  Food Sci Biotechnol       Date:  2022-08-05       Impact factor: 3.231

2.  Genomic insights into Lactobacillus gasseri and Lactobacillus paragasseri.

Authors:  Adriana Ene; Natalie Stegman; Alan Wolfe; Catherine Putonti
Journal:  PeerJ       Date:  2022-06-07       Impact factor: 3.061

  2 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.