Literature DB >> 33112867

Fabrication routes via projection stereolithography for 3D-printing of microfluidic geometries for nucleic acid amplification.

Charalampos Tzivelekis1, Pavlos Sgardelis1, Kevin Waldron2, Richard Whalley1, Dehong Huo1, Kenny Dalgarno1.   

Abstract

Digital Light Processing (DLP) stereolithography (SLA) as a high-resolution 3D printing process offers a low-cost alternative for prototyping of microfluidic geometries, compared to traditional clean-room and workshop-based methods. Here, we investigate DLP-SLA printing performance for the production of micro-chamber chip geometries suitable for Polymerase Chain Reaction (PCR), a key process in molecular diagnostics to amplify nucleic acid sequences. A DLP-SLA fabrication protocol for printed micro-chamber devices with monolithic micro-channels is developed and evaluated. Printed devices were post-processed with ultraviolet (UV) light and solvent baths to reduce PCR inhibiting residuals and further treated with silane coupling agents to passivate the surface, thereby limiting biomolecular adsorption occurences during the reaction. The printed devices were evaluated on a purpose-built infrared (IR) mediated PCR thermocycler. Amplification of 75 base pair long target sequences from genomic DNA templates on fluorosilane and glass modified chips produced amplicons consistent with the control reactions, unlike the non-silanized chips that produced faint or no amplicon. The results indicated good functionality of the IR thermocycler and good PCR compatibility of the printed and silanized SLA polymer. Based on the proposed methods, various microfluidic designs and ideas can be validated in-house at negligible costs without the requirement of tool manufacturing and workshop or clean-room access. Additionally, the versatile chemistry of 3D printing resins enables customised surface properties adding significant value to the printed prototypes. Considering the low setup and unit cost, design flexibility and flexible resin chemistries, DLP-SLA is anticipated to play a key role in future prototyping of microfluidics, particularly in the fields of research biology and molecular diagnostics. From a system point-of-view, the proposed method of thermocycling shows promise for portability and modular integration of funcitonalitites for diagnostic or research applications that utilize nucleic acid amplification technology.

Entities:  

Mesh:

Year:  2020        PMID: 33112867      PMCID: PMC7592796          DOI: 10.1371/journal.pone.0240237

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


1. Introduction

1.1. PCR-based microfluidics in molecular diagnostics

Analysis of nucleic acids through amplification by Polymerase Chain Reaction (PCR) is a powerful tool in molecular biology with many critical applications. PCR is based on the in-vitro enzymatic exponential amplification of a target DNA sequence, through a thermal cycling process of purified template DNA in the presence of additional DNA polymerase enzyme, nucleobases and forward and reverse primers suspended in an aqueous buffer solution. It can also be applied to generate DNA complementary to a starting RNA sequence, referred to as reverse transcription (RT) PCR, which is particularly useful in studying gene expression of viral RNA [1]. Apart from diagnostic purposes, sequencing and genotyping through PCR is used to enhance understanding of various diseases, record gene-dependent drug sensitivity or identify individuals [2]. Miniature PCR microfluidic devices has been introduced in the 90’s [3-7] and since then investigated as tools for rapid [8-12] and accurate, high-throughput [13] analysis of biological samples for nucleic acids on portable systems that integrate on-chip target detection [14]. Point-Of-Care (POC) molecular diagnostic systems utilize this technology to deliver high throughput personalized sample analysis for clinical diagnosis and monitoring of diseases [15, 16]. Several research groups demonstrated complete systems, integrating all steps for PCR-based diagnosis of various pathogens in crude samples for field-use [17-19]; to an extent, the potential of POC molecular diagnostic technology is now met in some commercial cartridge-based PCR assays with pre-printed reagents for diagnosis of common infectious diseases and for drug sensitivity tests performed by trained personnel [20, 21]. Although, wide commercialization of POC molecular diagnostics requires the integration of all steps on a single chip, with sample-in-answer-out functionality at a low-cost, providing substantial benefits for the end-user compared to alternatives [22, 23]. The current potential of higher throughput, more reliable performance and target multiplexing in simpler, “smarter” and truly portable systems, connected in a dedicated health surveillance network is far from being fulfilled [24]. Commercial lab-on-chip diagnostic technology is showing cumbersome development, with several studies reporting that the lack of a critical or “killer” application has meant that lab-on-a-chip technology has not developed further [25-27]. Nonetheless, the need for manufacturing expertise and high development costs, combined with the lack of communication of research needs and strict regulatory frameworks in healthcare manufacturing highly contribute to the observed slow development [28, 29]. Manufacturing constraints often discourage experimentation on novel designs and experimental approaches in microfluidics, revealing the gaps between proof-of-concept academic results and their translation to meaningful applications. Commercial quality microfluidics are manufactured at large volumes, mainly with micro-forming processes and medical grade thermoplastics, due to low unit costs. Such processes are highly expensive for prototyping, due to the requirement of forming tool manufacturing and therefore only validated designs justify investment in a tool [30]. Alternatively, soft lithography of polydimethylsiloxane (PDMS) [17, 31], clean-room based photolithographic patterning or etching of SU-8, glass or silicon [18, 32] and material removal processes such as mechanical and laser micromachining [33] of a wide range of microfluidic materials are typically preferred for research prototyping and low volume production.

1.2. Polymer additive manufacturing for microfluidics

Unlike conventional processes, additive manufacturing (AM) is more accessible to researchers, due to the simplicity of use and low setup and running costs, allowing researchers to get hands-on developing custom devices [34, 35]. Microfluidics research into prototyping with AM is essentially carried out with material extrusion, material jetting and vat photopolymerization AM technologies [36]. Material extrusion or Fused Filament Fabrication (FFF) has been popular in microfluidics prototyping for its wide range of biocompatible printable thermoplastics and has been used for printing various bioanalytical microfluidic devices, in mostly explorative projects. Representative studies included poly(ethylene terephthalate) (PET) devices for nanoparticle suspensions preparation and biochemical sensing [37], portable polylactic acid (PLA) immuno-array devices for detection of multiple cancer biomarkers in serum [38], a configurable polypropylene micro-reactor for bioanalytical applications [39], polycaprolactone (PCL) nervous-system-on-chip devices for cell co-cultures that enable physiological studies [40], wax-based extrusion of vascular 3D structures for chaotic mixing studies [41] and purpose-built systems for printing biodegradable, cell-loaded hydrogels for producing tissue scaffolds of clinically relevant sizes [42]. The main limitations of FFF are lower print resolution (when compared to vat photopolymerization and material jetting) and rough surfaces due to the stair-stepping effect created by deposited filaments, which can often lead to sealing issues [43]. Material jetting or inkjet 3D printing is preferred for printing microfluidics for its multi-material printing capability that enables sacrificial [44] and functional [45] material patterning. Additionally, drop-on-demand printing technology offers the highest resolution among AM processes, other than 2-photon lithography [46]. In microfluidics context, the process is often used in conjunction with UV-curable polymers for printing microfluidic prototyping tools as soft lithography moulds [47], active microfluidic circuitry components [48, 49] and various lab-on-chip devices for cell and bacteria studies, often focused on material biocompatibility [50-52]. Recently Yin et al exhibited a inkjet 3D printed droplet-based PCR device with complex 2.5D channel pattern to detect micro RNAs in MCF-10A cells and MDA-MB-231, which can act as reliable biomarkers in various cancer types [53]. The device was printed in commercial photopolymer with sacrificial wax and post-processed for wax removal according to specifically developed protocols [54]. Dielectric ink jetting has produced thin film based 2D printed devices with embedded elements for low-cost diagnostics [55], while inkjet 3D printing of SU-8 monolithic channel devices using dissolvable PMMA supports and embedded functional elements has also been demonstrated [56]. Inkjet 3DP performance is typically dependent on specific system capabilities and the available material options, and open source systems can print custom material formulations with their fluidic properties tuned to specific ranges. Limitations of the process involve low print speeds and the high cost of flexible inkjet printing systems. Stereolithography (SLA) is the first 3D printing technique invented and patented in 1984 by Chuck Hull, the co-founder of 3D Systems [57]. It utilizes light projection to achieve prints in photocurable resin formulations. The capability to print small unsupported overhangs results in less post-processing, smoother and more complex geometries. The simplicity of SLA systems has been translated into several commercial low-cost printers, with some enabling third-party resins and printing of research formulations. There are two key points to consider when developing medical microfluidics with SLA: channel manufacturability and material biocompatibility. Manufacturability of enclosed volumes in SLA is dependent on the effective drainage of uncured resin, which can block channels [58, 59]. The minimum size of a monolithic microchannel is determined by part orientation, resin viscosity, and the print resolution (determined by a laser beam diameter or pixel size in the case of Digital Light Processing) [60]. Due to that limitation, research on microfluidics with SLA often focuses on adopting intelligent design and printing practices for sealing microfluidic prints [61, 62], the development of computational models for determining minimum printable feature size [63], the use of low viscosity SLA resins [64] and printing of soft lithography tools [47]. Studies on SLA printing of microfluidics often concludes that with appropriate bonding and good quality control, SLA-based 3D printing shows great promise in future prototyping and low volume processing techniques for a variety of lab-on-chip platforms [65-68]. Biocompatibility of photopolymer prints is an additional issue that needs to be specifically addressed on an application basis. Commercial photopolymer resins for AM are formulations of acrylate or epoxy derived monomers and oligomers and typically contain a photoinitiator, which initiates polymerization on exposure to UV or visible light [69]. Most resins additionally contain additives to improve functional properties and printability [70]. Printed resins, in their semi-polymerized form are usually aggressive towards biological samples such as cells and DNA, through a variety of interactions with reactive moieties as residual monomers on, or leaching from, the printed surface, including commercial USP Class VI biocompatible formulations [71-73]. The impact of such interactions on a biological process as PCR can be detrimental in high surface-to-volume ratio (SVR) microfluidic architectures. Appropriate post-processing of photopolymer prints with increased temperature and UV light [51], organic solvents and water baths [52] has been shown in multiple studies to improve the biocompatibility of prints by reducing residuals content in photopolymer parts [52, 74]. Reducing leaching from the interface and reactivity at the interface by further static or dynamic coating of surfaces has also been a popular solution for 3D printed devices. Treatment is possible by exploiting the inherent surface reactivity of the prints to perform coatings with various coupling agents, endowing customised surface properties. Silane coupling agents [75] or biocompatible compounds as poly (ethylene glycol) (PEG), bovine serum albumin BSA, poly (vinyl alcohol) (PVA) [62] and poly-l-lysine [74] have been reported to improve functionality of photopolymer parts for applications such as droplet generation [53, 75], cell and bacteria culture and nucleic acids amplification [62, 74, 76]. Commercial biocompatible resins have been also successfully tested in low-risk applications such as skin and internal tissue contact for hearing aids and dental applications respectively, and for short period bacterial or cell cultivation experiments [77, 78]. In addition novel cytocompatible and photosensitive monomer formulations such as polyethylene glycol diacrylate (PEG-DA), ethoxylated trimethy-lolpropane triacrylate, poly(propylene fumarate)/diethyl fumarate and fumaric acid monoethyl ester based resins, have also been used in applications as cell-based microfluidics for cancer studies [79] and tissue scaffold printing [80, 81], demonstrating excellent biocompatibility.

1.3. Research motivation

Several studies on microfluidic prototyping with SLA have individually addressed the manufacturability issues associated with realisation of enclosed micro-features, the need for process standardization and the particularly reactive nature of commercial resins that makes them inappropriate for biological applications. Aim of this work is to define the processing protocols for the production of chips for stationary PCR, and to clearly demonstrate functionality. The research focusses on the production of chips for stationary PCR using open-source Digital Light Processing (DLP) SLA and a high-performance third-party acrylate resin. The 3D printed chips were post-processed to reduce PCR inhibiting residuals content and subsequently hydrophobically modified with silane agents to limit molecular adsorption instances. Silane-based modification protocols were based on dip-coating methodologies and characterized with Scanning Electron Microscopy-Energy Dispersive X-ray Spectroscopy (SEM-EDS) and contact angle visualisations and analysis prior to implementation on PCR chips. To evaluate performance, an infrared (IR) mediated PCR thermocycler for printed chips was developed. The system was developed to address issues associated with the problematic thermal behaviour of 3D printed flow-through chips [82], as the radiation directly heated the PCR mixture, enabling the evaluation of the PCR inhibitory effect caused directly by material interactions rather than poor temperature control. The functionalized chips were evaluated by performing on-chip PCR to amplify a 75 base pair target sequence from genomic DNA in a protocol used as endogenous control in qPCR. The short target allowed rapid extension and denaturation times and was selected as a first step for proof-of-concept experimentation. Amplification reactions were performed on glass and fluorosilane coated chips and amplicons were subsequently detected off-chip with agarose gel electrophoresis and fluorescence and compared to control reactions ran at identical conditions on a high-speed PCR thermocycler. To highlight the effectiveness of the silane modification in limiting molecular adsorption occurrences, a non-treated chip was tested under identical conditions.

2. Methods

2.1. Micro-chamber PCR chip architecture

The stationary PCR chip geometry consisted of three cylindrical chambers of 3 mm diameter and 400 μm depth, interconnected with a 300x400 μm cross-section microchannel. Fillet features of 1 mm radius at the intersection of the chamber and the interconnected microchannels were inserted to eliminate rough edges that promote air bubble formation. The total surface area of the microfluidic chamber design was 36 mm2, resulting in a total surface-to-volume ratio of approximately 5, and a 15 μL reaction volume with each interconnected chamber accommodating approximately 5 μL. Circular inlets of 400 μm nominal diameter were designed to fit and seal with a 200 μL pipette tip used for PCR mixture insertion. Temperature sensing was performed only in the central PCR chamber, through a 300 μm hole on the central chamber, designed for tight fitting a micro-probe thermocouple of the same diameter.

2.2. Characterisation of printed and post-processed resin interference with PCR

To simulate the behavior of a low SVR PCR fluidic device printed in SLA, low-volume printed specimens were exposed to PCR mixture during the reaction. The specimens were post-processed at different levels. Prior to PCR sample preparation, nine cubes (1 mm3) were printed in Formlabs Hi Temp resin on the Autodesk Ember DLP SLA. The utilized resin is commercially developed for high-definition prints of high thermal stability and minimum deformation and its main application is 3D printing of thermoforming tools. Layer exposure time was selected at 2 ± 0.1 seconds, so that optimal feature definition is achieved, as it was visually observed (Figs 1 and 6). After printing, the specimens were washed in isopropanol, dried with air and post-cured in a UV oven (0.08 W/cm2, 355 nm) for 1 hour, according to the manufacturer instructions [83] to achieve heat deflection temperature higher than 200°C. At this stage, three cubes were placed in individual PCR tubes and sealed. The remaining six cubes were boiled and stirred in 100 mL deionized water. Three more cubes were then placed in PCR tubes and sealed. The final three cubes were boiled in deionized water for 1 hour, while placed under in the UV oven for 1 additional hour. They were then also stored in polypropylene tubes and sealed. A conventional PCR protocol to amplify a 1,000 base pair long target sequence was used for characterization. PCR mixture for nine 50 μL reactions (three replicates for each of the three post-processing conditions), plus three controls (positive, negative-no template, negative-no enzyme) was prepared. Each individual reaction contained 50% v/v FailSafe® PCR buffer (Premix D, Lucigen) with 4 mM MgCl2 and 400 μM of each dNTP (10 μM), 5% v/v of each primer (SeCopAP1 forward TGTCAATGAATTGATGACCAATCATAAAGGAGTTTTTACTTGTAGGCTGGAGCTGCTTCG 10 μM and SeCopAP2 reverse CCGCCTTTAAGCAACTCGAATTATTTTGGGTATAGACTTTCATATGAATATCCTCCTTAG 10 μM), 1% v/v Taq DNA polymerase and 1% v/v plasmid DNA template solution (30 ng/μL) in molecular biology grade water. The reaction mixture was pipetted into the nine tubes containing cubes, and into three empty tubes as controls. All twelve tubes were gently mixed, pulse spun and then run in a BioRad C1000 PCR thermocycler. The thermocycling protocol included an initial denaturation step at 95°C for 5 minutes, followed by denaturation at 95°C for 30 seconds, annealing at 52°C for 30 seconds and extension at 68°C for 60 seconds repeated for 35 cycles with a final extension step of 5 minutes. After thermocycling, 5.5 μL of 10X loading dye was added to each PCR tube. The contents of each tube were mixed and 10 μL aliquots of each sample were loaded with 10 μL of DNA ladder (80–10,000 base pair) and resolved in a 1% (w/v) agarose gel for 35 minutes at 90V and imaged on a BioRad transilluminator.
Fig 1

Two-stage printing protocol schematic for printing monolithic microfluidic cartridges with DLP® SLA.

An open channel chip and a cap CAD model are developed and converted into STL type format. In AM software environment, the open-channel part is printed virtually positioned onto the printing platform and without support structures. The chip is then cleaned, and the channel cavities are filled with low melting point and viscosity sacrificial wax. The whole process takes place, while the chip is held on the platform by vacuum built during printing of the first layer. A cap part is then printed on the existing chip creating a monolithic channel. The chip is then removed from the platform, cleaned from excessive resin and dried. It is then heated at ~60° and the wax is flushed out with isopropanol and hot water. The printed chip can then be further post-processed and treated.

Fig 6

Characterisation of silane-functionalized 3D-printed disk specimens.

SEM images, contact angle visualizations and surface chemistry schematics of (a, d, g) a non-treated, (b, e, h) a fluorosilane and (c, f, i) a glass modified printed 2D surface, with wetting contact angle values of (d) 80°, (e) 115° and (f) 135° for each respective condition for a 0,05 μL deionised water droplet, (j) SEM-EDS surface elemental composition estimation for two silane treatment conditions, compared to a non-treated printed surface. (k) contact angle results summary. (S2A_SEM_contact_angle in S1 File (DOI: 10.25405/data.ncl.12320837), S2B_contact_angle in S1 File (DOI: 10.25405/data.ncl.12320849), S3_Fig_6_SEM_EDS in S1 File (DOI: 10.25405/data.ncl.12320861)).

Two-stage printing protocol schematic for printing monolithic microfluidic cartridges with DLP® SLA.

An open channel chip and a cap CAD model are developed and converted into STL type format. In AM software environment, the open-channel part is printed virtually positioned onto the printing platform and without support structures. The chip is then cleaned, and the channel cavities are filled with low melting point and viscosity sacrificial wax. The whole process takes place, while the chip is held on the platform by vacuum built during printing of the first layer. A cap part is then printed on the existing chip creating a monolithic channel. The chip is then removed from the platform, cleaned from excessive resin and dried. It is then heated at ~60° and the wax is flushed out with isopropanol and hot water. The printed chip can then be further post-processed and treated.

2.3. Chips fabrication with DLP- stereolithography

A two-stage printing process based on DLP-SLA and the Formlabs Hi Temp resin was developed for printing monolithic micro- channel and micro-well features based on the use of sacrificial, low-viscosity paraffin wax. An open channel chip with a 2.5D channel pattern was first printed, parallel to the projection plane of printer and attached on the platform without support structures. The platform was then removed with the print, the open channel chip cleaned with isopropanol and dried before applying sacrificial paraffin wax (Paraffin wax, melting point: 53–57°C (ASTM D 87), Sigma Aldrich). After wax deposition, a warm glass slide is pressed towards the deposited wax to improve surface quality of the subsequent printed layer. The entire cleaning and wax deposition processes occur with the printed part held on the platform by the vacuum generated during printing of the first layer. The platform is then placed back on the printer and the cap is printed on the existing part, sealing the channels. After a chip was printed, it was removed from the platform, washed in isopropanol and dried. It was then heated to 50–60°C to melt the wax, which was flushed out with hot isopropanol and subsequent water washes. A schematic of the two-stage printing process is shown in (Fig 1). The chips were then UV cured for one hour in a purpose-built 355 nm UV oven at 0.08 mW/cm2. Printed and post-UV cured chips were further washed with boiling hot water internally for one hour. Following the functionalization of the chips described in the following paragraph, the chips were fitted with a K type thermocouple with a probe of 300 μm diameter and sealed with UV curable adhesive.

2.4. Hydrophobic functionalization of SLA prints

To internally treat the micro-chamber chips printed with SLA, a perfusion coating methodology was considered most appropriate. Glass and fluorosilane hydrophobic functionalization protocols were initially developed as dip coating methodologies to functionalize 2D printed and post-processed disks of 10 mm diameter and 1 mm thickness. Those specimens were used for the evaluation of coatings with contact angle and SEM-EDS prior to implementation on 3D printed chips.

2.4.1. Dip coating of 2D SLA prints

To functionalize the 2D prints with fluorosilane, after post-processing as described in 2.2, the prints were dipped into reactive siloxane solution (G790, Wacker) and left for 30 minutes before being removed and dried at room temperature. A 95:5 ethanol: deionised water solution was adjusted to have a pH of 4.5 using glacial acetic acid. The fluorosilane coupling agent (1h,1h,2h,2h-perfluorooctyltriethoxysilane, Sigma Aldrich) was then added to the ethanol: deionised water solution yielding a 2% v/v concentration. The solution was stirred for 5 to 10 minutes to instigate silanol formation. The siloxane pre-treated 2D prints were then moved into the fluorosilane solution and stirred for 3–4 hours at room temperature. After functionalization the specimens were washed with deionised water, dried and stored in petri dishes prior to evaluation. The siloxane pre-treatment and the subsequent fluorosilane coating mechanism s are illustrated in (Fig 2).
Fig 2

Schematic representation of the consecutive treatment with siloxane and fluorosilane agents to functionalize a 3D printed acrylate surface with fluorosilane.

The siloxane treated acrylate surface is dipped into hydrolysed fluorosilane agent. Hydrogen bonds are initially formed between the primer and the coating agent, which are covalently bonded to each other after thermal treatment.

Schematic representation of the consecutive treatment with siloxane and fluorosilane agents to functionalize a 3D printed acrylate surface with fluorosilane.

The siloxane treated acrylate surface is dipped into hydrolysed fluorosilane agent. Hydrogen bonds are initially formed between the primer and the coating agent, which are covalently bonded to each other after thermal treatment. The glass hydrophobic coating involved similarly dipping of the 2D post-processed prints in reactive siloxane agent for 30 minutes, before removed and dried at room temperature. The prints were then dipped into Sigmacote® and agitated for few seconds. They were then cured at 130°C for 15 minutes and then cooled to room temperature over a period of 6–8 hours toa void thermal shocks and therefore cracking and flaking on the coated layer. The siloxane pre-treatment and subsequent glass coating mechanisms are illustrated in (Fig 3).
Fig 3

Schematic representation of the consecutive treatments with siloxane and glass agents to functionalize a 3D printed acrylate surface with glass.

The siloxane treated surface is dipped into Sigmacote glass in heptane solution, and bonds are formed between the primer and the glass agent by displacing -CL.

Schematic representation of the consecutive treatments with siloxane and glass agents to functionalize a 3D printed acrylate surface with glass.

The siloxane treated surface is dipped into Sigmacote glass in heptane solution, and bonds are formed between the primer and the glass agent by displacing -CL.

2.4.2. Perfusion coating of SLA printed monolithic micro-channels

To functionalize the chips with fluorosilane, post-processed and dried chips had the micro-chamber filled with the reactive siloxane solution, which was left for 30 minutes, then flushed away with pressurized air. The chip was then dried. The fluorosilane coupling agent was added to a pH adjusted ethanol: deionised water solution prepared as described for the 2D prints. The dried siloxane pre-treated chips were connected to the chip bracket designed for the IR system as described in 2.4. M6 fitting nuts (Omnilok, Kinesis), silicone ferrules and 1/16” diameter tubing were used to connect the chip to a Harvard PHD 22/2000 syringe pump. The fluorosilane solution was then cycled through the chip for 2 hours at flow rates of 0.1–1 ml/min. During this period, the chip was heated to approximately 80°C. The functionalized chips were disconnected from the manifold and washed thoroughly with PCR grade water and dried. Similarly, to functionalize the chips with glass, the post-processed chips were filled with the reactive siloxane solution, left for 30 minutes and flushed and dried with pressurized air. Sigmacote® was then manually inserted and cycled in the chamber with a mechanical pipette for a few seconds before the excessive solution was flushed out. The chips were then cured at 130°C for 15 minutes and cooled to room temperature over a period of 6–8 hours. Functionalized chips were fitted with a thermocouple as described in 2.2.

2.5. Infrared thermocycler development

The IR thermocycler employed two active elements for heating and cooling and a chip bracket. The heating element was a 12 W, 850 nm PCB mounted IR LED cluster (RS Components), consisting of nine individual LEDs in a 3 X 3 square configuration of 25x25 mm, bonded with electrical insulating and heat conductive compound on an anodized aluminium heatsink. Each LED provided a radiant flux of 1.3W under its highest permissible operation, and half of its intensity at a 45o viewing angle. Considering the spacing between the centre points of individual LEDs, the chip was located at an effective height of 2.5 mm above the LED top surface to achieve homogeneous IR emission and even heating of the PCR mixture. The cooling element was a 24V DC centrifugal air fan (RS Components), fitted on the side of the heatsink/LED array and chip bracket configuration (Fig 4). Both active elements were driven by MOSFET transistors and controlled by an 8-bit Arduino-based microcontroller. PID (proportional-integral-derivative) control was implemented into the Arduino code and the gains were calculated for the 2-step PCR protocol described in 2.5 to achieve minimal temperature overshoot and increased stability. Temperature sensing was performed with the thermocouples embedded in the PCR chamber of the 3D printed chips during fabrication. A chip bracket was designed, and 3D printed in Autodesk Ember DLP SLA with PR48 black prototyping resin. The bracket design served a series of purposes, including housing and sealing of the chip during PCR, interfacing commercial tubing for post-processing and perfusion treatments, improving air-cooling, reflecting IR toward chip chamber and locating the chip at the effective height for optimum IR transmission. M6 holes were tapped on the 3D printed bracket for attaching Omnilok M6 microfluidic fitting nuts (Kinesis, UK) and 1/16” microfluidic tubing, used during post-processing and coating treatments. Regular plastic M6 fitting nuts and pressure sensitive tape were used for sealing during PCR.
Fig 4

Schematic of an infrared (IR) PCR thermocycler for a 3D printed microchamber PCR chip.

CAD assembly of chip bracket, chip, IR LED cluster and heatsink and a centrifugal fan. The sides of the bracket exposed the bottom chip surface allowing cooling of both the chip and the LED cluster by the fan and insulating the area around the temperature sensor. Copper tape was used to cover internal surfaces of the bracket, reflecting IR towards the chip, and improving the heating rate. The system provided excellent repeatability in thermocycling for PCR, enabling the characterisation of the PCR inhibition exclusively owed to the performance of the printed polymer, eliminating inhibition owed to temperature control. The developed thermocycling platform and its modular character based on open-source electronics additionally provides a basis further exploration of resin-3D printed microfluidic geometries for Point-of-Care analysis of nucleic acids.

Schematic of an infrared (IR) PCR thermocycler for a 3D printed microchamber PCR chip.

CAD assembly of chip bracket, chip, IR LED cluster and heatsink and a centrifugal fan. The sides of the bracket exposed the bottom chip surface allowing cooling of both the chip and the LED cluster by the fan and insulating the area around the temperature sensor. Copper tape was used to cover internal surfaces of the bracket, reflecting IR towards the chip, and improving the heating rate. The system provided excellent repeatability in thermocycling for PCR, enabling the characterisation of the PCR inhibition exclusively owed to the performance of the printed polymer, eliminating inhibition owed to temperature control. The developed thermocycling platform and its modular character based on open-source electronics additionally provides a basis further exploration of resin-3D printed microfluidic geometries for Point-of-Care analysis of nucleic acids.

2.6. Two-step PCR protocol for on-chip reactions

To demonstrate PCR functionality from 3D printed micro-well devices, genomic DNA template from a DNA pool was used to amplify a 75 bp target sequence using CD8a quantitative PCR primers based on a two-step PCR thermocycling protocol. PCR concentrations were optimized to take into account molecular adsorption. Phire II hot start polymerase was specifically selected for its extension rate of 10 s/kb, which allows shorter extension times even in environments that inhibit enzyme activity and compared to reactions performed with Taq polymerase. The protocol was performed on 3D printed chips treated with fluorosilane and Sigmacote®. A non-treated chip was also tested for control purposes. To establish reliable controls for the IR system and for the reaction itself positive and negative control reactions were performed on a Philisa high-speed thermocycler under an identical PCR protocol and similar heating rates. Individual reaction volumes for IR PCR (15 μL) and Philisa (25 μL) positive control reactions contained 20% Phire buffer (5x), 200 μM dNTPs, 2μM each of the CD8a forward and reverse primer respectively (CD8a Forward CACCTGGAAGCGACTTAGATACTGT/CD8A Reverse CCCTACTCAGCCTCGCGTTA), 10% (v/v) Phire II polymerase and genomic template (4000 copies per reaction) in molecular biology grade water. The 15 μL PCR mixtures were pipetted into the micro-chamber with a mechanical pipette and a 200 μL tip. The PCR thermocycling protocol included an initial denaturation step at 95°C for 60 seconds, followed by 50 cycles of denaturation at 95°C for 2 seconds and an extension- annealing step at 68°C for 5 seconds, followed by a final extension step at 68°C for 60 seconds. This protocol was implemented for both IR and Philisa control reactions. After thermocycling, amplicons were loaded with 6x Purple loading buffer and 5μL aliquots were loaded and resolved on a 2% (w/v) agarose in gel in TAE buffer at 90V for 45 minutes along with a low molecular weight DNA marker (NEB) of 25–766 bp using 0.5 and 1 μL loadings. For demonstration purposes, the faint amplicons retrieved from non-treated chips ran on agarose gel for approximately 20 minutes, before fully absorbed in the agarose gel after a few additional minutes. Gels were imaged in a BioRad transilluminator system and bands were analysed using GelAnalyzer. Target amplicon concentrations were calculated based on Beer-Lambert law and using DNA ladder bands as standards.

3. Results and discussion

3.1. Characterisation of printed and post processed resin interference with PCR

The reactions performed in the presence of low volumes of printed material, indicated that basic post-processing with only isopropanol washes and UV light did not efficiently reduce PCR inhibiting residuals, so that a target concentration consistent with the control reaction is yielded (Fig 5(B): bands 2–4). In contrast, the reactions performed with printed specimens washed with hot water and further UV-cured (Fig 5(B): bands 5–9) yield amplicon concentrations consistent with the positive control [Fig 5(B): band 11]. Negative control reactions lacking template DNA (Fig 5(B): band 12) and enzyme (Fig 5(B): band 13) did not generate any product as it was anticipated. Those results (S1A in S1 File, Fig 5) address PCR inhibition, due to leachates, but also due to biomolecular adsorption, which in this case has minimum impact due to the very low SVR of the cube specimen (0.12). The results demonstrate a strong PCR inhibiting effect of the SLA polymer when this is post-processed minimally with isopropanol and UV light, while hot water baths are shown to reduce inhibiting residuals. UV curing reduced PCR inhibiting residuals by inducing their consumption into the polymerized material and increasing the degree of cross-linking. Water and isopropanol further dissolve print residuals to remove them from the printed surface. Therefore, the printed polymer is compatible with PCR for fluidic and potentially milli-fluidic chamber-based devices when post-processed appropriately. However, the evidence is partially representative for higher SVR architectures, which are anticipated to enhance the inhibiting effect of biomolecular adsorption in on-chip reactions.
Fig 5

Mock PCR experiments for characterisation of printed resin interference with PCR.

(a) Schematic illustration of mock PCR experiments for low SVR incubated prints. Printed samples representative of consecutive post-processing steps including isopropanol (IPA) wash, UV curing and hot water baths were incubated into the PCR mixture and remained until the completion of the reaction, (b) Gel electrophoresis imaging of separated PCR amplicons from mock reactions: low SVR printed samples incubated in PCR mixture during PCR. Samples post-processed with high intensity UV light and hot water washes (bands 5–9) showed minimum interaction with DNA amplification, unlike the ones post-processed only with isopropanol washes and/or UV curing (bands 2–4) (S1A_raw_images in S1 File (DOI: 10.25405/data.ncl.12320501)).

Mock PCR experiments for characterisation of printed resin interference with PCR.

(a) Schematic illustration of mock PCR experiments for low SVR incubated prints. Printed samples representative of consecutive post-processing steps including isopropanol (IPA) wash, UV curing and hot water baths were incubated into the PCR mixture and remained until the completion of the reaction, (b) Gel electrophoresis imaging of separated PCR amplicons from mock reactions: low SVR printed samples incubated in PCR mixture during PCR. Samples post-processed with high intensity UV light and hot water washes (bands 5–9) showed minimum interaction with DNA amplification, unlike the ones post-processed only with isopropanol washes and/or UV curing (bands 2–4) (S1A_raw_images in S1 File (DOI: 10.25405/data.ncl.12320501)).

3.2. Chip design and printing

The three-chamber architecture was observed to be more rigid during printing, with easier application of sacrificial material and fitting of thermocouples compared to a larger single-chamber design. Moreover, the geometry repeatedly induced no bubble formation during PCR mixture insertion. Printing time of an open channel chip and the cap was 3 and <1 minute respectively using 50 μm printed layers and considering total nominal chip thickness of 0.9 mm. Total printing time for a chip was 10 minutes, including wax deposition and removal. In this work, one chip was printed per print run. However, multiple chips can fit in the platform of most DLP SLA systems to increase productivity by maintaining identical printing times irrelevant to print surface area. The total post-processing time including simultaneous UV curing and water washes for a printed cartridge was approximately 1 hour, with the capability to post-process multiple chips simultaneously depending on the setup. By following the manufacturer instruction for post-UV with an 80 mW/cm2 light source, no distortion was observed at a level that would impair the performance of the printed device. The chips were designed to accommodate 15 μL fluid volumes, which were precisely loaded using a mechanical pipette. No flatness issues were observed, while the small chip area and thickness allowed for a level of flexibility. The complexity of channels achievable with the proposed methods is based on the melt viscosity of the wax, which determines the backpressure required for wax removal and the feasibility depends on the bonding strength between the chip and the cap. The low melt viscosity of the paraffin wax, in combination with the unibody microchannel formed can deliver more complex 2.5D channels, such as heat exchanging architectures found in flow-through thermocycling setups.

3.3. Hydrophobic functionalization of SLA printed surfaces

The contact angle of fluorosilane and glass coated samples was approximately 115° (Fig 6B, 6E and 6H) and 135° respectively (Fig 6C, 6F and 6I). For a non-treated surface, the value was 80° (Fig 6A, 6D and 6G) (S2A, S2B in S1 File). Elemental composition analysis with SEM EDS showed distinctive elemental signals corresponding to silicon and fluorine and increased presence of oxygen when compared to non-functionalized samples, which is indicative of silane chemistry (Fig 6J) (S3 in S1 File).

Characterisation of silane-functionalized 3D-printed disk specimens.

SEM images, contact angle visualizations and surface chemistry schematics of (a, d, g) a non-treated, (b, e, h) a fluorosilane and (c, f, i) a glass modified printed 2D surface, with wetting contact angle values of (d) 80°, (e) 115° and (f) 135° for each respective condition for a 0,05 μL deionised water droplet, (j) SEM-EDS surface elemental composition estimation for two silane treatment conditions, compared to a non-treated printed surface. (k) contact angle results summary. (S2A_SEM_contact_angle in S1 File (DOI: 10.25405/data.ncl.12320837), S2B_contact_angle in S1 File (DOI: 10.25405/data.ncl.12320849), S3_Fig_6_SEM_EDS in S1 File (DOI: 10.25405/data.ncl.12320861)). The perfusion coating steps lasted 2 and 1 hour for the fluorosilane and glass layers respectively. Considering a 10-minute print time per chip and one hour of post-processing (if UV curing and water washes are combined), a minimum of 2–3 hours is required to fabricate one or more fully post-processed and silane-functionalized PCR micro-chamber chips. The number of chips that can be produced in this period depends on the capabilities of the post-processing and treatment setup. As far as the silane coatings are concerned, it is recommended that surface-modified chips are stored overnight prior to use to allow for complete curing of the coatings.

3.4. Thermocycling performance

The fluid volume of 15 μL within the chips was required to undergo a two-step PCR protocol with the temperature oscillating between 95°C and 68°C for denaturation and extension-annealing steps respectively. The thermocycling performance was experimentally determined during PCR reactions using the thermocouple embedded in the printed chips during fabrication as described in 2.2 (Fig 7D and 7F). Total thermocycling time for the IR and control reactions were 25 and 20 minutes, respectively, with the experiments performed at room temperature of approximately 20°C. The average heating rate of the IR system was 4.1°C/s, with a maximum value of 14.3°C/s. The average and maximum cooling rates were -5.1°C/s and -12.5°C/s, respectively (Fig 7A and 7B) (S4 in S1 File). The heating rates and cycle times were identical for untreated, fluorosilane treated, and glass treated chips. The PID code was optimized for 15 μL reaction mixtures and achieved thermal stability of ±1.5°C during initial overshooting, and less than ±0.25°C in the steady state. The stabilisation time was 5–10 seconds. In terms of the material performance in thermocycling, the reaction chamber withstood the pressure built during PCR and the material remained rigid with no visual signs of deterioration. The system design with radiation heating and stationary thermocycling enables testing of more complex PCR geometries, which can serve additional purposes such as DNA extraction, reagents selective delivery and optical detection. Functionalities such as fluidic control and optical detection can be incorporated in a modular fashion exploiting the open-source electronics platform. Finally, the compact system design allows for portability, which is desirable in POC applications.
Fig 7

IR PCR thermocycling performance and system configuration.

(a) A two-step PCR thermocycling profile for 50 cycles and one-minute initial denaturation and final extension steps for 15 μL on-chip reactions. The temperature profile was recorded on a thermocouple embedded 3D printed PCR chip in real-time during PCR thermocycling on a fluorosilane modified chip, (b) zoom-in one two-step PCR cycle temperature profile, (c) a 3D printed chip modified with fluorosilane and fitted with an embedded thermocouple, mounted on the bottom chip bracket prior to PCR, (d) A 3D printed and post-processed, non-treated PCR chip, (e) the IR thermocycler, (f) PCR chip assembled on the IR chip bracket prior to reaction. (S4_ 2_step_PCR-temperature_profile in S1 File (DOI: 10.25405/data.ncl.12320864)).

IR PCR thermocycling performance and system configuration.

(a) A two-step PCR thermocycling profile for 50 cycles and one-minute initial denaturation and final extension steps for 15 μL on-chip reactions. The temperature profile was recorded on a thermocouple embedded 3D printed PCR chip in real-time during PCR thermocycling on a fluorosilane modified chip, (b) zoom-in one two-step PCR cycle temperature profile, (c) a 3D printed chip modified with fluorosilane and fitted with an embedded thermocouple, mounted on the bottom chip bracket prior to PCR, (d) A 3D printed and post-processed, non-treated PCR chip, (e) the IR thermocycler, (f) PCR chip assembled on the IR chip bracket prior to reaction. (S4_ 2_step_PCR-temperature_profile in S1 File (DOI: 10.25405/data.ncl.12320864)).

3.5. On-chip PCR performance

By examining the agarose gel bands and their respective intensity profiles, a highly specific 75 bp target concentration is observed for the reactions performed on the IR system and 3D printed fluorosilane (Fig 8(A): Lane 5) and glass (Fig 8(B): Lane 4) modified chips. PCR products of those reactions were of identical sequence length and slightly lower intensity to the positive control reaction respective bands in (Fig 8(A): Lane 3) and (Fig 8(B): Lane 2). Negative control reactions, lacking template DNA performed on printed chips, resulted in no amplification product (Fig 8(A): Lane 4, 8(b): Lane 5), similarly to the negative control reactions ran on the Philisa thermocycler (Fig 8(A): Lane 2, 8(b): Lane 3). The PCR performance was consistent with the controls for both glass and fluorosilane coatings. Slightly lower concentrations of amplicon were observed from the functionalized 3D printed chips compared to the control reactions which apart from surface reactivity are potentially influenced by altered temperature stability and thermal transition rates, both of which can influence enzyme activity. Non-treated printed chips explicitly produced very faint or no PCR product (Fig 8(C): Lane 4,6). The gel containing the PCR amplicon retrieved from the non-treated chip did not run for the full period of time as the previous gels. The gel electrophoresis was stopped at 20 minutes and the gel was imaged to visualize the faint amplicon, which was later absorbed after few minutes of additional electrophoresis of the same gel (Fig 8, (c inset)) (S1A in S1 File). This resulted in partially separated DNA ladder bands.
Fig 8

On-chip nucleic acid amplification reactions on 3D-printed and silane-functionalized micro-chamber chips.

(a) Band intensity analysis of positive and negative (no DNA template) control reactions on Philisa (Lane 2,3) and IR PCR thermocycler on fluorinated 3D printed chips (Lane 4,5,6,7). Loading of 1 (Lane 1) and 0.5 μL (Lane 8) low molecular weight DNA marker allowed accurate quantification of amplicon based on band-intensity. (a1) Agarose gel intensity profile plots generated in ImageJ. Base pair lengths of DNA marker have been tagged for reference to target specificity. (b) Band intensity analysis of positive and negative (no DNA template) control reactions on Philisa (Lane 2,3) and IR PCR thermocycler on glass-coated 3D printed chips (Lane 4,5), run with 1 μL (Lane 1) loading of low molecular weight DNA marker. (b1) Agarose gel intensity profile plots generated in ImageJ. PCR product bands for positive and IR PCR reaction representative peaks were tagged. (c) Band intensity analysis of positive and negative (no DNA template) control reactions on Philisa (Lane 2, 3) and IR PCR thermocycler on non-treated 3D printed chips (Lane 4,5,6,7), run with 1 μL (Lane 1) loading of low molecular weight DNA marker. The gel run for approximately 20 minutes less than the time for the gels with amplicons from treated chips, to visualize the faint amplicon, as the latter was fully absorbed in longer gel electrophoresis runs (inset in c). As a result, the ladder in this gel image is not fully separated. (c1) Agarose gel intensity profile plots generated in ImageJ. PCR product and primer bands for positive and IR PCR reaction representative peaks were tagged. (S1A_raw_images in S1 File (DOI: 10.25405/data.ncl.12320501), S1B_Amplicon_band_intensities_plots in S1 File (DOI: 10.25405/data.ncl.12320396)).

On-chip nucleic acid amplification reactions on 3D-printed and silane-functionalized micro-chamber chips.

(a) Band intensity analysis of positive and negative (no DNA template) control reactions on Philisa (Lane 2,3) and IR PCR thermocycler on fluorinated 3D printed chips (Lane 4,5,6,7). Loading of 1 (Lane 1) and 0.5 μL (Lane 8) low molecular weight DNA marker allowed accurate quantification of amplicon based on band-intensity. (a1) Agarose gel intensity profile plots generated in ImageJ. Base pair lengths of DNA marker have been tagged for reference to target specificity. (b) Band intensity analysis of positive and negative (no DNA template) control reactions on Philisa (Lane 2,3) and IR PCR thermocycler on glass-coated 3D printed chips (Lane 4,5), run with 1 μL (Lane 1) loading of low molecular weight DNA marker. (b1) Agarose gel intensity profile plots generated in ImageJ. PCR product bands for positive and IR PCR reaction representative peaks were tagged. (c) Band intensity analysis of positive and negative (no DNA template) control reactions on Philisa (Lane 2, 3) and IR PCR thermocycler on non-treated 3D printed chips (Lane 4,5,6,7), run with 1 μL (Lane 1) loading of low molecular weight DNA marker. The gel run for approximately 20 minutes less than the time for the gels with amplicons from treated chips, to visualize the faint amplicon, as the latter was fully absorbed in longer gel electrophoresis runs (inset in c). As a result, the ladder in this gel image is not fully separated. (c1) Agarose gel intensity profile plots generated in ImageJ. PCR product and primer bands for positive and IR PCR reaction representative peaks were tagged. (S1A_raw_images in S1 File (DOI: 10.25405/data.ncl.12320501), S1B_Amplicon_band_intensities_plots in S1 File (DOI: 10.25405/data.ncl.12320396)). Enzyme adsorption rather than DNA template is here considered the main source of PCR inhibition, which is in agreement with similar literature [62, 71, 74]. Enzyme can be anchored on the printed surface and become limiting during early PCR cycles, resulting in low target concentrations. In addition, PCR compounds such as denatured DNA, primers, dNTPs and Mg ions are further prone to adsorption and might also become limiting, due to surface reactivity, further inhibiting the reaction. Silane treatments exploit the surface reactivity to create a hydrophobic passivated surface, which significantly limits the adsorption interface and level of reactivity. PCR components could not be adsorbed on the hydrophobic surface and the reaction was facilitated. Considering similar literature results, enzyme is the main adsorbed PCR component [84, 85]. The proposed hydrophobic treatments are appropriate for reducing biological adsorption in 3D printed microfluidics. The estimation of target concentrations on on-chip reactions was performed on GelAnalyzer by analyzing the peak areas of the 75 base pair long fragment bands for the two loadings of 1 and 0.5 μL shown in (Fig 8A and 8a1: Lane 1 and 8) and constructing a calibration curve (S1B in S1 File). The curve was then used to calculate the concentration for the bands of the control and on-chip reactions (Fig 9) (S1B in S1 File). The calculated concentration values were 288 ng/ μL for the positive control reaction, 260 ng/ul for the glass modified chip and 234 ng/ μL for the fluorosilane modified chip. The respective value for the non-treated chip was calculated at 55 ng/ μL. Such low concentration levels compared to the controls can argue that denatured, short 75 base pair target sequences might also be adsorbed into the channel walls. If it is assumed that the efficiency of the control reaction is 100%, then the ratio of concentration of an on-chip reaction to the concentration of the control would indicate the PCR efficiency. This was calculated at 81% and 90% for the fluorosilane and glass modified chips respectively. The same value for a non-treated chip was 20%.
Fig 9

Band intensity-based estimation of amplicon concentration for on-chip reactions.

Calculations of concentration were based on calibration bands obtained from low molecular weight (25-766bp) DNA ladder of 0.5 and 1 μL loadings, resolved in 2% agarose (45 min, 90V) (S1B_Fig_8_Amplicon_band_intensity_plots in S1 File (DOI: 10.25405/data.ncl.12320396)).

Band intensity-based estimation of amplicon concentration for on-chip reactions.

Calculations of concentration were based on calibration bands obtained from low molecular weight (25-766bp) DNA ladder of 0.5 and 1 μL loadings, resolved in 2% agarose (45 min, 90V) (S1B_Fig_8_Amplicon_band_intensity_plots in S1 File (DOI: 10.25405/data.ncl.12320396)). The capability for customising the surface of SLA prints for reducing non-specific adsorption during PCR, means that further experimentation is possible to create functional devices for nucleic acid amplification applications that can be printed and functionalized in-house at very low costs. This characteristic is highly attractive for prototyping POC molecular diagnostic platforms, as well as cell-based lab-on-chip, where the behaviour of the surfaces that interact with biological fluids is of utmost importance. The proposed methods can form the first stage towards optimization and standardization.

4. Conclusion

Low-cost research prototyping of customised PCR microfluidics is highly desirable within the molecular diagnostics community, driven by the increased demand for low-cost POC molecular diagnostics. The latter is almost exclusively based on amplification of nucleic acids. In this paper we have presented specific processing routes to repeatedly deliver low-cost microfluidic chamber PCR devices printed with DLP SLA in a two-step printing protocol with sacrificial wax. The concept of sacrificial wax is known for realising various enclosed microstructures including microfluidic channels [86] and has been recently reported for fabricating complex flow-through PCR architectures with inkjet 3D printing [53]. In this work, the concept was extended to DLP SLA. The presented method of printing utilizes low viscosity paraffin wax to deliver a unibody non post-processed microfluidic chip in less than 10 minutes. The water-like viscosity of the wax enables complex channel patterns and sizes of few hundred microns. The minimum achievable dimension for enclosed channels is mostly appropriate for diagnostic applications, where the fluid samples range typically at the micro-litre scale for clinical relevance. The raw material unit cost of the printed chips was below £0.20, not including a temperature sensing element or the cost of the functionalization reagents. Indicatively, the cost of the temperature sensor was £0.55 and the functionalization agents £0.6 and £0.02 per chip for fluorosilane and glass respectively. The suggested protocols pose an attractive alternative for microfluidics prototyping, as it requires no tool manufacturing, thus enabling developers to promote or discard ideas faster and cheaper than with conventional processes. In addition, the study showcases that reactive resin chemistries may provide a basis for developing surface treatments to achieve on-demand material performance and hence enable challenging biological applications, such as PCR. The process requires no clean-room setup, but a print post-processing station which can be fitted in any basic research environment. The mask-less patterning capability of DLP SLA together with flexible resin chemistries mean that further experimentation is possible. However, extending the work beyond prototyping volumes is largely a commercial decision, based on the price per chip. Future research will be focused on the optimization of the microfluidic design, material, instrumentation and biology for this method of chip fabrication and temperature control, and the incorporation of further functionalities towards fully 3D printed molecular diagnostics. Additional interest emerges from the potential to couple DLP SLA with CNC micromachining and functional ink-jetting in a hybrid system to automatically produce functional micro-assemblies, including microfluidics in a single manufacturing environment. (RAR) Click here for additional data file. 6 May 2020 PONE-D-20-09489 Fabrication routes via projection stereolithography for 3D-printing of microfluidics for nucleic acid amplification PLOS ONE Dear Dr Tzivelekis, Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process. We would appreciate receiving your revised manuscript by Jun 20 2020 11:59PM. When you are ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file. If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. To enhance the reproducibility of your results, we recommend that if applicable you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols Please include the following items when submitting your revised manuscript: A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). This letter should be uploaded as separate file and labeled 'Response to Reviewers'. A marked-up copy of your manuscript that highlights changes made to the original version. This file should be uploaded as separate file and labeled 'Revised Manuscript with Track Changes'. An unmarked version of your revised paper without tracked changes. This file should be uploaded as separate file and labeled 'Manuscript'. Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out. We look forward to receiving your revised manuscript. Kind regards, Jonathan Claussen Academic Editor PLOS ONE Journal requirements: When submitting your revision, we need you to address these additional requirements: 1.    Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at http://www.plosone.org/attachments/PLOSOne_formatting_sample_main_body.pdf and http://www.plosone.org/attachments/PLOSOne_formatting_sample_title_authors_affiliations.pdf 2. PLOS ONE now requires that authors provide the original uncropped and unadjusted images underlying all blot or gel results reported in a submission’s figures or Supporting Information files. This policy and the journal’s other requirements for blot/gel reporting and figure preparation are described in detail at https://journals.plos.org/plosone/s/figures#loc-blot-and-gel-reporting-requirements and https://journals.plos.org/plosone/s/figures#loc-preparing-figures-from-image-files. When you submit your revised manuscript, please ensure that your figures adhere fully to these guidelines and provide the original underlying images for all blot or gel data reported in your submission. See the following link for instructions on providing the original image data: https://journals.plos.org/plosone/s/figures#loc-original-images-for-blots-and-gels. In your cover letter, please note whether your blot/gel image data are in Supporting Information or posted at a public data repository, provide the repository URL if relevant, and provide specific details as to which raw blot/gel images, if any, are not available. Email us at plosone@plos.org if you have any questions. 3. PLOS requires an ORCID iD for the corresponding author in Editorial Manager on papers submitted after December 6th, 2016. Please ensure that you have an ORCID iD and that it is validated in Editorial Manager. To do this, go to ‘Update my Information’ (in the upper left-hand corner of the main menu), and click on the Fetch/Validate link next to the ORCID field. This will take you to the ORCID site and allow you to create a new iD or authenticate a pre-existing iD in Editorial Manager. Please see the following video for instructions on linking an ORCID iD to your Editorial Manager account: https://www.youtube.com/watch?v=_xcclfuvtxQ 4. Please amend your list of authors on the manuscript to ensure that each author is linked to an affiliation. Authors’ affiliations should reflect the institution where the work was done (if authors moved subsequently, you can also list the new affiliation stating “current affiliation:….” as necessary). 5. Please ensure that you refer to Figure 2-4 and 6 in your text as, if accepted, production will need this reference to link the reader to the figure. 6. Please include captions for your Supporting Information files at the end of your manuscript, and update any in-text citations to match accordingly. Please see our Supporting Information guidelines for more information: http://journals.plos.org/plosone/s/supporting-information. [Note: HTML markup is below. Please do not edit.] Reviewers' comments: Reviewer's Responses to Questions Comments to the Author 1. Is the manuscript technically sound, and do the data support the conclusions? The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1: Yes Reviewer #2: Yes ********** 2. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1: N/A Reviewer #2: Yes ********** 3. Have the authors made all data underlying the findings in their manuscript fully available? The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #1: Yes Reviewer #2: Yes ********** 4. Is the manuscript presented in an intelligible fashion and written in standard English? PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #1: Yes Reviewer #2: Yes ********** 5. Review Comments to the Author Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #1: The manuscript by Tzivelekis and coworkers described the fabrication and testing of a 3D-printed PCR device and thermocycler. Digital Light Processing (DLP) stereolithography (SLA) was used as a high-res 3D printing technique for the fabrication of a monolithic micro-channel PCR device. A UV light and solvent bath was further performed to limit biomolecular adsorption. An IR mediated thermocycler was also built that is fully compatible with the 3D printed PCR device. This device was tested for amplifying a 75 bp subgenomic DNA sequence, the amplicon of which was compared with commercial PCR machines. The authors gave a very nice introduction summarizing the miniaturization of PCR machines using microfluidics and 3D printed devices for nucleic acid analyses. They also correctly identified existing challenges for miniaturizing PCR through 3D printing. The device and the thermocycler have been successfully verified by amplifying DNA sequence through PCR protocol. However, the current manuscript is too preliminary to be published. The authors shall expand more on the application end to validate the device and demonstrate the fluidic controllability. 1. The miniaturized PCR device was claimed to be a microfluidic device. However, there was very little fluidic control demonstrated. The device looks more like a microwell to the reviewer. The authors shall specify more on the fluidic control, e.g. how was the PCR reagents delivered? Ideally, a better device design with fluidic control shall be demonstrated. 2. A related question is the level of complexity that DLP SLA printing would allow. The two-stage dip coating of the hydrophobic layer on chip may increase the production period and difficulty. 3. The authors claimed that “the system is qPCR ready by integration with a fluorescent microscope and qPCR DNA stains. However, this was not demonstrated experimentally in the manuscript. Reviewer #2: The goal of this work is to describe processing protocols for 3-D printed microfluidics using SLA-printing and resin. In addition, the authors demonstrate functional material characteristics and application for static PCR amplification. Overall, the paper is well written with good background detail and relevant literature review. Minor Revisions Suggested: 1. Defining the post-processing steps used in a 3-D printed device is useful but building standards/controls for those processing methods is really what is needed to extend this work beyond the custom chip and application described. Maybe add a comment or two about how this could be or was addressed so that it advances 3-D DLP-SLA printing for the field. 2. Consider adding a scale bar on Figure 4. 3. The three-chamber chip design reduced bubbles (downfall of any microfluidic device) but it was unclear if all three chambers hold 15 uL and are used in the PCR reaction or only the central chamber. Please clarify. 4. Line 284, I believe Figure 5, (d, f) is mislabeled and should be (a, d). 5. Line 287, Figure 5 legend I believe the panels are mislabeled here as well. Shouldn’t it be (a,d) (b,e) and (c,f) with no i panel. 6. Line 311 should reference Figure 7, currently there is an error message. 7. In Figure 7, the gel band alignments and the measurement of the 75 bp amplicon don’t always seem to line up well. I would suggest removing the mfg standard ladder image and label the bp bands on your agarose gel within the figure. Furthermore in panel c, it appears that the gel conditions changed (% agarose?, if so please also indicate in methods or legend) and the largest marker bands are no longer present within the gel but it actually the only one that does align with the marker image at left side of the panel. ********** 6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: No Reviewer #2: No [NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files to be viewed.] While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org. Please note that Supporting Information files do not need this step. 27 May 2020 Part of the present text is mentioned in the uploaded document: Response to Reviewers Dear Reviewers/Editors, we would like to thank you for your time to review the manuscript and the positive evaluation of our work. In general, we consider that the points made by the reviewers are correct and the revision work made to address them improved the manuscript. In the following paragraphs we quote each comment and explain how the revised version of the manuscript is modified around it. We further highlight the updates made in regards with data availability and according to PLOS requirements. Reviewer #1 1. “The miniaturized PCR device was claimed to be a microfluidic device. However, there was very little fluidic control demonstrated. The device looks more like a microwell to the reviewer. The authors shall specify more on the fluidic control, e.g. how was the PCR reagents delivered? Ideally, a better device design with fluidic control shall be demonstrated.” The reviewer makes a good point. We have changed the terminology to refer to a microfluidic chamber, and we discuss the potential for more complex microfluidic devices. In lines 146-149, it was further explained that the microchamber architecture was developed to implement stationary PCR thermocycling which is more reliable compared to the error prone flow-through method when employing resin 3D printed chips as shown in the work of Park and Park (J. Park and H. Park, “Thermal cycling characteristics of a 3D-printed serpentine microchannel for DNA amplification by polymerase chain reaction,” Sensors and Actuators A: Physical, vol. 268, pp. 183-187, 2017). In this way it was possible to characterise PCR inhibition, exclusively owed to material interactions rather than poor temperature control. In the case of flow-through PCR, poor fluidic control emerging from variable deviation levels of printed channel dimensions can result in poor temperature control that would lead to false interpretations of material PCR compatibility. 2. "A related question is the level of complexity that DLP SLA printing would allow. The two-stage dip coating of the hydrophobic layer on chip may increase the production period and difficulty." Complexity of channels achievable with the proposed methods is based on the melt viscosity of the wax, which determines the backpressure required for wax removal and feasibility depends on the bonding strength between the chip and the cap. In lines 354-356 it is mentioned that, the water-like melt viscosity of the low melting point paraffin wax, in combination with the unibody microchannel formed can deliver more complex 2.5D channels, such as heat exchanging architectures found in flow-through thermocycling setups. Although, such a geometry was not required in the present study, as it focuses specifically on the optimization of material properties to enable higher throughput platforms in the future. In regards with the second aspect of this comment, the coating processes for fluorination and glass coating lasted 2 hours and 1 hours respectively, as described in section 3.3 (line 368). These processes could be used for batches of chips, which was mentioned in the manuscript (line 375-376). 3. "The authors claimed that “the system is qPCR ready by integration with a fluorescent microscope and qPCR DNA stains. However, this was not demonstrated experimentally in the manuscript." The text has been amended. To highlight the potential of the proposed method of thermocycling for 3D printed chips, the following statement was added in the conclusions: “From a system point-of-view, the proposed method of thermocycling shows promise for portability and modular integration of functionalities for diagnostic or research applications that utilize nucleic acid amplification technology.” Reviewer #2: 1. "Defining the post-processing steps used in a 3-D printed device is useful but building standards/controls for those processing methods is really what is needed to extend this work beyond the custom chip and application described. Maybe add a comment or two about how this could be or was addressed so that it advances 3-D DLP-SLA printing for the field." Within this paper we present well defined protocols for the processing methods, which can be adopted by researchers more broadly as the first stage towards standardised methods. Extending the work beyond prototyping volumes is largely a commercial decision, based on the price per chip. We have added to the discussion (lines 454-458-) and conclusions (lines 470-472) to consider this point. Further to this comment, and in regards with the creation of standards/controls for the post-processing methods presented, a new section has been added (2.2. Characterisation of printed resin interference with PCR). This section describes a preliminary experiment, that indirectly demonstrates that prolonged UV curing and hot water baths removes PCR inhibiting substances on the prints, facilitating the reaction in low SVR architectures (fluidics and milli fluidics). This method of post-processing was then adopted for the high SVR printed chip geometry, showing that although PCR inhibiting residuals are removed, inhibition due to adsorption becomes dominant in high SVR non-treated prints. This conclusion is drawn, since only hydrophobically modified chips produced amplicons consistent with the controls. 2. "Consider adding a scale bar on Figure 4." A scale bar was added, derived from the 3D CAD model assembly of the PCR thermocycler. Figure 4 was changed to Figure 5. 3. "The three-chamber chip design reduced bubbles (downfall of any microfluidic device) but it was unclear if all three chambers hold 15 uL and are used in the PCR reaction or only the central chamber. Please clarify." It was clarified that all three chambers hold 15 μL of PCR mixture, with each chamber accommodating approximately 5 μL (lines 163-165). Temperature sensing was performed only on the central chamber with the sensing element in contact with the fluid. 4. "Line 284, I believe Figure 5, (d, f) is mislabeled and should be (a, d)." Figure 5 was changed to Figure 6. The figure was relabelled and the referencing in the text was updated. 5. "Line 287, Figure 5 legend I believe the panels are mislabeled here as well. Shouldn’t it be (a,d) (b,e) and (c,f) with no i panel." Figure 5 was changed to Figure 6. The figure was relabelled and the referencing in the text was updated. 6. "Line 311 should reference Figure 7, currently there is an error message." Cross-references were updated. 7. "In Figure 7, the gel band alignments and the measurement of the 75 bp amplicon don’t always seem to line up well. I would suggest removing the mfg standard ladder image and label the bp bands on your agarose gel within the figure. Furthermore in panel c, it appears that the gel conditions changed (% agarose?, if so please also indicate in methods or legend) and the largest marker bands are no longer present within the gel but it actually the only one that does align with the marker image at left side of the panel." Figure 7 was changed to Figure 8. The DNA ladder bands on the gel images were tagged individually. The text and the caption of the figure were further updated by clarifying that the gel representing the reactions performed on a non-treated chip (c panel) was 2% similar to a and b panels, but run for 20 minutes, instead of 45 for the modified printed chips that allowed for full ladder separation. This was for visualizing the faint amplicon generated on the non-treated chip before it was fully absorbed in the agarose gel at the end of the 45-minute run. Due to the early interruption of the agarose gel electrophoresis, the DNA ladder bands in Figure 8 (c), c are not fully separated but appear in groups for 766-100 and 75-25 base pair. This was confirmed by a few-minute additional rerun, which was added as an inset in Figure 8, (c) and is provided in the supporting information (S1_raw_images). However, the image comprehensively conveys the message of intense PCR inhibition owed to the reactivity of the non-treated printed polymer that creates suboptimal conditions, thereby disrupting the outcome of the reaction, providing a false negative. Further changes according to PLOS requirments are summarized below. According to PLOS style requirements, we formatted the manuscript according to the online template. According to PLOS requirements for data availability, we have uploaded the raw data of the paper, including the blot/gel image data according to PLOS requirements, in the data repository of Newcastle university. Separate captions have also been added in the supporting information files. The supplementary information description and individual DOIs are mentioned below, as well as within the manuscript, under each figure and in the related section. The supporting information files added and their DOIs are summarized below: • S1A_raw_images: Raw agarose gel electrophoresis images for the mock PCR reactions presented in 2.2 and on-chip reactions presented in 3.5, Figure 5. (10.25405/data.ncl.12320501) • S1B_Fig_8_Amplicon_band¬_intensity_plots: Amplicon band intensity profiles of the on-chip reactions presented in 3.5, Figure 8. (10.25405/data.ncl.12320396) • S2A_Fig_6_SEM_contact_angle: Raw SEM images and water contact angle visualizations of printed and functionalized disk specimens presented in 3.3, Figure 6. (10.25405/data.ncl.12320837) • S2B_contact_angle: Contact angle values for all functionalized and non-functionalized printed disk specimens presented in 3.3, Figure 6. (10.25405/data.ncl.12320849) • S3_Fig_6_SEM_EDS: Elemental analysis of the surface of printed and functionalized disk specimens presented in 3.3, Figure 6. (10.25405/data.ncl.12320861) • S4_ Fig_7_2_step_PCR-temperature_profile: Temperature profile of the IR PCR system presented in 3.4, Figure 7 for a glass-coated 3D-printed chip ran a two-step PCR thermocycling protocol (10.25405/data.ncl.12320864). An ORDID ID was created for the corresponding author and each author was linked to an institution within the manuscript. All figures are now referenced within the text and are presented just after the text that cites them. Figure captions within the manuscript were also formatted according to guidelines. We hope that we successfully addressed the reviewers’ comments and clarified the presented data, giving a good insight into the versatile capabilities of high-resolution 3D-printing, specifically for microfluidics. We hope that the manuscript now meets the requirements for publication in PLOS one. Yours sincerely, Charalampos Tzivelekis Submitted filename: Response to Reviewers.docx Click here for additional data file. 3 Sep 2020 PONE-D-20-09489R1 Fabrication routes via projection stereolithography for 3D-printing of microfluidics for nucleic acid amplification PLOS ONE Dear Dr. Tzivelekis, Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process. ============================== Please address the points raised by reviewer 3. ============================== Please submit your revised manuscript by Oct 18 2020 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file. Please include the following items when submitting your revised manuscript: A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'. A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'. An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'. If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter. If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols We look forward to receiving your revised manuscript. Kind regards, Andreas Offenhausser Academic Editor PLOS ONE Journal Requirements: Additional Editor Comments (if provided): [Note: HTML markup is below. Please do not edit.] Reviewers' comments: Reviewer's Responses to Questions Comments to the Author 1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation. Reviewer #1: All comments have been addressed Reviewer #3: (No Response) ********** 2. Is the manuscript technically sound, and do the data support the conclusions? The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1: Yes Reviewer #3: Yes ********** 3. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1: Yes Reviewer #3: Yes ********** 4. Have the authors made all data underlying the findings in their manuscript fully available? The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #1: Yes Reviewer #3: Yes ********** 5. Is the manuscript presented in an intelligible fashion and written in standard English? PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #1: Yes Reviewer #3: Yes ********** 6. Review Comments to the Author Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #1: (No Response) Reviewer #3: The original manuscript convincingly demonstrated the need for silanization of 3D printed PCR wells to obtain useful yields of PCR amplicons. The revised manuscript appropriately answered the reviewers’ questions. A few other minor questions could be answered by the authors in order to strengthen the revised manuscript further: 1. One of the problems with SLA 3D printing is the volume shrinkage of the material used upon curing, which could induce high internal stress causing the deformation of material, and may eventually break the material. Did the authors observe or envision any such issues with the material they used? Did curing deformation affect the precision of the printed model? 2. Many resin materials with low viscosity have problems with biocompatibility, perhaps due to the residual photoinitiator or the degree of crosslinking of the material due to low viscosity. Can the authors comment on how the post-processing treatments and silane coupling agents affected biocompatibility? 3. Line 232, Figure 1 legend, change “positioning it” to “positioned”. 4. Line 315, Figure legend 4, add “for” to read it as “basis for further exploration”. 5. Line 423, Figure legend 7, change “denature” to “denaturation”. ********** 7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: No Reviewer #3: No [NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.] While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step. 14 Sep 2020 In the following paragraphs we quote the comments made by reviewer #3 and provide a point-by-point response, where we discuss the points and explain how these are addressed in the manuscript. Reviewer #3: "The original manuscript convincingly demonstrated the need for silanization of 3D printed PCR wells to obtain useful yields of PCR amplicons. The revised manuscript appropriately answered the reviewers’ questions. A few other minor questions could be answered by the authors in order to strengthen the revised manuscript further:" "1. One of the problems with SLA 3D printing is the volume shrinkage of the material used upon curing, which could induce high internal stress causing the deformation of material, and may eventually break the material. Did the authors observe or envision any such issues with the material they used? Did curing deformation affect the precision of the printed model?" We have previously experienced deformations in microfluidic prints induced by over-curing with various resins. These usually result in flatness issues, especially for large print geometries. In this project, the utilized resin is commercially developed for high-definition prints of high thermal stability (e.g. moulds for injection moulding) and displays low deformation. By following the manufacturer’s instruction (Formlabs, 2016) for post-UV curing at approximately 80 mW/cm2*, we observed no distortion, at a level that would impair the device performance. The chips were designed to accommodate 15 μL fluid volumes, which were precisely loaded using a mechanical pipette. The reaction chamber withstood the pressure built during PCR thermocycling, verifying the good bonding quality, while the material remained rigid with no signs of deterioration. Flatness issues were not observed, potentially due to the small chip area and thickness which allowed a level of flexibility. * chips were cured in a custom-built UV oven (355 nm, 0.003- 0.3 W/cm2, resolution 0.003 W/cm2) This point was addressed in the manuscript: In 2.2, line 186-189: “The utilized resin is commercially developed for high-definition prints of high thermal stability and minimum deformation and its main application is 3D printing of thermoforming tools. Layer exposure time was selected at 2 ± 0.1 seconds, so that optimal feature definition is achieved, as it was visually observed (Fig 1, 6)”, line 191-192: “…according to the manufacturer instructions to achieve heat deflection temperature higher than 200°C”, in 3.2, line 382-386: “By following the manufacturer instruction for post-UV curing with an 80 mW/cm2 light source, no distortion was observed at a level that would impair the performance of the printed device. The chips were designed to accommodate 15 μL fluid volumes, which were precisely loaded using a mechanical pipette. No flatness issues were observed, while the small chip area and thickness allowed for a level of flexibility.”, in 3.4, line 423-425: “In terms of the material performance in thermocycling, the reaction chamber withstood the pressure built during PCR and the material remained rigid with no visual signs of deterioration.” "2. Many resin materials with low viscosity have problems with biocompatibility, perhaps due to the residual photoinitiator or the degree of crosslinking of the material due to low viscosity. Can the authors comment on how the post-processing treatments and silane coupling agents affected biocompatibility?" Biocompatibility in the wider sense was not part of this study. The focus was on developing a material suitable for nucleic acid amplification, in a sense that it does not interfere with the amplification process. In this context, the post processing treatments with ultraviolet (UV) curing and washing aim to reduce the amount of residuals (e.g. monomers, oligomers, photoinitator) which can be strong PCR inhibitors (Inhibitory effect of common microfluidic materials on PCR outcome, 2012; Compatibility analysis of 3D printer resin for biological applications, 2016; Inhibition and Facilitation of Nucleic Acid Amplification, 1997). UV curing achieves reduction of residuals through post-polymerization (i.e. consumption of the residuals in the polymer chain), while washing achieves reduction through removal with solvents of high monomer solubility (including water). Silane coupling agents created a hydrophobic passivated surface, reducing the potential for adsorption of components vital to the reaction, such as Taq polymerase (Biochemical analysis and optimization of inhibition and adsorption phenomena in glass-silicon PCR-chips, 2003; Relief of Amplification Inhibition in PCR with Bovine Serum Albumin or T4 Gene 32 Protein, 1996). Considering similar literature and our obtained results, the enzyme is the main adsorbed PCR component. The proposed hydrophobic treatments are appropriate for reducing biological adsorption in 3D printed microfluidics. This comment was addressed in the manuscript by adding the following statements: In 3.1, line 358-361: “UV curing reduced PCR inhibiting residuals by inducing their consumption into the polymerized material and increasing the degree of cross-linking. Water and isopropanol further dissolve print residuals to remove them from the printed surface.”, in 3.5, line 476-480: “Silane treatments exploit the surface reactivity to create a hydrophobic passivated surface, which significantly limits the adsorption interface and level of reactivity. PCR components could not be adsorbed on the hydrophobic surface and the reaction was facilitated. Considering similar literature results, enzyme is the main adsorbed PCR component (Biochemical analysis and optimization of inhibition and adsorption phenomena in glass-silicon PCR-chips, 2003; Relief of Amplification Inhibition in PCR with Bovine Serum Albumin or T4 Gene 32 Protein, 1996). The proposed hydrophobic treatments are appropriate for reducing biological adsorption in 3D printed microfluidics.” "3. Line 232, Figure 1 legend, change “positioning it” to “positioned”." "4. Line 315, Figure legend 4, add “for” to read it as “basis for further exploration”." "5. Line 423, Figure legend 7, change “denature” to “denaturation”." The figure legends were updated. We think that the changes further clarify the presented data and highlight the capability of stereolithorgaphy 3D printing to improve the efficiency of microfluidics rapid prototyping even for challenging applications, under appropriate processing protocols and stategies. Submitted filename: Response to Reviewers.docx Click here for additional data file. 23 Sep 2020 Fabrication routes via projection stereolithography for 3D-printing of microfluidic geometries for nucleic acid amplification PONE-D-20-09489R2 Dear Dr. Tzivelekis, We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements. Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication. An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org. If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org. Kind regards, Andreas Offenhausser Academic Editor PLOS ONE Additional Editor Comments (optional): Reviewers' comments: 9 Oct 2020 PONE-D-20-09489R2 Fabrication routes via projection stereolithography for 3D-printing of microfluidic geometries for nucleic acid amplification Dear Dr. Tzivelekis: I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department. If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org. If we can help with anything else, please email us at plosone@plos.org. Thank you for submitting your work to PLOS ONE and supporting open access. Kind regards, PLOS ONE Editorial Office Staff on behalf of Dr. Andreas Offenhausser Academic Editor PLOS ONE
  56 in total

1.  A 3D bioprinting system to produce human-scale tissue constructs with structural integrity.

Authors:  Hyun-Wook Kang; Sang Jin Lee; In Kap Ko; Carlos Kengla; James J Yoo; Anthony Atala
Journal:  Nat Biotechnol       Date:  2016-02-15       Impact factor: 54.908

2.  Cost-effective three-dimensional printing of visibly transparent microchips within minutes.

Authors:  Aliaa I Shallan; Petr Smejkal; Monika Corban; Rosanne M Guijt; Michael C Breadmore
Journal:  Anal Chem       Date:  2014-02-24       Impact factor: 6.986

3.  3D printed microfluidic circuitry via multijet-based additive manufacturing.

Authors:  R D Sochol; E Sweet; C C Glick; S Venkatesh; A Avetisyan; K F Ekman; A Raulinaitis; A Tsai; A Wienkers; K Korner; K Hanson; A Long; B J Hightower; G Slatton; D C Burnett; T L Massey; K Iwai; L P Lee; K S J Pister; L Lin
Journal:  Lab Chip       Date:  2016-01-04       Impact factor: 6.799

4.  A Point-of-Need infrared mediated PCR platform with compatible lateral flow strip for HPV detection.

Authors:  Wenjia Liu; Mingfang Zhang; Xiaoyan Liu; Alok Sharma; Xianting Ding
Journal:  Biosens Bioelectron       Date:  2017-04-29       Impact factor: 10.618

Review 5.  Existing and Emerging Technologies for Point-of-Care Testing.

Authors:  Andrew St John; Christopher P Price
Journal:  Clin Biochem Rev       Date:  2014-08

6.  Optical Approach to Resin Formulation for 3D Printed Microfluidics.

Authors:  Hua Gong; Michael Beauchamp; Steven Perry; Adam T Woolley; Gregory P Nordin
Journal:  RSC Adv       Date:  2015-12-07       Impact factor: 3.361

7.  3D-printed supercapacitor-powered electrochemiluminescent protein immunoarray.

Authors:  Karteek Kadimisetty; Islam M Mosa; Spundana Malla; Jennifer E Satterwhite-Warden; Tyler M Kuhns; Ronaldo C Faria; Norman H Lee; James F Rusling
Journal:  Biosens Bioelectron       Date:  2015-09-11       Impact factor: 10.618

8.  Simple and Versatile 3D Printed Microfluidics Using Fused Filament Fabrication.

Authors:  Alex J L Morgan; Lorena Hidalgo San Jose; William D Jamieson; Jennifer M Wymant; Bing Song; Phil Stephens; David A Barrow; Oliver K Castell
Journal:  PLoS One       Date:  2016-04-06       Impact factor: 3.240

9.  Fully inkjet-printed microfluidics: a solution to low-cost rapid three-dimensional microfluidics fabrication with numerous electrical and sensing applications.

Authors:  Wenjing Su; Benjamin S Cook; Yunnan Fang; Manos M Tentzeris
Journal:  Sci Rep       Date:  2016-10-07       Impact factor: 4.379

10.  3D Printed Multimaterial Microfluidic Valve.

Authors:  Steven J Keating; Maria Isabella Gariboldi; William G Patrick; Sunanda Sharma; David S Kong; Neri Oxman
Journal:  PLoS One       Date:  2016-08-15       Impact factor: 3.240

View more
  1 in total

1.  A 3D-Printed Microfluidic Device for qPCR Detection of Macrolide-Resistant Mutations of Mycoplasma pneumoniae.

Authors:  Anyan Wang; Zhenhua Wu; Yuhang Huang; Hongbo Zhou; Lei Wu; Chunping Jia; Qiang Chen; Jianlong Zhao
Journal:  Biosensors (Basel)       Date:  2021-10-29
  1 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.