| Literature DB >> 29695837 |
Rémi Veneziano1, Tyson R Shepherd2, Sakul Ratanalert2,3, Leila Bellou2, Chaoqun Tao2, Mark Bathe4.
Abstract
Single-stranded DNA (ssDNA) increases the likelihood of homology directed repair with reduced cellular toxicity. However, ssDNA synthesis strategies are limited by the maximum length attainable, ranging from a few hundred nucleotides for chemical synthesis to a few thousand nucleotides for enzymatic synthesis, as well as limited control over nucleotide composition. Here, we apply purely enzymatic synthesis to generate ssDNA greater than 15 kilobases (kb) using asymmetric PCR, and illustrate the incorporation of diverse modified nucleotides for therapeutic and theranostic applications.Entities:
Mesh:
Substances:
Year: 2018 PMID: 29695837 PMCID: PMC5916881 DOI: 10.1038/s41598-018-24677-5
Source DB: PubMed Journal: Sci Rep ISSN: 2045-2322 Impact factor: 4.379
Figure 1ssDNA production by aPCR. (a) aPCR reactions were assembled with a 50-molar excess of a forward primer for the amplification of a 1,000 nt ssDNA fragment using the M13mp18 ssDNA plasmid as template, and with 10 different polymerases that were tested for highest yield of ssDNA production (upper band: expected dsDNA size is 1,000 bp; lower band: expected ssDNA size is 1,000 nt) as judged by agarose gel electrophoresis (right panel). QuantaBio AccuStart HiFi, polymerase (lane 2, boxed) produced the highest amount without overlapping dsDNA contaminants. 1. Accustart; 2. Accustart HiFi; 3. Accustart II; 4. AccuPrime; 5. GoTaq; 6. DreamTaq; 7. Phusion; 8. Platinum SuperFi; 9. Q5; 10. Tth polymerase. (b) Biochemical validation of ssDNA production by incubating 1,000 nt aPCR reaction products with the ssDNA-specific ExoI or S1 nucleases or dsDNA-specific restriction enzymes EcoRI and NaeI (left panel). Agarose gel electrophoresis of the digestion products as labeled by lane (right panel). M: Marker, C: aPCR product control, ExoI: exonuclease I, S1: S1 nuclease, Enz: EcoRI + NaeI. (c) NEB LongAmp was used to generate ssDNA up to 15,000 nt long using lambda phage dsDNA as template. Purification of the 10 kb fragment shows a single band of higher molecular weight than the M13mp18 ssDNA (7,249 nt). (d) The primer design algorithm aPrime was used to select primers for product sizes between 500 and 3,000 nt using M13mp18 ssDNA as template and the Quantabio Accustart HiFi enzyme. SYBR Safe stained agarose gels illuminated under blue light show dsDNA as yellow bands, while ssDNA show as orange bands.
Figure 2Chemically modified ssDNA produced by aPCR. Accustart Taq polymerase HiFi is able to incorporate various chemically modified dNTPs into ssDNA produced with aPCR. (a) Triphosphate-modified nucleotide incorporation is realized by replacing canonical dNTPs with varying concentration of modified alpha-thiol dNTPs (4 bases). ssDNA production is effective for a replacement of dNTPs up to 75% (upper band: dsDNA 1,000 bp; lower band: ssDNA 1,000 nt). See Fig. S16 for higher percentage of dNTPs replacement. (b) dUTP replacement for dTTP up to 100% in asymmetric production of the ssDNA. Different parts of the same gel and exposure are shown and the split indicated by a white space. See Fig. S17 for the uncropped gel. (c) Cy5 fluorescently modified dCTP can be used to up to 10% replacement of canonical dCTP to be incorporated into the synthesized ssDNA (left). Merged image of ethidium bromide and Cy5 channels. See Fig. S19 for the full ethidium bromide- and Cy5-channel images. The efficiency of incorporation of Cy5-dCTP is quantified by fluorimetry and show approximately 2.5% modification of the Cy5 in ssDNA when 5% of Cy5-modified dCTP are used in aPCR for both 1,000 and 2,000 nt fragments (right). (d) Fluorescently modified ssDNA 2,000 nt is used to fold DNA nanoparticles. DNA stain and fluorescent agarose gel mobility shift assay showing folding of a fluorescent scaffolded DNA origami nanoparticle compared to non-fluorescent DNA nanoparticles.
Primers used to investigate aPCR synthesis conditions.
|
|
|
|
|---|---|---|
| 1,000 | GTCTCGCTGGTGAAAAGAAA | ATTAATGCCGGAGAGGGTAG |
| 3,281 | TCTTTGCCTTGCCTGTATGA | GCTAACGAGCGTCTTTCCAG |