Literature DB >> 27420548

The VanRS Homologous Two-Component System VnlRSAb of the Glycopeptide Producer Amycolatopsis balhimycina Activates Transcription of the vanHAXSc Genes in Streptomyces coelicolor, but not in A. balhimycina.

Regina Kilian1, Hans-Joerg Frasch1, Andreas Kulik1, Wolfgang Wohlleben1,2, Evi Stegmann1,2.   

Abstract

In enterococci and in Streptomyces coelicolor, a glycopeptide nonproducer, the glycopeptide resistance genes vanHAX are colocalized with vanRS. The two-component system (TCS) VanRS activates vanHAX transcription upon sensing the presence of glycopeptides. Amycolatopsis balhimycina, the producer of the vancomycin-like glycopeptide balhimycin, also possesses vanHAXAb genes. The genes for the VanRS-like TCS VnlRSAb, together with the carboxypeptidase gene vanYAb, are part of the balhimycin biosynthetic gene cluster, which is located 2 Mb separate from the vanHAXAb. The deletion of vnlRSAb did not affect glycopeptide resistance or balhimycin production. In the A. balhimycina vnlRAb deletion mutant, the vanHAXAb genes were expressed at the same level as in the wild type, and peptidoglycan (PG) analyses proved the synthesis of resistant PG precursors. Whereas vanHAXAb expression in A. balhimycina does not depend on VnlRAb, a VnlRAb-depending regulation of vanYAb was demonstrated by reverse transcriptase polymerase chain reaction (RT-PCR) and RNA-seq analyses. Although VnlRAb does not regulate the vanHAXAb genes in A. balhimycina, its heterologous expression in the glycopeptide-sensitive S. coelicolor ΔvanRSSc deletion mutant restored glycopeptide resistance. VnlRAb activates the vanHAXSc genes even in the absence of VanS. In addition, expression of vnlRAb increases actinorhodin production and influences morphological differentiation in S. coelicolor.

Entities:  

Mesh:

Substances:

Year:  2016        PMID: 27420548      PMCID: PMC5036315          DOI: 10.1089/mdr.2016.0128

Source DB:  PubMed          Journal:  Microb Drug Resist        ISSN: 1076-6294            Impact factor:   3.431


Introduction

Bacteria need to respond to changes in their environment. Therefore, they require adequate means to gain and process information on the immediate surroundings. Such means are represented by two-component systems (TCSs), which are ubiquitous in all prokaryotes. A typical TCS consists of a sensor histidine kinase (HK) and a response regulator (RR).[1] The HK measures a specific external signal and autophosphorylates at a conserved histidine residue within the cytosol. This phosphoryl group is transferred to the associated RR. The activated RR initiates the cellular response.[2] Most RRs are transcription factors that not only change the gene expression pattern of one or more genes of the cell, but also post-transcriptional and post-translational regulation of RNAs and proteins, respectively, by RRs has been reported.[3] The ability of bacteria to sense the signal enables them to react with an adaptive response. Of special interest is the glycopeptide-sensing TCS VanRS that controls the expression of glycopeptide resistance genes in gram-positive pathogens,[4,5] some glycopeptide producers, and other actinomycetes.[6] VanS is a membrane-standing HK. Its C-terminus extends into the cytoplasm and contains the kinase domain and the phosphorylation site.[7] VanS senses the presence of glycopeptides and catalyses adenosine triphosphate-dependent autophosphorylation of a specific histidine residue. Subsequently, VanS transfers the phosphate group to an aspartate residue of VanR, which then activates the transcription of the resistance genes. However, under noninduction conditions, VanS acts as a phosphatase, removing the phosphate group from VanR.[8] Glycopeptides such as vancomycin, teicoplanin, and telavancin are used for treating infections caused by gram-positive pathogens. They act by binding to the N-acyl-d-alanyl-d-alanine (d-Ala-d-Ala) termini of peptidoglycan (PG) and its precursor lipid II. This binding effectively sequesters the substrate for the transglycosylases and the d,d-transpeptidases, two key enzymes of cell wall synthesis, resulting in an inability to grow and subsequently to cell death. Glycopeptide resistance is mediated by reprogramming cell wall biosynthesis. Ten types of resistances have been characterized so far (VanA-N).[9,10] In each case, the terminal d-alanine (d-Ala) in the pentapeptide side chain of the PG of gram-positive bacteria is substituted either by a d-lactate (d-Lac) (VanA, B, D, F, and M) or a d-serine (VanC, E, G, L and VanN). These substitutions result in a 1000-fold[11] or 6-fold[12] decreased binding affinity of the glycopeptide to its target, respectively. Categorization into the different phenotypes is based on the inducibility, the breadth of resistance to individual compounds, and the level of resistance.[9] Three of those phenotypes, VanC,[13] VanD,[14] and VanN,[15,16] are constitutively expressed. All others are inducible to different degrees by different glycopeptides. It was shown that enterococcus and staphylococcus strains expressing glycopeptide resistance genes constitutively are impaired in growth in comparison with strains where the genes are inducible.[17,18] Apparently, careful control of the expression of these genes is advantageous. Streptomyces coelicolor A3(2) is neither a pathogen nor a glycopeptide producer, but it is likely to encounter glycopeptides in its natural habitat. Therefore, it benefits from carrying vanRS, vanHAX, vanK, and vanJ (Fig. 1C). VanHSc is a d-stereospecific lactate dehydrogenase that converts pyruvate to d-Lac. VanASc is a d-Ala-d-Ala-ligase family protein that ligates d-Ala and d-Lac to d-Ala-d-Lac-depsipeptides. VanXSc is a highly selective carboxypeptidase that cleaves the remaining d-Ala-d-Ala-dipeptide. VanKSc belongs to the Fem family of enzymes, which add the cross-bridging amino acid(s) to the stem pentapeptide of PG precursors.[19] VanY is a membrane protein conferring resistance to teicoplanin. To identify the precise nature of the ligand signal that activates glycopeptide resistance in S. coelicolor A3(2), the VanB-type HK VanSSc, sensing vancomycin, but not teicoplanin, was investigated.[21,22] Investigation on VanSSc revealed opposed results. On the one hand, it was shown by cross-linking experiments that vancomycin is the direct ligand of the VanSSc.[21] On the other hand, Kwun et al.[22] demonstrated that VanSSc is activated by vancomycin in complex with the d-Ala-d-Ala termini of PG precursors.

(A, B) EMBOSS stretcher pairwise sequence alignment of VnlRSAb and VanRSSc. (A) EMBOSS stretcher pairwise sequence alignment of VnlSAb and VanSSc. Transmembrane domains are indicated in blue. The extracytosolic domain is highlighted by a red box. (B) EMBOSS stretcher pairwise sequence alignment of VnlRAb and VanRSc. The site of aspartate phosphorylation is indicated by red and that of the proposed autophosphorylation by green arrow. (C) Organization of the resistance genes in Streptomyces coelicolor compared with that of Amycolatopsis balhimycina. “-” for a mismatch or a gap; “.” for any small positive score; “:” for a similarity, which scores more than 1.0; and “I” for an identity where both sequences have the same residue.

(A, B) EMBOSS stretcher pairwise sequence alignment of VnlRSAb and VanRSSc. (A) EMBOSS stretcher pairwise sequence alignment of VnlSAb and VanSSc. Transmembrane domains are indicated in blue. The extracytosolic domain is highlighted by a red box. (B) EMBOSS stretcher pairwise sequence alignment of VnlRAb and VanRSc. The site of aspartate phosphorylation is indicated by red and that of the proposed autophosphorylation by green arrow. (C) Organization of the resistance genes in Streptomyces coelicolor compared with that of Amycolatopsis balhimycina. “-” for a mismatch or a gap; “.” for any small positive score; “:” for a similarity, which scores more than 1.0; and “I” for an identity where both sequences have the same residue. The actinomycete Amycolatopsis balhimycina produces the glycopeptide balhimycin, a vancomycin-type glycopeptide differing from vancomycin only in the glycosylation pattern.[23,24] The balhimycin biosynthesis gene cluster contains all genes necessary for balhimycin production[25] as well the vanRS-like regulatory genes, vnlRS and the accessory resistance gene vanY (Fig. 1C).[26] VanYAb is a carboxypeptidase which cleaves the endstanding D-Ala-D-Ala-dipeptide from the PG precursors.[27] However, the vanHAX genes are encoded more than 2 Mb apart from the balhimycin biosynthesis cluster. Although VnlRAb does not regulate glycopeptide resistance in A. balhimycina,[27] its heterologous expression in the glycopeptide-sensitive S. coelicolor strain M600 J2301[6] (ΔvanRS) revealed unexpected effects. VnlRAb activates the vanHAX genes, increases actinorhodin production, and influences morphological differentiation in S. coelicolor.

Materials and Methods

Bacterial, strains, plasmids, and primers

The strains and plasmids used for this study are listed in Table 1, the primers used for this study are listed in Table 2.
1.

Bacterial Strains Used in This Study

 Relevant feature(s)References
Strains
Streptomyces coelicolor A3(2)
  M600SCP1- SCP2-[30]
  M600 ΔvanRSSc (J2301)vanRSSc deletion mutant[6]
  M600 ΔvanRSSc [vnlRSAb]ΔvanRSSc complemented with pRM4vnlRSAbThis study
  M600 ΔvanRSSc [vnlRAb]ΔvanRSSc complemented with pRM4vnlRAbThis study
  M600 ΔvanRSSc [vnlSAb]ΔvanRSSc complemented with pRM4vnlSAbThis study
  M600 ΔvanRSSc [vnlRAbD51A]ΔvanRSSc complemented with pRM4vnlRAbD51AThis study
Amycolatopsis balhimycina DSM 5908
  A. balhimycina WT DSM 5908Wildtype[24]
  A. balhimycina ΔvnlRAbvnlRAb deletion mutant[27]
  A. balhimycina [vnlRAb]Overexpression of vnlRAb in A. balhimycina, using pRM4vnlRAbThis study
  A. balhimycina ΔvnlRAb [vnlRAb]ΔvnlRAb complemented with pRM4vnlRAbThis study
  A. balhimycina ΔvnlSAbvnlSAb deletion mutantThis study
Escherichia coli
  XL1-bluerecA1; endA1; gyrA96; tji-1; hsdR17; supE44; relA1; lac [F'proAB, lacqZΔM15Tn10(tetr)][28]
  ET 12567 pUZ8002pUZ8002; kanr[34]
  ET 12567F-; dam13::Tn9; dcm-6; hsdM; hsdR; recF143; zjj201::Tn10; galK2; galT22; ara14; lacY1; xyl15; leuB6; thi1; tonA31; rpsL136; hisG4; tsx78; mtli; glnV44[29]
Plasmids
 pRM4pSET152 ermEp*, RBS, Φ31 attP-int-derived integration vector[31]
 pRM4vnlRSAbExpression plasmid for vnlRSAbThis study
 pRM4vnlRAbExpression plasmid for vnlRAbThis study
 pRM4vnlSAbExpression plasmid for vnlSAbThis study
 pRM4vnlRAbD51AExpression plasmid for vnlRAb,This study
 Exchange of Asp at position 51 with Ala 
 pSP1Inactivation vector in A. balhimycina[32]
 Erythromycin and ampicillin resistance 
 pSPΔvnlSAbpSP1 carrying a 1579 bp upstream and a 1509 bp downstream fragment of vnlSAbThis study

WT, wild type.

2.

Primers Used in This Study

 PrimerSequenceRelevant feature(s)References
1vnlRS-compl.1CATCGGCATATGCGCGTGCTGATCGTCGAGCloning of vnlRSAbThis study
2vnlRS-compl. 2GAATTCCTGCGCGACTCCAGCGTTTCTCAGCGGAAG  
3vnlR-overGAATTCAGGCGTAGCTGAGGCloning of vnlRAbThis study
4vnlS-cloningATCATATGAGCGTCCGCCTCAAACCloning of vnlSAbThis study
5vnlRD51A1GAATATCCCGGgCGAGGACGGRecombinant primers for aa exchangeThis study
6vnlRD51A2CCGTCCTCGcCCGGGATATT  
7vnlSdelFrg1forTTAGAATTCGATTGTCCGCGAGAAATGCloning of vnlSAb upstream regionThis study
8vnlSdelFrg1revTAATCTAGACCCGGCCGCTCTGTC  
9vnlSdelFrg2forTTATCTAGACCGGCCGGGTCACCTCCloning of vnlSAb downstream regionThis study
10vnlSdelFrg2revATTGCATGCGGGCGCAAGTGAGTTTCGGTCATCG  
11pSETerme revATGCTAGTCGCGGTTGAIntegration of Plasmid and InsertThis study
12attBli-fwdTTCTGGAAATCCTCGAAGGCIntegration of plasmid through ΦC31 
13attPint-revTGTGCATGCGCCCACGAATG  
14ery forAAGGGAGAAAGGCGGACAGGProof of erythromycin resistance cassetteThis study
15ery revGTCGCTTCTGCGCAAGTACC  
16vnlSproof forTGCTCGAAGTCCTCGTTTCCIntegration and deletion verificationThis study
17vnlSproof revGCAAGTACGTGAGCGATCAG  
18vanSSc_RT_1CTCCAACTGACCACGAACCTRT-PCR analysis in S. coelicolor M600This study
19vanSSc_RT_2GGTCGGTGTGTATGCGTTC  
20vanRSc_RT_1TGCTGAGTGTCAACGCCTAC  
21vanRSc_RT_2CGAACTGCTTCCTGGTCAAC  
22vanASc_RT_1ACCGTGACAGGAGACGAGAC  
23vanASc_RT_2CTGGTGGATCCGGAAGAAT  
24hrdBSc_RT_1TGACCAGATTCCGGCCACTC This study
25hrdBSc_RT_2CTTCGCTGCGACGCTCTTTC  
26sigB forCGTAGGTCGAGAACTTGAACRT-PCR analysis in A balhimycina DSM5908[41]
27sigB revGTGTCTACCTCAACGGTATC  
28vanH1GGGACAAGCCCATCAAGAAC [27]
29vanA2GAGCGGACTTGACGGAGATG  
30vanY_RT_fwdTCGGCACGAGGATTG  
31vanY_RT_revTTCACGCACAGTTCG  

RT-PCR, reverse transcriptase polymerase chain reaction.

Bacterial Strains Used in This Study WT, wild type. Primers Used in This Study RT-PCR, reverse transcriptase polymerase chain reaction. Escherichia coli XL1-blue[28] was used for cloning purposes, and the methylation-deficient strain E. coli ET12567[29] was used to obtain unmethylated DNA for A. balhimycina transformations. A. balhimycina[24] is the balhimycin-producing wild type (WT) and was used to generate the vnlS deletion as well as the vnlR-overexpressing strains (this study). Furthermore, ΔvnlR deletion[27] was used for complementation (this study). S. coelicolor M600[30] were used to generate S. coelicolor M600 ΔvanRS.[6] This deletion strain was used to generate complementations with vnlRS, vnlR, vnlS, and vnlRD51A (this study). The overexpression plasmids pRM4vnlRSAb, pRM4vnlRAb, pRM4vnlSAb, and pRM4vnlRAbD51A are derived from pRM4[31], a pSET152-derived nonreplicative, ΦC31 integration vector with an integrated constitutive ermEp* promoter, an artificial ribosomal binding site, and an apramycin resistance cassette. The deletion vector pSPΔvnlSAb is derived from pSP1[32] in which flanking regions of vnlS were cloned.

Media and culture conditions

A. balhimycina grown in 100 ml TSB medium (Difco) for 48 hr and 2 ml of this preculture were used to inoculate the main cultures either in 100 ml R5[30] or in TSB medium. R5 medium was used to stimulate balhimycin production, while TSB medium was used when balhimycin production should be prevented. After 48 hr of cultivation, the mycelium was used to isolate PG precursors, to extract DNA, or to perform resistance assays against different glycopeptides. To isolate RNA, the cells were grown 15/39/63 hr. Balhimycin production assays were performed after 5 days of growth. S. coelicolor M145 and M600 were grown on Cullum-agar plates for sporulation. Isolated spores were used to inoculate 10 ml R5 medium as preculture for cell wall precursor extraction or DNA extraction. For RNA isolation, 2 ml of a 48-hr-old TSB preculture was used to inoculate 100 ml of HA medium. The cells were harvested after 69 hr. To compare the growth of the different S. coelicolor strains, 10 μl spores (∼1.5 × 107) of each strain were streaked on a YM plate. The plate was incubated for 7 days. A. balhimycina and S. coelicolor were grown at 30°C, and liquid cultures were shaken at 180 rpm. A. balhimycina and S. coelicolor strains were cultivated in 100 ml of R5 medium in an orbital shaker (220 rpm) in 500-ml baffled Erlenmeyer flasks at 27°C. Liquid/solid media were supplemented with 100 μg/ml apramycin to select for strains carrying integrated antibiotic resistance genes. E. coli was grown in Luria-Bertani broth (Roth) at 37°C using 100 μg/μl apramycin or 150 μg/μl ampicillin for selection of plasmid-containing colonies. Liquid cultures were shaken at 180 rpm.

Plasmid construction

For the heterologous expression in S. coelicolor ΔvanRS, the entire coding regions of the vnlR (Table 2 primer 1 + 3), vnlRS (Table 2 primer 1 + 2), and vnlS (primer 4 + 2) were amplified using Kapa-Hifi proofreading polymerase and the corresponding primers in brackets. The vnlR (758 bp), vnlRS (1908 bp), and vnlS (1198 bp) polymerase chain reaction (PCR) products were integrated into pRM4[31] through the primer-attached restriction sites (Nde-EcoRI) downstream of the ermEp* promoter. Site-directed mutagenesis by overlap extension[33] was performed for the exchange of aspartate at position 51 to an alanine with the primers 5 + 6 (Table 2). The 758 bp PCR product vnlRD51A was integrated into pRM4 through the primer-attached restriction sites (Nde-EcoRI) downstream of the ermEp* promoter. For the in-frame deletion of vnlSb (1125 bp), a 1579 bp upstream fragment (Table 2 primer 7 + 8) and a 1509 bp downstream fragment (Table 2 primer 9 + 10) of vnlS were amplified from A. balhimycina genomic DNA using Kapa-Hifi proofreading polymerase and the corresponding primers in brackets. The plasmid pSPΔvnlS was constructed by integration of the fragments in pSP1[30] through the primer-attached restriction sites at the 5′ and 3′ ends (EcoRI/XbaI and XbaI/SphI) (pSPΔvnlS).

DNA transfer

Transformation of E. coli XL1-blue[28] and ET12567 (pUZ8002)[34] was performed as described previously.[35,36] Plasmids pRM4vnlRSAb, pRM4vnlRAb, pRM4vnlSAb, and pRM4vnlRAbD51A were transferred into S. coelicolor through intergeneric conjugation.[30] Plasmid integration was confirmed by colony PCR using the primer pair 12 + 13 (Table 2) or primer 11 (Table 2) in combination with a reverse primer of corresponding gene. pRM4vnlRAb and pRM4vnlRAbD51A were transferred into A. balhimycina through the direct transformation method[32,37] using unmethylated plasmid DNA isolated from E. coli ET12567. Integration of plasmid was verified by PCR using primer pair 11 + 3 (Table 2). For deletion of vnlS, A. balhimycina WT was transformed with pSPΔvnlSAb by direct transformation. The integration of the plasmid into the chromosome through homologous recombination was confirmed by PCR screening for the erythromycin resistance cassette, using primers ery for and ery rev (Table 2). To obtain deletion mutants, a second homologous recombination event was provoked by stressing plasmid-carrying colonies as described by Puk et al.[38] Colonies were examined for sensitivity to erythromycin, and the deletions were verified by PCR analysis, using primers 16 + 17 (Table 2).

Sequence alignment

The amino acid (AA) sequences of VnlRSAb, VanRSc, and VanSSc are available under accession number Y16952 (named VanRS), (SCO3590), and (SCO3589), respectively. Alignment of the AA sequences was performed by EMBOSS stretcher[39]; (www.ebi.ac.uk/Tools/psa/emboss_stretcher/).

Resistance test, reverse transcriptase polymerase chain reaction analyses, PG precursor, and cell wall analysis

Resistance test, reverse transcriptase polymerase chain reaction (RT-PCR) analyses, extraction of PG precursors, PG isolation, and the high-performance liquid chromatography–mass spectrometry (HPLC-MS) analyses were performed as described.[27,40]

Balhimycin concentration

The balhimycin concentration in 1 ml culture was quantified using HPLC with a photodiode array detector (HPLC-DAD) as described.[40] The balhimycin concentration was calculated to 100 μg/ml total DNA.

Inference of biomass concentration from DNA quantification

For the quantification of total DNA in 1 ml culture, an acid extraction of DNA coupled with a colorimetric method[41] was performed by measuring the absorbance at 600 nm. To analyze the amount of DNA, a standard curve with salmon sperm DNA was generated.

Results

A. balhimycina includes a VanRS homologous TCS (VnlRSAb) encoded in the balhimycin biosynthetic gene cluster

In most of the antibiotic-producing bacteria, the antibiotic biosynthetic gene clusters include resistance genes. One exception is the balhimycin producer A. balhimycina. In this study, the glycopeptide resistance genes vanHAX are located 2 Mb apart from the balhimycin biosynthetic gene cluster. In addition, the resistance is characterized by another unusual feature: the counterpart of the well-known TCS VanRS, which is known to regulate vanHAX expression in pathogens and in S. coelicolor is encoded by genes (vnlRS), which are part of the biosynthetic gene cluster and are therefore not colocated with the vanHAX genes. VanRSSc of S. coelicolor was reported to sense glycopeptides and to activate the expression of the vanHAX genes.[19] To elucidate the differences of the two actinomycete TCSs, we compared the AA sequence of VnlRSAb with the sequence of VanRSSc. Sequence alignment using EMBOSS stretcher[39] revealed 82% sequence similarity between VnlRAb and VanRSc (Sco3590) and 73% between VnlSAb and VanSSc (Sco3589) (Fig. 1A, B). Based on the high similarity, a corresponding function of both RRs could be proposed. In S. coelicolor, VanSSc phosphorylates VanRSc at the aspartate at AA position 51. Replacement of this residue with an alanine completely destroyed the activity of VanRSc.[6] It has been shown that in S. coelicolor, in the absence of vancomycin, acetylphosphate phosphorylates VanRSc, whereas VanSSc acts as a phosphatase to decrease the level of VanRSc∼P. On exposure to vancomycin, VanS activity switches from a phosphatase to a kinase and vancomycin resistance is induced.[6] Furthermore, Novotna et al.[42] specified a serine residue at AA position 69 important for autophosphorylation through acetyl phosphate. Sequence comparison revealed that VnlRAb contains both, a conserved aspartate at AA position 51 (D51) and a serine at AA position 69, the position that probably becomes autophosphorylated through acetyl phosphate (Fig. 1B), indicating an analogous phosphorylation pattern of VnlRAb compared with VanRSc.

The RR VnlRAb does not control expression of the vanHAX genes in A. balhimycina

In A. balhimycina, vanHAX expression does not depend on VnlRSAb. The deletion of vnlR had no effect on glycopeptide resistance and did not result in any obvious phenotype.[27] This raises the interesting question on the function of this TCS in A. balhimycina. Since overexpression of RRs of two-component signal transduction systems often modulates multidrug resistance,[43,44] we overexpressed vnlR in A. balhimycina to analyze the effects on resistance and antibiotic production. vnlR was cloned under the control of the constitutive promoter ermE*p into the integrative plasmid pRM4 (pRM4vnlRAb). pRM4vnlRAb was transferred into A. balhimycina WT and into the A. balhimycina ΔvnlR mutant,[27] resulting in the recombinant strains A. balhimycina [vnlR] and A. balhimycina ΔvnlR [vnlR], respectively. The phenotypes of the recombinant strains overexpressing VnlRAb and (as a control) that of the deletion mutant A. balhimycina ΔvnlR were compared with the WT phenotype (Fig. 2). All strains produced balhimycin at the same level (Fig. 2A). No differences in resistance against balhimycin were observed. Using a method optimized for actinomycetes,[27] muropeptides from all A. balhimycina strains cultivated under balhimycin production conditions were isolated. HPLC/MS chromatograms showed the similar muropeptide composition pattern for all strains (Fig. 2B).

Analysis of balhimycin production, muropeptide composition, and PG precursors in A. balhimycina WT (1), A. balhimycina ΔvnlR (2), A. balhimycina [vnlR] (3), and A. balhimycina ΔvnlR [vnlR] (4). (A) Production of balhimycin measured by HPLC (n = 5). (B) HPLC/MS chromatogram of the muropeptides (positive mode). The first bracket embraces the peaks representing muropeptide monomers, the second the muropeptide dimers. (C) Extracted ion chromatograms of the negative mode from the PG precursors isolated from cells grown in R5 (balhimycin production) and in TSB (no balhimycin production). d-Lac, Pentapeptide precursors ending on d-Ala-d-Lac 1194 m/z at retention time ∼18 min. d-Ala, Pentapeptide precursors ending on d-Ala-d-Ala 1193 m/z at retention time ∼12 min. HPLC, high-performance liquid chromatography; MS, mass spectrometry; PG, peptidoglycan; WT, wild type.

Analysis of balhimycin production, muropeptide composition, and PG precursors in A. balhimycina WT (1), A. balhimycina ΔvnlR (2), A. balhimycina [vnlR] (3), and A. balhimycina ΔvnlR [vnlR] (4). (A) Production of balhimycin measured by HPLC (n = 5). (B) HPLC/MS chromatogram of the muropeptides (positive mode). The first bracket embraces the peaks representing muropeptide monomers, the second the muropeptide dimers. (C) Extracted ion chromatograms of the negative mode from the PG precursors isolated from cells grown in R5 (balhimycin production) and in TSB (no balhimycin production). d-Lac, Pentapeptide precursors ending on d-Ala-d-Lac 1194 m/z at retention time ∼18 min. d-Ala, Pentapeptide precursors ending on d-Ala-d-Ala 1193 m/z at retention time ∼12 min. HPLC, high-performance liquid chromatography; MS, mass spectrometry; PG, peptidoglycan; WT, wild type. In addition to muropeptides, the PG precursors were analyzed. For this purpose, we cultivated the strains under balhimycin production conditions and conditions under which balhimycin production is disabled. Under production as well as under nonproduction conditions, A. balhimycina WT, A. balhimycina [vnlR], A. balhimycina ΔvnlR, and A. balhimycina ΔvnlR [vnlR] produced resistant PG precursors ending with d-Ala-d-Lac (Fig. 2C). Only A. balhimycina WT and A. balhimycina ΔvnlR [vnlR] produced traces of precursors ending with d-Ala-d-Ala under nonproduction conditions (Fig. 2C). These results suggest that VnlRAb does not regulate the synthesis of resistance PG in A. balhimycina. RT-PCR analyses revealed that a vanHAX transcript was detectable in A. balhimycina ΔvnlR, confirming that the expression of vanHAX is independent of vnlR (Fig. 3).

RT-PCR analyses of vanHAX and vanY in A. balhimycina WT, A. balhimycina ΔvnlR, and in A. balhimycina WT overexpressing vnlR (WT [vnlR]). RNA was isolated at different time points (15/39/63 hr) from the three strains cultivated in balhimycin production medium R5. sigB: transcription of the housekeeping gene sigB. vanHAX and vanY: transcription of vanHAX and vanY. For PCR, genomic DNA (gDNA) was used as positive control.

RT-PCR analyses of vanHAX and vanY in A. balhimycina WT, A. balhimycina ΔvnlR, and in A. balhimycina WT overexpressing vnlR (WT [vnlR]). RNA was isolated at different time points (15/39/63 hr) from the three strains cultivated in balhimycin production medium R5. sigB: transcription of the housekeeping gene sigB. vanHAX and vanY: transcription of vanHAX and vanY. For PCR, genomic DNA (gDNA) was used as positive control.

In A. balhimycina, sensing of glycopeptides through VnlSAb is not required for expressing the resistance genes

In enterococci and in S. coelicolor, the RR VanRSc becomes phosphorylated by the HK VanSSc. To analyze whether and how VnlRAb interacts with VnlSAb, we constructed an in-frame ΔvnlS mutant of A. balhimycina using the inactivation plasmid pSPΔvnlSAb. This plasmid containing a 1509 bp downstream fragment and a 1579 bp upstream fragment of vnlS was introduced into A. balhimycina through direct transformation. Successive homologous recombination resulted in the deletion of vnlS. A. balhimycina ΔvnlS showed neither a defect in balhimycin production nor resistance toward glycopeptides. In addition, no changes in the PG precursor and in the nascent PG composition in comparison with A. balhimycina WT were observed (data not shown). These results suggested that sensing the presence of glycopeptides does not correlate with balhimycin production and glycopeptide resistance. Apparently, the expression of the vanHAX genes occurs independently of VnlSAb.

VnlRAb is able to activate vanHAX transcription in S. coelicolor

In silico analyses revealed similar characteristics of VnlRSAb compared with VanRSSc. However, as shown above, the VnlRSAb system in A. balhimycina, in contrast to VanRSSc in S. coelicolor, does not regulate the vanHAX. To clarify the contradictory findings, the genes encoding the TCS VnlRSAb as well as VnlRAb and VnlSAb individually were transferred into the S. coelicolor mutant strain, in which the vanRS genes were deleted,[6] to elucidate the ability of VnlRAb to activate the vanHAX genes in the S. coelicolor mutant. vnlRS, vnlR, and vnlS were introduced into S. coelicolor ΔvanRS under the control of the constitutive promoter ermEp* using the integrative plasmid pRM4vnlRAb. The growth of the recombinant strains was tested on glycopeptide-containing plates. Introduction of vnlRS and of vnlR alone into S. coelicolor M600 ΔvanRS resulted in balhimycin-resistant strains (Fig. 4). In contrast, expression of vnlS alone did not change the glycopeptide-sensitive phenotype of the S. coelicolor ΔvanRS mutant. These results indicated that VnlRAb from A. balhimycina is able to activate the transcription of vanHAXSc in S. coelicolor M600 also in the absence of VnlSAb. Since in S. coelicolor M600 VanRSc∼P can be generated in a VanSSc-independent manner using acetylphosphate,[6] we suggest a similar activation of VnlRAb in the absence of VnlSAb or VanSSc.

Growth and resistance of the S. coelicolor M600 ΔvanRS complemented with different combinations of vnlRS. (A) Growth on YM agar containing no antibiotic. (B) Growth on YM agar containing apramycin (100 mg/ml) (Apra 100) to prove plasmid integration. (C) Growth on YM agar containing balhimycin (10 mg/ml) (Bal 10). (D) Growth on YM agar containing teicoplanin (10 mg/ml) (Teico 10). (E) Growth on YM agar containing no antibiotic. M600, S. coelicolor M600.

Growth and resistance of the S. coelicolor M600 ΔvanRS complemented with different combinations of vnlRS. (A) Growth on YM agar containing no antibiotic. (B) Growth on YM agar containing apramycin (100 mg/ml) (Apra 100) to prove plasmid integration. (C) Growth on YM agar containing balhimycin (10 mg/ml) (Bal 10). (D) Growth on YM agar containing teicoplanin (10 mg/ml) (Teico 10). (E) Growth on YM agar containing no antibiotic. M600, S. coelicolor M600. The activation of the vanHAX genes in the complemented S. coelicolor M600 ΔvanRS mutant with vnlRS and vnlR was further analyzed by RT-PCR. For this purpose, RNA was isolated from 25-hr-old liquid cultures grown without addition of any glycopeptide. A vanHAX transcript was detected when S. coelicolor M600 ΔvanRS was complemented with vnlRS or with vnlR alone. However, in S. coelicolor M600 and in the S. coelicolor M600 ΔvanRS mutant, transcription of the vanHAX failed (Fig. 5), confirming the functionality of VnlRAb as transcriptional activator in S. coelicolor.

RT-PCR analyses of S. coelicolor M600 and different S. coelicolor M600 mutants. RNA was isolated after 25 hr of cultivation in the absence of any glycopeptide. hrdB: transcription of the housekeeping gene hrdB. vanS, vanR, and vanHAX: transcription of vanS, vanR, and vanHAX. For PCR, genomic DNA (gDNA) was used as positive control.

RT-PCR analyses of S. coelicolor M600 and different S. coelicolor M600 mutants. RNA was isolated after 25 hr of cultivation in the absence of any glycopeptide. hrdB: transcription of the housekeeping gene hrdB. vanS, vanR, and vanHAX: transcription of vanS, vanR, and vanHAX. For PCR, genomic DNA (gDNA) was used as positive control. To investigate whether transcription of the vanHAX genes indeed resulted in the formation of glycopeptide-resistant PG precursors, which caused the resistant phenotype, we used HPLC/MS to analyze the PG precursor composition of S. coelicolor M600 ΔvanRS and of S. coelicolor M600 ΔvanRS complemented either with vnlRS or vnlR. Complementing S. coelicolor M600 ΔvanRS with vnlRS or with vnlR restored the synthesis of resistant PG precursors. In the presence of balhimycin exclusively, PG precursors ending with d-Ala-d-Lac were synthesized (Fig. 6C, D). The PG precursor composition of the glycopeptide-sensitive S. coelicolor M600 ΔvanRS mutant was analyzed after growing the strain in the absence of balhimycin. In this mutant, only sensitive cell wall precursors ending on d-Ala-d-Ala (1193 m/z) eluting at a retention time of 10–11 min were detected (Fig. 6A).

Extracted ion chromatograms (negative mode) of the PG precursors isolated from cells grown in R5 medium without antibiotic or with 25 mg/ml balhimycin (bal25). M600 ΔvanRS: S. coelicolor M600 ΔvanRS; d-Lac, pentapeptide precursors ending on d-Ala-d-Lac 1194 m/z at retention time ∼18 min; d-Ala, pentapeptide precursors ending on d-Ala-d-Ala 1193 m/z at retention time ∼14 min.

Extracted ion chromatograms (negative mode) of the PG precursors isolated from cells grown in R5 medium without antibiotic or with 25 mg/ml balhimycin (bal25). M600 ΔvanRS: S. coelicolor M600 ΔvanRS; d-Lac, pentapeptide precursors ending on d-Ala-d-Lac 1194 m/z at retention time ∼18 min; d-Ala, pentapeptide precursors ending on d-Ala-d-Ala 1193 m/z at retention time ∼14 min.

The phosphorylation site D51 is essential for the function of VnlRAb

To define the phosphorylation site of VnlRAb, D51, which was identified as a likely phosphorylation site by sequence composition (Fig. 1), was replaced by an alanine by exchanging nucleotide A to C at position 161 of vnlR using the recombinant PCR method. The exchange was verified by sequence analysis. The mutated gene was cloned into the integrative vector pRM4 under the control of the ermEp* promoter and introduced into S. coelicolor M600 ΔvanRS The resulting recombinant strain was not able to grow in the presence of the tested glycopeptides (Fig. 4). Therefore, we propose D51 as the VnlRAb phosphorylation site.

VnlRAb expands the glycopeptide resistance in S. coelicolor

The glycopeptide resistance mechanism in S. coelicolor belongs to the VanB type of resistance, meaning that glycopeptide resistance can only be induced by vancomycin or vancomycin-type glycopeptides, whereas teicoplanin (a type IV glycopeptide) fails to activate resistance,[42] resulting in a teicoplanin-sensitive phenotype of S. coelicolor. In contrast, A. balhimycina is resistant against vancomycin- as well as teicoplanin-type glycopeptides. To analyze whether the RR is responsible for determination of the glycopeptide resistance type, the recombinant strains S. coelicolor ΔvanRS [vnlRS], S. coelicolor ΔvanRS [vnlR], S. coelicolor ΔvanRS [vnlS], and S. coelicolor ΔvanRS [vnlRS D51A] were grown on teicoplanin-containing plates. Surprisingly, the recombinant strains (S. coelicolor ΔvanRS [vnlRS], S. coelicolor ΔvanRS [vnlR]) were able to grow also on teicoplanin-containing plates, whereas growth of S. coelicolor M600 WT was inhibited (Fig. 4). These results indicated that VnlRAb is able to induce teicoplanin resistance in S. coelicolor M600 by probably activating further genes required for teicoplanin resistance.

VnlRAb influences antibiotic production in S. coelicolor

To analyze if the heterologous expression of VnlRAb, in addition to the activation of the vanHAX genes, causes further (morphological) changes in S. coelicolor M600, the growth and production of actinorhodin were investigated without the addition of any antibiotic. Similar titers of spores (1.5 × 107) of S. coelicolor M600, S. coelicolor ΔvanRS, S. coelicolor ΔvanRS [vnlRS], S. coelicolor ΔvanRS [vnlR], S. coelicolor ΔvanRS [vnlS], and S. coelicolor ΔvanRS [vnlRS D51A] were plated on YM medium. Surprisingly, the heterologous expression of vnlRS or vnlR alone in S. coelicolor M600 ΔvanRS caused retardation in growth and increased actinorhodin production (Fig. 4E). These results suggested that VnlRAb is not only able to activate the vanHAX genes in S. coelicolor M600 and to change its glycopeptide resistance type but it also has effects on other genes in S. coelicolor M600.

VnlRAb is responsible for the activation of vanY

Heterologous expression of VnlRAb in S. coelicolor confirmed that it can take over the VanRSc function to induce the expression of the vanHAX genes and, in addition, can apparently induce the expression of further genes. In contrast, it is not involved in regulation of the vanHAX genes in A. balhimycina. Since regulatory genes are often colocalized with its target genes, we speculated that VnlRSAb might control vanY, which is located directly adjacent to vnlR and which encodes a carboxypeptidase. Previous studies showed that VanYAb cleaves the d-Ala-d-Ala dipeptide from the PG precursors, but it is not able to cleave the d-Ala-d-Lac depsipeptide.[27] To investigate, whether VnlRAb regulates the expression of vanY, transcriptional analyses were performed. RT-PCR analyses revealed that vanY was only transcribed when vnlR was expressed under the control of the strong promoter ermE*p (Fig. 2 (A. balhimycina [vnlR]). In A. balhimycina WT, transcription was detectable on a low level only after 63 hr of cultivation and in the A. balhimycina ΔvnlR mutant, vanY transcription was not induced at all (Fig. 2). This result was confirmed by RNA-seq analyses where we compared the transcription level of vanY in the A. balhimycina WT and A. balhimycina ΔvnlR (data not shown). The transcription of vanY was 25-fold decreased in A. balhimycina ΔvnlR compared with A. balhimycina WT. We therefore concluded that the RR VnlRAb in A. balhimycina is involved in controlling the expression of resistance mediated by VanYAb.

Discussion

Glycopeptide resistance in pathogens and in S. coelicolor is mediated by the action of VanHAX. The expression of the vanHAX genes is regulated by the TCS VanRS, the genes of which are colocalized with vanHAX. In the presence of glycopeptides, VanS becomes autophosphorylated and phosphorylates VanR, which subsequently activates transcription of vanHAX. VanH, VanA, and VanH reprogram the biosynthesis of the PG precursors, resulting in lipid II with an N-terminal d-Ala-d-Lac depsipeptide instead of the normally occurring d-Ala-d-Ala termini, the target of the glycopeptides. A. balhimycina produces the vancomycin-like glycopeptide balhimycin and has to protect itself from the action of the glycopeptide.[45] The genome of A. balhimycina includes vanHAX genes and vanRS-like genes (vnlRS). However, in contrast to other glycopeptide-resistant bacteria, the vanHAX genes in A. balhimycina are located 2 Mb apart from the vnlRS genes, which are part of the balhimycin biosynthetic gene cluster.[40] RT-PCR experiments revealed that VnlRAb is not involved in the activation of the vanHAXb genes in A. balhimycina. Subsequent PG analyses confirmed that a vnlR deletion mutant cannot synthesize resistant muropeptides. Since vnlR is colocalized with the balhimycin biosynthetic genes, an alternative role of VnlRAb as regulator of balhimycin synthesis was assumed, but the deletion of the vnlR did not affect balhimycin production. Hence, VnlRAb is not the central regulator activating the vanHAXb resistance genes or the balhimycin biosynthetic genes. To further investigate the potential target gene(s) of VnlRAb, we analyzed the transcription of vanY, which encodes a carboxypeptidase and which is located adjacent to the vnlRS genes in the balhimycin biosynthetic gene cluster.[25] RT-PCR and RNA-seq analyses revealed that vanY expression was 25-fold decreased in A. balhimycina ΔvnlRAb compared with A. balhimycina WT. VanYAb is a d,d-carboxypeptidase, which cleaves the endstanding d-Ala from lipid II, resulting in the formation of tetrapeptides.[27] In contrast to other described carboxypeptidases,[46] VanYAb has no d,d-carboxyesterase activity. The tetrapeptides are the substrates for the l,d-transpeptidase (Ldt), which subsequently cross-links the tetrapeptide acyl donors at the third AA. This results in PG with 3–3 cross-linked tetra- and tripeptides, which are devoid of the d-Ala-d-Ala-ending peptides, and which can therefore not serve as target of glycopeptides anymore.[47] Investigations of the PG of A. balhimycina revealed the presence of 3–3 cross-linked tetra- and tripeptides.[40,45] Furthermore, we could identify at least three ldt genes in the genome of A. balhimycina.[45] We therefore speculate that by activating the expression of vanY, VnlRAb is involved in regulating an alternative, VanHAXAb-independent glycopeptide resistance mechanism in A. balhimycina. This fact is further confirmed by RT-PCR analysis, where it was shown that VanYAb is expressed in A. balhimycina ΔvanHAX.[40] This observation is in accordance with the findings in Nonomuraea ATCC 39727, the producer of the dalbavancin precursor A40926. Nonomuraea ATCC 39727 does not encode VanHAX homologs, but possesses a VanY homolog (VanYn) for the synthesis of a resistant PG precursor.[48] As described for A. balhimycina, VanYn cleaves the C-terminal d-Ala from the pentapeptide as well as from the d-Ala-d-Ala dipeptide. The tetrapeptides are subsequently cross-linked by Ldt, resulting in glycopeptide-resistant cell wall.[47] The surprising features of VnlRAb are that although it does not regulate the transcription of the vanHAX genes in A. balhimycina, it is able to activate vanHAX transcription in S. coelicolor, and that it activates teicoplanin resistance in S. coelicolor. Activation of the vanHAX transcription can be explained by the binding of VnlRAb at the promoter region of vanHAX Sequence comparison of the promoter regions of vanHAX and vanHAX not only revealed conserved motives but also some differences (data not shown). Although many attempts have been made to analyze putative promoter sequences in gel mobility assays, no shifts could be observed. This is probably due to the fact that after purification, the protein lost its functionality (data not shown). Therefore, determination of the exact binding motive of VnlRAb still requires alternative approaches. VnlRAb was not only able to restore vancomycin resistance in an S. coelicolor ΔvanRS mutant after heterologous expression but it even conferred teicoplanin resistance to this mutant, although S. coelicolor WT is sensitive toward teicoplanin. Recent comparative study of the VanR-VanS systems from two Streptomyces strains, S. coelicolor and Streptomyces toyocaensis (the producer of the sugarless glycopeptide A47934), indicated that the glycopeptide antibiotic inducer specificity is determined solely by the differences between the AA sequences of the VanR-VanS TCS present in each strain rather than by any inherent differences in general cell properties, including cell wall structure and biosynthesis.[42] On the one hand, the results obtained in this work support this finding; since vnlR is under the control of the ermEp* promoter, VnlRAb is constitutively expressed and activates the transcription of the vanHAXJK genes in S. coelicolor independent from the presence of any glycopeptide. The activation of vanHAXJK resulted in the synthesis of PG with pentapeptides ending on d-Ala-d-Lac depsipeptide, which are resistant against vancomycin and teicoplanin. On the other hand, the second explanation contradicts the work of Novotna et al.[42]; it is likely that VnlRAb activates the transcription of additional unknown genes, which mediate teicoplanin resistance. The diverse functionality of VnlRAb in the glycopeptide producer A. balhimycina and in the nonproducer S. coelicolor provides the starting point of evolutionary analyses of glycopeptide resistance. In pathogenic bacteria and in S. coelicolor of glycopeptides, resistance is strictly regulated and is induced by the presence of glycopeptides. In contrast, glycopeptide producers overcome this regulation not only by the constitutive expression of the vanHAX genes but also by the development of a vanHAX-independent resistance mechanism. However, the ability of VnlRAb to activate transcription of vanHAX in S. coelicolor is an indication of a common origin of the three glycopeptide resistance mechanisms, the inducible one, the constitutively expressed, and the vanHAX-independent mechanism. Whether and how the complex resistance mechanism has evolved in the glycopeptide producers and whether and how it was transferred into resistance pathogens have to be subjects of future investigation.
  45 in total

Review 1.  Specificity in two-component signal transduction pathways.

Authors:  Michael T Laub; Mark Goulian
Journal:  Annu Rev Genet       Date:  2007       Impact factor: 16.830

2.  Identification of VanN-type vancomycin resistance in an Enterococcus faecium isolate from chicken meat in Japan.

Authors:  Takahiro Nomura; Koichi Tanimoto; Keigo Shibayama; Yoshichika Arakawa; Shuhei Fujimoto; Yasuyoshi Ike; Haruyoshi Tomita
Journal:  Antimicrob Agents Chemother       Date:  2012-09-24       Impact factor: 5.191

3.  Association constants for the binding of vancomycin and teicoplanin to N-acetyl-D-alanyl-D-alanine and N-acetyl-D-alanyl-D-serine.

Authors:  D Billot-Klein; D Blanot; L Gutmann; J van Heijenoort
Journal:  Biochem J       Date:  1994-12-15       Impact factor: 3.857

4.  The VanS-VanR two-component regulatory system controls synthesis of depsipeptide peptidoglycan precursors in Enterococcus faecium BM4147.

Authors:  M Arthur; C Molinas; P Courvalin
Journal:  J Bacteriol       Date:  1992-04       Impact factor: 3.490

5.  The vancomycin resistance VanRS two-component signal transduction system of Streptomyces coelicolor.

Authors:  Matthew I Hutchings; Hee-Jeon Hong; Mark J Buttner
Journal:  Mol Microbiol       Date:  2006-02       Impact factor: 3.501

6.  Self-resistance and cell wall composition in the glycopeptide producer Amycolatopsis balhimycina.

Authors:  Till F Schäberle; Waldemar Vollmer; Hans-Jörg Frasch; Stephan Hüttel; Andreas Kulik; Marlene Röttgen; Anna-Katharina von Thaler; Wolfgang Wohlleben; Evi Stegmann
Journal:  Antimicrob Agents Chemother       Date:  2011-06-20       Impact factor: 5.191

7.  Novel mechanism of glycopeptide resistance in the A40926 producer Nonomuraea sp. ATCC 39727.

Authors:  Giorgia Letizia Marcone; Fabrizio Beltrametti; Elisa Binda; Lucia Carrano; Lucy Foulston; Andrew Hesketh; Mervyn Bibb; Flavia Marinelli
Journal:  Antimicrob Agents Chemother       Date:  2010-03-22       Impact factor: 5.191

8.  Characterization of an inducible vancomycin resistance system in Streptomyces coelicolor reveals a novel gene (vanK) required for drug resistance.

Authors:  Hee-Jeon Hong; Matthew I Hutchings; John M Neu; Gerard D Wright; Mark S B Paget; Mark J Buttner
Journal:  Mol Microbiol       Date:  2004-05       Impact factor: 3.501

9.  The border sequence of the balhimycin biosynthesis gene cluster from Amycolatopsis balhimycina contains bbr, encoding a StrR-like pathway-specific regulator.

Authors:  Riham M Shawky; Oliver Puk; Andreas Wietzorrek; Stefan Pelzer; Eriko Takano; Wolfgang Wohlleben; Efthimia Stegmann
Journal:  J Mol Microbiol Biotechnol       Date:  2007

10.  Fitness cost of VanA-type vancomycin resistance in methicillin-resistant Staphylococcus aureus.

Authors:  Marie-Laure Foucault; Patrice Courvalin; Catherine Grillot-Courvalin
Journal:  Antimicrob Agents Chemother       Date:  2009-03-30       Impact factor: 5.191

View more
  7 in total

Review 1.  Comparison of Antibiotic Resistance Mechanisms in Antibiotic-Producing and Pathogenic Bacteria.

Authors:  Hiroshi Ogawara
Journal:  Molecules       Date:  2019-09-21       Impact factor: 4.411

Review 2.  Teicoplanin biosynthesis: unraveling the interplay of structural, regulatory, and resistance genes.

Authors:  Oleksandr Yushchuk; Bohdan Ostash; Andrew W Truman; Flavia Marinelli; Victor Fedorenko
Journal:  Appl Microbiol Biotechnol       Date:  2020-02-19       Impact factor: 5.560

3.  Integrating vectors for genetic studies in the rare Actinomycete Amycolatopsis marina.

Authors:  Hong Gao; Buvani Murugesan; Janina Hoßbach; Stephanie K Evans; W Marshall Stark; Margaret C M Smith
Journal:  BMC Biotechnol       Date:  2019-06-04       Impact factor: 2.563

4.  A Two-Component regulatory system with opposite effects on glycopeptide antibiotic biosynthesis and resistance.

Authors:  Rosa Alduina; Arianna Tocchetti; Salvatore Costa; Clelia Ferraro; Patrizia Cancemi; Margherita Sosio; Stefano Donadio
Journal:  Sci Rep       Date:  2020-04-10       Impact factor: 4.379

Review 5.  Multidrug Resistance (MDR) and Collateral Sensitivity in Bacteria, with Special Attention to Genetic and Evolutionary Aspects and to the Perspectives of Antimicrobial Peptides-A Review.

Authors:  András Fodor; Birhan Addisie Abate; Péter Deák; László Fodor; Ervin Gyenge; Michael G Klein; Zsuzsanna Koncz; Josephat Muvevi; László Ötvös; Gyöngyi Székely; Dávid Vozik; László Makrai
Journal:  Pathogens       Date:  2020-06-29

6.  Specificity of Induction of Glycopeptide Antibiotic Resistance in the Producing Actinomycetes.

Authors:  Elisa Binda; Pamela Cappelletti; Flavia Marinelli; Giorgia Letizia Marcone
Journal:  Antibiotics (Basel)       Date:  2018-04-25

7.  Genomic Insights into the Distribution and Phylogeny of Glycopeptide Resistance Determinants within the Actinobacteria Phylum.

Authors:  Andrés Andreo-Vidal; Elisa Binda; Victor Fedorenko; Flavia Marinelli; Oleksandr Yushchuk
Journal:  Antibiotics (Basel)       Date:  2021-12-14
  7 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.