Literature DB >> 23987569

Carbon dioxide fixation by Calvin-Cycle enzymes improves ethanol yield in yeast.

Víctor Guadalupe-Medina1, H Wouter Wisselink, Marijke Ah Luttik, Erik de Hulster, Jean-Marc Daran, Jack T Pronk, Antonius Ja van Maris.   

Abstract

BACKGROUND: Redox-cofactor balancing constrains product yields in anaerobic fermentation processes. This challenge is exemplified by the formation of glycerol as major by-product in yeast-based bioethanol production, which is a direct consequence of the need to reoxidize excess NADH and causes a loss of conversion efficiency. Enabling the use of CO2 as electron acceptor for NADH oxidation in heterotrophic microorganisms would increase product yields in industrial biotechnology.
RESULTS: A hitherto unexplored strategy to address this redox challenge is the functional expression in yeast of enzymes from autotrophs, thereby enabling the use of CO2 as electron acceptor for NADH reoxidation. Functional expression of the Calvin cycle enzymes phosphoribulokinase (PRK) and ribulose-1,5-bisphosphate carboxylase (Rubisco) in Saccharomyces cerevisiae led to a 90% reduction of the by-product glycerol and a 10% increase in ethanol production in sugar-limited chemostat cultures on a mixture of glucose and galactose. Co-expression of the Escherichia coli chaperones GroEL and GroES was key to successful expression of CbbM, a form-II Rubisco from the chemolithoautotrophic bacterium Thiobacillus denitrificans in yeast.
CONCLUSIONS: Our results demonstrate functional expression of Rubisco in a heterotrophic eukaryote and demonstrate how incorporation of CO2 as a co-substrate in metabolic engineering of heterotrophic industrial microorganisms can be used to improve product yields. Rapid advances in molecular biology should allow for rapid insertion of this 4-gene expression cassette in industrial yeast strains to improve production, not only of 1st and 2nd generation ethanol production, but also of other renewable fuels or chemicals.

Entities:  

Year:  2013        PMID: 23987569      PMCID: PMC3766054          DOI: 10.1186/1754-6834-6-125

Source DB:  PubMed          Journal:  Biotechnol Biofuels        ISSN: 1754-6834            Impact factor:   6.040


Background

The yeast Saccharomyces cerevisiae is not only used for the large-scale production of fuel ethanol [1], but also for industrial production of a broad and rapidly expanding range of other chemical compounds from renewable carbohydrate feedstocks [2,3]. In anaerobic, ethanol-producing cultures of S. cerevisiae, excess NADH generated from biosynthetic reactions, such as NAD+-dependent oxidative decarboxylations involved in synthesis of the precursors acetyl-CoA and 2-oxoglutarate, is reoxidized by reducing part of the sugar substrate to glycerol [4]. In growing anaerobic yeast cultures, glycerol production typically accounts for 4-10% of the total sugar consumption and therefore has a significant impact on ethanol yields and process economy in both 1st and 2nd generation large-scale bioethanol production [5,6]. Using CO2 as electron acceptor for the reoxidation of NADH would be a highly attractive metabolic engineering strategy, in particular when CO2 reduction can be coupled to the formation of the product of interest. Functional expression of the Calvin cycle enzymes phosphoribulokinase (PRK) and ribulose-1,5-bisphosphate carboxylase (Rubisco) in S. cerevisiae should enable the coupling of CO2, a major product of alcoholic fermentation, to ribulose-5-phosphate, a normal intermediate of the S. cerevisiae pentose-phosphate pathway (Figure 1). The resulting two molecules of 3-phosphoglycerate can subsequently be converted to 2 molecules each of ethanol and CO2, with the concomitant net oxidation of 2 molecules of NADH to NAD+ (Figure 1). When ribulose-5-phosphate is formed via the oxidative pentose-phosphate pathway (Figure 1), this route results in a transhydrogenase-type conversion of redox cofactors (NADP+ + NADH → NADPH + NAD+). Since the total amount of NADPH required in biosynthesis is smaller than the amount of NADH generated [7], such a transhydrogenase-like activity cannot fully replace glycerol formation as a mechanism for reoxidizing biosynthetic NADH. However, no such constraint exists when ribulose-5-phosphate is formed from intermediates of glycolysis via the rearrangement reactions of the non-oxidative pentose-phosphate pathway (Figure 1). A theoretical analysis shows that complete replacement of glycerol production with CO2 incorporation through PRK and Rubisco can increase the ethanol yield of sugar by as much as 14% (Figure 1).
Figure 1

Schematic representation of central carbon metabolism and the introduced Calvin-cycle enzymes in . Orange: Formation of biomass and NADH from glucose and NADPH. Stoichiometries are according to Verduyn et al.[7]; Blue: Redox-neutral, ATP-yielding alcoholic fermentation of glucose and galactose via the Embden-Meyerhof-Parnas glycolysis and Leloir pathways, respectively; Magenta: NADPH generation via the oxidative part of the pentose-phosphate pathway; Green: rearrangement of sugar-phosphate carbon skeletons via the non-oxidative pentose-phosphate pathway; Black: NADH oxidation by formation of glycerol through glycerol-3-phosphate dehydrogenase and glycerol-3-phosphatase; Red: heterologously expressed Calvin-cycle enzymes phosphoribulokinase and Rubisco. Numbers in boxes represents the distribution of carbon along the different pathways (in mmol) normalized for a combined glucose and galactose uptake of 100 mmol for a wild-type, glycerol-producing reference strain (top) and for a scenario in which the alternative pathways via the Calvin cycle enzymes completely replace glycerol formation as the mechanism for reoxidizing NADH formed in biosynthetic reactions (bottom). In the scenario with the Calvin cycle enzymes, ribulose-5-phosphate was assumed to be preferentially derived from the oxidative reactions of the pentose phosphate pathway. Once the generation of NADPH from these reactions matched the requirement for NADPH in biosynthesis, further ribulose-5-phosphate was derived from glycolytic intermediates via the non-oxidative pentose-phosphate pathway rearrangement reactions. The biomass yield on ATP was assumed to be identical for both scenarios.

Schematic representation of central carbon metabolism and the introduced Calvin-cycle enzymes in . Orange: Formation of biomass and NADH from glucose and NADPH. Stoichiometries are according to Verduyn et al.[7]; Blue: Redox-neutral, ATP-yielding alcoholic fermentation of glucose and galactose via the Embden-Meyerhof-Parnas glycolysis and Leloir pathways, respectively; Magenta: NADPH generation via the oxidative part of the pentose-phosphate pathway; Green: rearrangement of sugar-phosphate carbon skeletons via the non-oxidative pentose-phosphate pathway; Black: NADH oxidation by formation of glycerol through glycerol-3-phosphate dehydrogenase and glycerol-3-phosphatase; Red: heterologously expressed Calvin-cycle enzymes phosphoribulokinase and Rubisco. Numbers in boxes represents the distribution of carbon along the different pathways (in mmol) normalized for a combined glucose and galactose uptake of 100 mmol for a wild-type, glycerol-producing reference strain (top) and for a scenario in which the alternative pathways via the Calvin cycle enzymes completely replace glycerol formation as the mechanism for reoxidizing NADH formed in biosynthetic reactions (bottom). In the scenario with the Calvin cycle enzymes, ribulose-5-phosphate was assumed to be preferentially derived from the oxidative reactions of the pentose phosphate pathway. Once the generation of NADPH from these reactions matched the requirement for NADPH in biosynthesis, further ribulose-5-phosphate was derived from glycolytic intermediates via the non-oxidative pentose-phosphate pathway rearrangement reactions. The biomass yield on ATP was assumed to be identical for both scenarios. The PRK gene from Spinacia oleracea[8] has previously been expressed in the yeast Pichia pastoris[9] and is therefore an interesting candidate for heterologous expression in S. cerevisiae. For Rubisco, a key enzyme in the Calvin cycle for autotrophic carbon fixation, three catalytically active forms have been described [10,11]. Prokaryotic form-II Rubisco’s are encoded by single structural genes and several have been heterologously expressed in E. coli[12,13]. Functional expression of form-II Rubisco’s in E. coli was shown to be strongly stimulated by the E. coli protein-folding chaperones GroEL and GroES [14] and expression of Hydrogenovibrio marinus Rubisco in E. coli was further stimulated by co-expression of the CbbO and CbbQ chaperones of the donor organism [15]. Very recently the structure of GroEL/GroES encapsulating Rubisco was visualized by cryo-electron microscopy [16]. Eukaryotes such as S. cerevisiae harbour a chaperone couple (Hsp60/Hsp10) that structurally and functionally resemble GroEL/GroES. However, these proteins are located in the mitochondria, whereas a role in Rubisco expression would require their activity in the cytosol. In this study we investigated how to achieve functional expression of PRK and Rubisco in yeast. In view of the envisioned benefit of being encoded by single structural genes, a prokarytic form-II Rubisco gene was expressed in S. cerevisiae in combination with the PRK gene from Spinacia oleracea. Both the promoters and coding regions for genes required for glycerol formation were left unchanged compared to the reference strain. Subsequently, the impact of the resulting CO2 incorporation on product formation was studied, with special emphasis on the yields of ethanol and the undesired by-product glycerol.

Results and discussion

Chaperone-mediated functional expression of Rubisco in Saccharomyces cerevisiae

To study a possible requirement of heterologous chaperones for expression of Rubisco in S. cerevisiae, the form-II Rubisco-encoding cbbM gene from T. denitrificans[17] was codon-optimised for expression in S. cerevisiae and expressed from a centromeric vector, both alone and in combination with expression cassettes for the codon-optimised E. coli groEL/groES[18] and/or T. denitrificans cbbO2/cbbQ2 genes [19,20]. Functional expression of T. denitrificans Rubisco in S. cerevisiae, as indicated by ribulose-1,5-bisphosphate-dependent 14CO2 fixation by yeast cell extracts, was only observed upon co-expression of E. coli GroEL/GroES (Figure 2). Co-expression of CbbO2/CbbQ2 did not result in a further increase of Rubisco activity (Figure 2). Co-expression of bacterial chaperones has previously been shown to improve heterologous protein expression in Pichia pastoris and insect cells [21,22]. The positive effect of GroEL/GroES on Rubisco expression in S. cerevisiae demonstrates the potential value of co-expression of heterologous chaperones for metabolic pathway engineering that requires expression of prokaryotic enzymes in the cytosol of eukaryotes.
Figure 2

Rubisco enzymatic activity in strains expressing different synthetic constructs. Specific ribulose-1,5-bisphosphate carboxylase (Rubisco) activity in cell extracts of S. cerevisiae expressing Rubisco form II CbbM from T. denitrificans, either alone (IMC033) or in combination with the E. coli chaperones GroEL/GroES [18] (IMC035), the T. denitrificans chaperones CbbO2/CbbQ2 [20] (IMC034) or all four chaperones (IMC014). Heterologously expressed genes were codon optimised for expression in yeast and expressed from a single centromeric vector. Biomass samples were taken from anaerobic batch cultures on synthetic media (pH 5.0, 30°C), sparged with nitrogen and containing 20 g l-1 glucose as carbon source. Rubisco activities, measured as 14CO2-fixation in cell extracts, in a wild-type reference strain and in S. cerevisiae strains expressing cbbM and cbbM-cbbQ2-cbbO2 were below the detection limit of the enzyme assay (0.2 nmol CO2 min-1 mg protein-1).

Rubisco enzymatic activity in strains expressing different synthetic constructs. Specific ribulose-1,5-bisphosphate carboxylase (Rubisco) activity in cell extracts of S. cerevisiae expressing Rubisco form II CbbM from T. denitrificans, either alone (IMC033) or in combination with the E. coli chaperones GroEL/GroES [18] (IMC035), the T. denitrificans chaperones CbbO2/CbbQ2 [20] (IMC034) or all four chaperones (IMC014). Heterologously expressed genes were codon optimised for expression in yeast and expressed from a single centromeric vector. Biomass samples were taken from anaerobic batch cultures on synthetic media (pH 5.0, 30°C), sparged with nitrogen and containing 20 g l-1 glucose as carbon source. Rubisco activities, measured as 14CO2-fixation in cell extracts, in a wild-type reference strain and in S. cerevisiae strains expressing cbbM and cbbM-cbbQ2-cbbO2 were below the detection limit of the enzyme assay (0.2 nmol CO2 min-1 mg protein-1).

Functional expression of phosphoribulokinase in Saccharomyces cerevisiae

The Spinacia oleracea phosphoribulokinase (PRK) gene [8], which has previously been expressed in the yeast Pichia pastoris[9], was integrated together with E. coli groEL/groES and T. denitrificans cbbO2/cbbQ2 into the S. cerevisiae genome at the CAN1 locus, under control of the galactose-inducible GAL1 promotor. This resulted in high PRK activities (approximately 15 μmol mg protein-1 min-1) in cell extracts of S. cerevisiae strain IMU033 taken from carbon-limited chemostat cultures on a mixture of glucose and galactose (Table 1). Although relatively high background activities were measured in the reference strain without PRK (IMU032), this activity does not contribute to pathway activity (see below). We therefore assumed that the background activity observed in the reference strain was caused by an impurity in one of the chemicals used in the assay and did not reflect formation of ribulose-1,5-bisphosphate. The engineered strain IMU033, which additionally carried the centromeric expression cassette for T. denitrificans Rubisco, was used to quantitatively analyse the physiological impacts of the expression of Rubisco and PRK.
Table 1

Physiological analysis of IMU033 expressing and Rubisco and the isogenic reference strain IMU032 in anaerobic chemostat cultures, grown at a dilution rate of 0.05 hon a synthetic medium (pH 5) supplemented with 12.5 g lglucose and 12.5 g lgalactose as carbon sources

 
IMU032
IMU033
 (Reference strain)(Expressing PRK and Rubisco)
CO2 in inlet gas (%)
0
10
0
10
CO2 in outlet gas (%)
0.89 ± 0.03
10.8 ± 0.0
1.02 ± 0.00
10.8 ± 0.1
Phosphoribulokinase (μmol mg protein-1 min-1)
0.58 ± 0.09
0.51 ± 0.12
14.4 ± 1.5
15.2 ± 1.0
Rubisco (nmol mg protein-1 min-1)
< 0.2*
< 0.2
4.59 ± 0.30
2.67 ± 0.28
Biomass yield on sugar (g g-1)
0.083 ± 0.000a
0.084 ± 0.000b
0.093 ± 0.001a
0.095 ± 0.000b
Ethanol yield on sugar (mol mol-1)
1.56 ± 0.03c
1.56 ± 0.02d
1.73 ± 0.02c
1.73 ± 0.01d
Glycerol yield on sugar (mol mol-1)0.14 ± 0.00e0.12 ± 0.00f0.04 ± 0.00e, g0.01 ± 0.00f, g

#Results are represented as average ± mean deviations of data from independent duplicate chemostat experiments. Data pairs labelled with the same subscripts (a,a, b,b, etc.) are considered statistically different in a standard t-test (p <0.02).

*Detection limit of enzyme activity assay.

Physiological analysis of IMU033 expressing and Rubisco and the isogenic reference strain IMU032 in anaerobic chemostat cultures, grown at a dilution rate of 0.05 hon a synthetic medium (pH 5) supplemented with 12.5 g lglucose and 12.5 g lgalactose as carbon sources #Results are represented as average ± mean deviations of data from independent duplicate chemostat experiments. Data pairs labelled with the same subscripts (a,a, b,b, etc.) are considered statistically different in a standard t-test (p <0.02). *Detection limit of enzyme activity assay.

Carbon dioxide as electron acceptor in anaerobic chemostat cultures of Saccharomyces cerevisiae

Quantitative physiological analysis is facilitated by the constant and highly reproducible process conditions in steady-state chemostat cultures [23,24]. Therefore, ethanol and glycerol yields of PRK- and Rubisco-expressing S. cerevisiae were compared to those of an isogenic reference strain in anaerobic, sugar-limited chemostats on a mixture of 12.5 g l-1 glucose and 12.5 g l-1 galactose. In nitrogen-sparged cultures, the glycerol yield on sugar in the strain expressing both Calvin-cycle enzymes was 68% lower than in the reference strain, while ethanol and biomass yields on sugar were 11% and 12% higher, respectively (Table 1). To investigate whether the low affinity of T. denitrificans form-II Rubisco for CO2 (KCO2 = 0.26 mM [17]) limited its in vivo activity in the nitrogen-sparged cultures, additional chemostats were sparged with a 10%/90% blend of CO2 and N2. Indeed, this CO2 supplementation resulted in a further decrease of the glycerol yield to a value below 10% of that of the reference strain (Table 1). Co-expression of Rubisco and chaperones without co-expression of PRK (strain IMC014) did not result in decreased glycerol yield (0.13 mol mol-1) compared to the reference strain IMU032 (0.12 mol mol-1) in carbon-limited chemostat cultures supplemented with CO2. This observation confirmed that expression of a heterologous phosphoribulokinase (PRK) gene is required for in vivo carbon fixation via Rubisco in yeast.

Carbon dioxide as electron acceptor in anaerobic batch fermentations

Since industrial-scale ethanol production is routinely performed in batch fermentations [25], the impact of the expression of PRK and Rubisco was also investigated in anaerobic, CO2-supplemented batch cultures (Figure 3). Galactose was used as the carbon source for these experiments to enable efficient expression of PRK from the GAL1 promoter. Despite an almost 10 h difference in the lag phase, the specific growth rates of the engineered and reference strains on galactose in these anaerobic cultures were not significantly different (Figure 3) and in good agreement with values reported elsewhere for this yeast strain family [26]. Consistent with the observations in chemostat cultures, expression of the two Calvin cycle enzymes reduced glycerol formation in the batch cultures by 60% and increased the ethanol yield on galactose by 8% (Figure 3e-f). However, the biomass yield on sugar, which in the chemostat cultures increased according to the predictions, did not increase in the anaerobic batch cultures on galactose. These observations together might indicate that under the galactose excess conditions used for these batch cultivations increased expression levels of PRK result in a small metabolic burden, but still result in an overall positive effect on the ethanol yield.
Figure 3

Physiological impact of expression of Calvin cycle enzymes on growth, substrate consumption and product formation in galactose-grown anaerobic batch cultures of . a: growth curves of isogenic reference strain S. cerevisiae IMU032, b: growth curves of S. cerevisiae IMU033 expressing PRK and Rubisco. Growth conditions: T = 30°C, pH 5.0, 10% CO2 in inlet gas. Each graph represents values for one of two independent replicate experiments, whose growth kinetic parameters differed by less than 5%. c-f: Calculated parameters: Maximum specific growth rate (c), biomass yield (d), glycerol yield (e), and ethanol yield (f) on galactose of the isogenic S. cerevisiae reference (black bars) and strain expressing PRK and Rubisco (white bars). Results are represented as average ± mean deviations of data from independent duplicate cultures. Values inside the white bars represent statistically significant differences in a standard t-test (p value < 0.02) relative to the reference strain.

Physiological impact of expression of Calvin cycle enzymes on growth, substrate consumption and product formation in galactose-grown anaerobic batch cultures of . a: growth curves of isogenic reference strain S. cerevisiae IMU032, b: growth curves of S. cerevisiae IMU033 expressing PRK and Rubisco. Growth conditions: T = 30°C, pH 5.0, 10% CO2 in inlet gas. Each graph represents values for one of two independent replicate experiments, whose growth kinetic parameters differed by less than 5%. c-f: Calculated parameters: Maximum specific growth rate (c), biomass yield (d), glycerol yield (e), and ethanol yield (f) on galactose of the isogenic S. cerevisiae reference (black bars) and strain expressing PRK and Rubisco (white bars). Results are represented as average ± mean deviations of data from independent duplicate cultures. Values inside the white bars represent statistically significant differences in a standard t-test (p value < 0.02) relative to the reference strain.

Conclusions

This study provides a compelling proof of principle for the replacement of glycerol formation as the predominant redox sink in anaerobic yeast metabolism by PRK- and Rubisco-mediated incorporation of CO2 into yeast central carbon metabolism. The loss of sugar feedstock due to glycerol production in industrial bioethanol processes has been estimated at 4% of the consumed sugar [5]. If expression of PRK and Rubisco in industrial yeast strains were to completely eliminate this loss, this could enable an additional production of 5 billion liters of ethanol from the amount of sugar used for the 2011 global ethanol production of 110 billion liters [1]. Use of CO2 as an external electron acceptor offers important advantages over previously proposed strategies for reducing glycerol production in yeast-based bioethanol production. Optimizing the redox cofactor specificity of nitrogen assimilation in S. cerevisiae[5] only enables a partial reduction of glycerol production and its impact further depends on the nitrogen sources present in industrial feedstocks. Similarly, a metabolic engineering strategy that enables NADH-dependent reduction of acetic acid [6] to ethanol is dependent on the presence of acetic acid in industrial feedstocks. Further optimization of PRK and Rubisco gene expression and regulation in S. cerevisiae should enable the design and construction of DNA cassettes that can be easily introduced in the genomes of industrial yeast strains. This should include the replacement of the GAL1-promotor, that was used for the expression of PRK in this study, by a promotor that is compatible with fast growth at high glucose concentrations and that further balances the expression of PRK and Rubisco. Since ribulose-5-phosphate is also an intermediate in pentose metabolism by engineered S. cerevisiae strains [27], this approach should also be readily applicable to the yeast-based conversion of lignocellulosic hydrolysates. The observed stimulatory effect of CO2 on the engineered strains will not hinder application of this concept in industrial bioethanol production, since large-scale processes for bioethanol production are characteristically CO2 saturated. Our results illustrate how metabolic engineering strategies based on the functional integration of extensively studied reactions in the central carbon metabolism of distantly related organisms enables the optimization of product yields in industrial biotechnology. Although the present study focuses on ethanol production by yeast, functional integration of autotrophic carbon-fixing enzymes in the metabolic networks of industrial microorganisms should also enable optimization of yields of other existing and novel products whose synthesis results in a net positive ATP yield.

Methods

Construction of expression modules

Phosphoribulokinase (PRK) cDNA from Spinacia oleracea (spinach) [9] (accession number: X07654.1) was PCR-amplified using Phusion Hot-Start Polymerase (Finnzymes, Landsmeer, the Netherlands) and the oligonucleotides XbaI_prk_FW2 and RV1_XhoI_prk (Table 2), and was ligated in pCR®-Blunt II-TOPO® (Life Technologies Europe BV, Bleiswijk, the Netherlands). After restriction by XbaI and XhoI, the PRK-containing fragment was ligated into pTEF424 [28]. The TEF1p was later replaced by GAL1p from plasmid pSH47 [29] by XbaI and SacI restriction/ligation, creating plasmid pUDE046 (Table 3).
Table 2

Oligonucleotides used in this study

NumberNameSequence (5′ to 3′)Purpose
 
Cloning
 
 
1
XbaI_prk_FW2
TGACATCTAGATGTCACAACAACAAACAATTG
Cloning of PRK into pUDE046.
2
RV1 XhoI prk
TGACATCTAGATGTCACAACAACAAACAATTG
Cloning of PRK into pUDE046.
 
Primers used for in vivo plasmid assembly
 
3
HR-cbbM-FW-65
TTGTAAAACGACGGCCAGTGAGCGCGCGTAATACGACTCACTATAGGGCGAATTGGGTACAGCTGGAGCTCAGTTTATCATTATC
Rubisco cbbM cassette for plasmids pUDC075, pUDC099, and pUDC100.
4
HR-cbbM-RV-65
GGAATCTGTGTAGTATGCCTGGAATGTCTGCCGTGCCATAGCCATGTATGCTGATATGTCGGTACCGGCCGCAAATTAAAG
Rubisco cbbM cassette for plasmids pUDC075, pUDC099, and pUDC100
5
linker-cbbO2-pRS416
ATCACTCTTACCAGGCTAGGACGACCCTACTCATGTATTGAGATCGACGAGATTTCTAGGCCAGCTTTTGTTCCCTTTAGTGAGGGTTAATTGCGCGCTTGGCGTAATCATGGTCATAGC
Linker fragment for assembly of plasmid pUDC099.
6
linker-cbbM-GroEL
GACATATCAGCATACATGGCTATGGCACGGCAGACATTCCAGGCATACTACACAGATTCCATCACTCTTACCAGGCTAGGACGACCCTACTCATGTATTGAGATCGACGAGATTTCTAGG
Linker fragment for assembly of plasmid pUDC100.
 
Primers used for in vivo integration assembly
 
7
FW pTDH3- HR-CAN1up
GTTGGATCCAGTTTTTAATCTGTCGTCAATCGAAAGTTTATTTCAGAGTTCTTCAGACTTCTTAACTCCTGTAAAAACAAAAAAAAAAAAAGGCATAGCAAGCTGGAGCTCAGTTTATC
1st cloning expression cassette linker fragment between CAN1 upstream and PRK expression cassette (IMI229), and CAN1up-linker and KlLEU2 expression cassette (IMI232).
8
RV linker-iHR2B
AGATATACTGCAAAGTCCGGAGCAACAGTCGTATAACTCGAGCAGCCCTCTACTTTGTTGTTGCGCTAAGAGAATGGACC
1st cloning fragment: linker fragment between CAN1up-linker and PRK expression cassette (IMI229).
9
RV linker-iHR6
GCTATGACCATGATTACGCCAAGCGCGCAATTAACCCTCACTAAAGGGAACAAAAGCTGGTTGCGCTAAGAGAATGGACC
1st cloning fragment: linker fragment between CAN1up-linker and KlLEU2 expression cassette (IMI232).
10
FW pGAL1-prk HR2B
CAACAAAGTAGAGGGCTGCTCGAGTTATACGACTGTTGCTCCGGACTTTGCAGTATATCTGCTGGAGCTCTAGTACGGATT
2nd cloning fragment: GAL1p-PRK-CYC1t expression cassette (IMI229) from pUDE046.
11
RV CYC1t-prk HR2
GGAATCTGTGTAGTATGCCTGGAATGTCTGCCGTGCCATAGCCATGTATGCTGATATGTCGTACCGGCCGCAAATTAAAG
2nd cloning fragment: GAL1p-PRK-CYC1t expression cassette (IMI229) from pUDE046.
12
FW HR2-cbbQ2-HR3
GACATATCAGCATACATGGCTATGG
3rd cloning fragment: PGI1p-cbbQ2-TEF2t cassette (IMI229).
13
RV HR2-cbbQ2-HR3
GGACACGCTTGACAGAATGTCAAAGG
3rd cloning fragment: PGI1p-cbbQ2-TEF2t cassette (IMI229).
14
FW HR3-cbbO2-HR4
CGTCCGATATGATCTGATTGG
4th cloning fragment: PGK1p-cbbO2-ADH1t cassette (IMI229).
15
RV HR3-cbbO2-HR4
CCTAGAAATCTCGTCGATCTC
4th cloning fragment: PGK1p-cbbO2-ADH1t cassette (IMI229).
16
FW HR4-GroEL-HR5
ATCACTCTTACCAGGCTAGG
5th cloning fragment: TEF1p-groEL-ACT1t cassette (IMI229).
17
RV HR4-GroEL-HR5
CTGGACCTTAATCGTGTGCGCATCCTC
5th cloning fragment: TEF1p-groEL-ACT1t cassette (IMI229).
18
FW HR5-GroES-HR6
CCGTATAGCTTAATAGCCAGCTTTATC
6th cloning fragment: TPI1p-groES-PGI1t cassette (IMI229).
19
RV HR5-GroES-HR6
GCTATGACCATGATTACGCCAAGC
6th cloning fragment: TPI1p-groES-PGI1t cassette (IMI229).
20
FW HR6-LEU2-CAN1dwn
CCAGCTTTTGTTCCCTTTAGTGAGGGTTAATTGCGCGCTTGGCGTAATCATGGTCATAGCCTGTGAAGATCCCAGCAAAG
7th (IMI229) or 2nd (IMI232) cloning fragment: KlLEU2 cassette from pUG73.
21
RV LEU2 HR-CAN1
AGCTCATTGATCCCTTAAACTTTCTTTTCGGTGTATGACTTATGAGGGTGAGAATGCGAAATGGCGTGGAAATGTGATCAAAGGTAATAAAACGTCATATATCCGCAGGCTAACCGGAAC
7th (IMI229) or 2nd (IMI232) cloning fragment: KlLEU2 cassette from pUG73.
 
Primers used for verification of the in vivo assembled constructs
 
22
m-PCR-HR1-FW
GGCGATTAAGTTGGGTAACG
Diagnostic for assembly of plasmids pUDC075, pUDC099, and pUDC100, and integration in strain IMI229.
23
m-PCR-HR1-RV
AACTGAGCTCCAGCTGTACC
Diagnostic for assembly of plasmids pUDC075, pUDC099, pUDC100, and integration in strain IMI229.
24
m-PCR-HR2-FW
ACGCGTGTACGCATGTAAC
Diagnostic for assembly of pUDC075, pUDC099, pUDC100, and integration in strain IMI229
25
m-PCR-HR2-RV
GCGCGTGGCTTCCTATAATC
Diagnostic for assembly of pUDC075, pUDC099, pUDC100, and integration in strain IMI229
26
m-PCR-HR3-FW
GTGAATGCTGGTCGCTATAC
Diagnostic for assembly of pUDC075, pUDC099, pUDC100, and integration in strain IMI229.
27
m-PCR-HR3-RV
GTAAGCAGCAACACCTTCAG
Diagnostic for assembly of pUDC075, pUDC099, pUDC100, and integration in strain IMI229.
28
m-PCR-HR4-FW
ACCTGACCTACAGGAAAGAG
Diagnostic for assembly of pUDC075, pUDC099, pUDC100, and integration in strain IMI229.
29
m-PCR-HR4-RV
TGAAGTGGTACGGCGATGC
Diagnostic for assembly of pUDC075, pUDC099, pUDC100, and integration in strain IMI229.
30
m-PCR-HR5-FW
ATAGCCACCCAAGGCATTTC
Diagnostic for assembly of pUDC075, pUDC099, pUDC100, and integration in strain IMI229.
31
m-PCR-HR5-RV
CCGCACTTTCTCCATGAGG
Diagnostic for assembly of pUDC075, pUDC099, pUDC100, and integration in strain IMI229.
32
m-PCR-HR6-FW
CGACGGTTACGGTGTTAAG
Diagnostic for assembly of pUDC075, pUDC099, pUDC100, and integration in strain IMI229.
33m-PCR-HR6-RVCTTCCGGCTCCTATGTTGTGDiagnostic for assembly of pUDC075, pUDC099, pUDC100, and integration in strain IMI229.
Table 3

Plasmids used in this study

NameRelevant genotypeSource/reference
pFL451
AOX1p-prk (Spinach)-AOX1t (pHIL2-D2 HIS4 Amp centromeric)
Brandes et al.[9].
pCR®-Blunt II-TOPO
Bla
Life Technologies Europe BV
pTEF424_TEF
TRP1bla
Mumberg et al.[28].
pSH47
URA3 CEN6 ARS4 GAL1p-cre-CYC1tbla
Güldener et al. [29].
pUD0E46
TRP1GAL1p-prk-CYC1tbla
This study.
pPCR-Script
Bla
Life Technologies Europe BV.
pGPD_426
URA3bla
Mumberg et al.[28].
pRS416
URA3 CEN6 ARS4 bla
Mumberg et al.[28].
pBTWW002
URA3TDH3p-cbbM-CYC1tbla
This study.
pUDC098
URA3 CEN6 ARS4 TDH3p-cbbM-CYC1tbla
This study.
pMK-RQ
nptII
Life Technologies Europe BV.
pUD230
PGI1p-cbbQ2-TEF2tnptII
Life Technologies Europe BV.
pUD231
PGK1p-cbbO2-ADH1tnptII
Life Technologies Europe BV.
pUD232
TEF1p-groEL-ACT1tnptII
Life Technologies Europe BV.
pUD233
TPI1p-groES-PGI1tnptII
Life Technologies Europe BV.
pUDC075
URA3 CEN6 ARS4 TDH3p-cbbM-CYC1t;PGI1p-cbbQ2-TEF2t;PGK1p-cbbO2-ADH1t;TEF1p-groEL-ACT1t;TPI1p-groES-PGI1tbla
This study.
pUDC099
URA3 CEN6 ARS4 TDH3p-cbbM-CYC1t;PGI1p-cbbQ2-TEF2t;PGK1p-cbbO2-ADH1tbla
This study.
pUDC100URA3 CEN6 ARS4 TDH3p-cbbM-CYC1t;TEF1p-groEL-ACT1t;TPI1p-groES-PGI1tblaThis study.
Oligonucleotides used in this study Plasmids used in this study Rubisco form II gene cbbM from T. denitrificans[17] flanked by KpnI and SacI sites was codon optimized [30] (accession number: KC699554), synthesized at GeneArt (Life Technologies Europe BV), and ligated into pPCR-Script. The cbbM-containing fragment was ligated into the BamHI and SacI restricted vector pGPD_426 [28] creating plasmid pBTWW002. The cbbM expression cassette was transferred into pRS416 using KpnI and SacI, yielding pUDC098. Expression cassette of the specific Rubisco form II chaperones from T. denitrificans cbbQ2 and cbbO2[20], and chaperones groEL and groES[18] from E. coli were codon optimized [30] (accession numbers: KC699555 and KC699556, respectively). The expression cassettes contained a yeast constitutive promoters and terminator, flanking the codon optimized gene. The cassette was flanked by unique 60-bp regions obtained by randomly combining bar-code sequences used in the Saccharomyces Genome Deletion Project [31] and an EcoRV site (GeneArt). The expression cassettes were inserted in plasmid pMK-RQ (GeneArt) using the SfiI cloning sites yielding pUD230 (PGI1p-cbbQ2-TEF2t), pUD231 (PGK1p-cbbO2-ADH1t), pUD232 (TEF1p-groEL-ACT1t), and pUDE233 (TPI1p-groES-PGI1t) (Table 3). The expression cassette TDH3p-cbbM-CYC1t was PCR-amplified from plasmid pBTWW002 using Phusion Hot-Start Polymerase (Finnzymes) and primers HR-cbbM-FW-65 and HR-cbbM-RV-65 in order to incorporate the 60-bp region for recombination cloning.

Strain construction, isolation and maintenance

All Saccharomyces cerevisiae strains used (Table 4) belong to the CEN.PK family [32,33]. All strains were grown in 2% w/v glucose synthetic media [7] supplemented with 150 mg l-1 uracil when required [34] until they reached end exponential phase, then sterile glycerol was added up to ca. 30% v/v and aliquot of 1 ml were stocked −80°C.
Table 4

strains used in this study

 Relevant genotypeSource/reference
CEN.PK113-5D
MATa ura3-52
Euroscarf.
CEN.PK102-3A
MATa ura3-52 leu2-3, 112
Euroscarf.
IMC014
MATa ura3-52 pUDC075 (CEN6 ARS4 URA3 TDH3p-cbbM-CYC1tPGI1p-cbbQ2-TEF2tPGK1p-cbbO2-ADH1tTEF1p-groEL-ACT1tTPI1p-groES-PGI1t)
This study.
IMC033
MATa ura3-52 pUDC098 (CEN6 ARS4 URA3 TDH3p-cbbM-CYC1t)
This study.
IMC034
MATa ura3-52 pUDC099 (CEN6 ARS4 URA3 TDH3p-cbbM-CYC1tPGI1p-cbbQ2-TEF2tPGK1p-cbbO2-ADH1tcbbO2-pRS416 linker)
This study.
IMC035
MATa ura3-52 pUDC100 (CEN6 ARS4 URA3 TEF1p-groEL-ACT1tTPI1p-groES-PGI1tcbbM-GroEL linker)
This study.
IMI229
MATa ura3-52 leu2-3, 112 can1Δ::GAL1p-prk-CYC1tPGI1p-cbbQ2-TEF2t,PGK1p-cbbO2-ADH1t,TEF1p-groEL-ACT1t,TPI1p-groES-PGI1tKlLEU2
This study.
IMI232
MATa ura3-52 leu2-3, 112 can1::KlLEU2
This study.
IMU032
IMI232 p426_GPD (2μ URA3)
This study.
IMU033IMI229 pUDC100 (CEN6 ARS4 URA3 TEF1p-groEL-ACT1tTPI1p-groES-PGI1tcbbM-GroEL linker)This study.
strains used in this study The strain IMC014 that co-expressed the Rubisco form II cbbM and the four chaperones cbbQ2, cbbO2, groEL, and groES was constructed using a previously published in vivo transformation associated recombination [35]. 200 fmol of each expression cassette were pooled with 100 fmol of the KpnI/SacI linearized pRS416 backbone in a final volume of 50 μl and transformed in CEN.PK 113-5D using the lithium acetate protocol [36] (Figure 4a). Cells were selected on synthetic medium. Correct assembly of the fragment of pUDC075 was performed by multiplex PCR on transformant colonies using primers enabling amplification over the regions used for homologous recombination (Table 2) and by restriction analysis after retransformation of the isolated plasmid in E. coli DH5α. pUDC075 was sequenced by Next Gen Seq Illumina (100-bp reads paired-end, 50 Mb) and assembled with Velvet [37]. The assembled sequence did not contain mutations in any of the assembled expression cassettes. The strains IMC034 and IMC035 that expressed cbbM/cbbQ2/cbbO2 and cbbM/groEL/groES respectively were constructed using the same in vivo assembly method with the following modification. To construct plasmids pUDC099 and pUDC100, 120 bp cbbO2-pRS416 linker and cbbM-GroEL linker were used to close the assembly respectively (Table 2), 100 fmol of each of complementary 120 bp oligonucleotides were added to the transformation. The strain IMC033 that only expressed the cbbM gene was constructed by transforming CEN.PK113-5D with pUDC098.
Figure 4

Strategy for the heterologous expression of Rubisco and PRK in . (a)In vivo assembly of Rubisco expression plasmid pUDC075, and (b)in vivo assembly and integration of PRK and chaperone proteins in CAN1 locus of Saccharomyces cerevisiae strain IMI229. Each fragment represents a different expression cassette or plasmid backbone. All fragments used in assembly experiments were flanked by 60-bp sequences used for in vivo recombination, either enabling the assembly of plasmids or the integration assembled constructs into the S. cerevisiae genome. Arrows and numbers indicate primers used in the construction of the cassette.

Strategy for the heterologous expression of Rubisco and PRK in . (a)In vivo assembly of Rubisco expression plasmid pUDC075, and (b)in vivo assembly and integration of PRK and chaperone proteins in CAN1 locus of Saccharomyces cerevisiae strain IMI229. Each fragment represents a different expression cassette or plasmid backbone. All fragments used in assembly experiments were flanked by 60-bp sequences used for in vivo recombination, either enabling the assembly of plasmids or the integration assembled constructs into the S. cerevisiae genome. Arrows and numbers indicate primers used in the construction of the cassette. To construct the strain IMU033 that co-expressed PRK, cbbM, cbbQ2, cbbO2, the intermediate strain IMI229 was constructed by integrating PRK, the four chaperones and KlLEU2[38] at the CAN1 locus by in vivo homologous integration in CEN.PK102-3A (Figure 4b). The expression cassettes were PCR amplified using Phusion Hot-Start Polymerase (Finnzymes), the corresponding oligonucleotides and DNA templates (Table 2). Finally, the strain IMI229 was transformed with pUDC100 that carries the Rubisco form II cbbM and the two E. coli chaperones groEL and groES. Strain IMI232 was constructed by transforming CEN.PK102-3A with the KlLEU2 cassette. IMI232 was finally transformed with the plasmid p426GPD to restore prototrophy resulting in the reference strain IMU032.

Experimental set-up of chemostat and batch experiments

Anaerobic chemostat cultivation was performed essentially as described [39] but with 12.5 g l-1 glucose and 12.5 g l-1 galactose as the carbon source and where indicated, a mixture of 10% CO2/90% N2 replaced pure nitrogen as the sparging gas. Residual glucose and galactose concentrations were determined after rapid quenching [40] using commercial enzymatic assays for glucose (Boehringer, Mannheim, Germany) and D-galactose (Megazyme, Bray, Ireland). Anaerobic bioreactor batch cultures were grown essentially as described [6], but with 20 g l-1 galactose and a sparging gas consisting of 10% CO2 and 90% N2. Biomass and metabolite concentrations in batch and chemostat and batch cultures were determined as described by Guadalupe et al.[6]. In calculations of ethanol fluxes and yields, ethanol evaporation was corrected for based on a first-order evaporation rate constant of 0.008 h-1 in the bioreactor setups and under the conditions used in this study [6,39].

Enzyme assays for phosphoribulokinase and Rubisco

Cell extracts for analysis of phosphoribulokinase (PRK) activity were prepared as described previously [41]. PRK activity was measured at 30°C by a coupled spectrophotometric assay [42]. Reaction rates were proportional to the amounts of cell extract added. Protein concentrations were determined by the Lowry method [43] using bovine serum albumin as a standard. Cell extracts for Rubisco activity assays were prepared as described [41], with two modifications: Tris–HCl (1 mM, pH 8.2) containing 20 mM MgCl2•6H2O, 5 mM of DTT and 5 mM NaHCO3 was used as sonication buffer and Tris–HCl (100 mM, pH 8.2), 20 mM MgCl2•6H2O and 5 mM of DTT as freezing buffer. Rubisco activity was determined by measuring 14CO2-fixation (PerkinElmer, Groningen, The Netherlands) as described [44] and measuring radioactive counts in a TRI-CARB® 2700TR Series liquid scintillation counter (PerkinElmer, Groningen, The Netherlands), using Ultima Gold™ scintillation cocktail (PerkinElmer, Groningen, The Netherlands). Protein concentrations were determined by the Lowry method [43] using standard solutions of bovine serum albumin dissolved in 50 mM Tris–HCl (pH 8.2).

Abbreviations

Rubisco: Ribulose 1,5-bisphosphate carboxylase/oxidase; PRK: Phosphoribulokinase; NAD+: Nicotinamide adenine dinucleotide; NADP+: Nicotinamide adenine dinucleotide phosphate.

Competing interests

VGM, HWW, AJAvM, and JTP are inventors on a patent application related to the content of this article.

Authors’ contributions

VGM, JMD, JTP, AJAvM designed the experiments and wrote the manuscript. HWW selected the Rubisco and PRK genes, VGM selected the chaperone genes and constructed all yeast strains. VGM and EdH carried out and analyzed the fermentation experiments. VGM and MAHL performed the PRK and Rubisco enzymatic activity determinations. All the authors have read and approved the final manuscript.
  39 in total

1.  Velvet: algorithms for de novo short read assembly using de Bruijn graphs.

Authors:  Daniel R Zerbino; Ewan Birney
Journal:  Genome Res       Date:  2008-03-18       Impact factor: 9.043

2.  The complete genome sequence of Escherichia coli DH10B: insights into the biology of a laboratory workhorse.

Authors:  Tim Durfee; Richard Nelson; Schuyler Baldwin; Guy Plunkett; Valerie Burland; Bob Mau; Joseph F Petrosino; Xiang Qin; Donna M Muzny; Mulu Ayele; Richard A Gibbs; Bálint Csörgo; György Pósfai; George M Weinstock; Frederick R Blattner
Journal:  J Bacteriol       Date:  2008-02-01       Impact factor: 3.490

3.  Cloning and sequencing of cDNA encoding the mature form of phosphoribulokinase from spinach.

Authors:  S Milanez; R J Mural
Journal:  Gene       Date:  1988-06-15       Impact factor: 3.688

4.  The cbbQ genes, located downstream of the form I and form II RubisCO genes, affect the activity of both RubisCOs.

Authors:  N R Hayashi; H Arai; T Kodama; Y Igarashi
Journal:  Biochem Biophys Res Commun       Date:  1999-11       Impact factor: 3.575

5.  Engineering topology and kinetics of sucrose metabolism in Saccharomyces cerevisiae for improved ethanol yield.

Authors:  Thiago O Basso; Stefan de Kok; Marcelo Dario; Júlio Cézar A do Espirito-Santo; Gabriela Müller; Paulo S Schlölg; Carlos P Silva; Aldo Tonso; Jean-Marc Daran; Andreas K Gombert; Antonius J A van Maris; Jack T Pronk; Boris U Stambuk
Journal:  Metab Eng       Date:  2011-09-22       Impact factor: 9.783

Review 6.  Towards industrial pentose-fermenting yeast strains.

Authors:  Bärbel Hahn-Hägerdal; Kaisa Karhumaa; César Fonseca; Isabel Spencer-Martins; Marie F Gorwa-Grauslund
Journal:  Appl Microbiol Biotechnol       Date:  2007-02-09       Impact factor: 4.813

7.  The novel genes, cbbQ and cbbO, located downstream from the RubisCO genes of Pseudomonas hydrogenothermophila, affect the conformational states and activity of RubisCO.

Authors:  N R Hayashi; H Arai; T Kodama; Y Igarashi
Journal:  Biochem Biophys Res Commun       Date:  1997-12-18       Impact factor: 3.575

8.  De novo sequencing, assembly and analysis of the genome of the laboratory strain Saccharomyces cerevisiae CEN.PK113-7D, a model for modern industrial biotechnology.

Authors:  Jurgen F Nijkamp; Marcel van den Broek; Erwin Datema; Stefan de Kok; Lizanne Bosman; Marijke A Luttik; Pascale Daran-Lapujade; Wanwipa Vongsangnak; Jens Nielsen; Wilbert H M Heijne; Paul Klaassen; Chris J Paddon; Darren Platt; Peter Kötter; Roeland C van Ham; Marcel J T Reinders; Jack T Pronk; Dick de Ridder; Jean-Marc Daran
Journal:  Microb Cell Fact       Date:  2012-03-26       Impact factor: 5.328

9.  JCat: a novel tool to adapt codon usage of a target gene to its potential expression host.

Authors:  Andreas Grote; Karsten Hiller; Maurice Scheer; Richard Münch; Bernd Nörtemann; Dietmar C Hempel; Dieter Jahn
Journal:  Nucleic Acids Res       Date:  2005-07-01       Impact factor: 16.971

10.  A versatile, efficient strategy for assembly of multi-fragment expression vectors in Saccharomyces cerevisiae using 60 bp synthetic recombination sequences.

Authors:  Niels G A Kuijpers; Daniel Solis-Escalante; Lizanne Bosman; Marcel van den Broek; Jack T Pronk; Jean-Marc Daran; Pascale Daran-Lapujade
Journal:  Microb Cell Fact       Date:  2013-05-10       Impact factor: 5.328

View more
  42 in total

Review 1.  Harnessing the power of microbial autotrophy.

Authors:  Nico J Claassens; Diana Z Sousa; Vitor A P Martins Dos Santos; Willem M de Vos; John van der Oost
Journal:  Nat Rev Microbiol       Date:  2016-09-26       Impact factor: 60.633

2.  Biosynthesis Based on One-Carbon Mixotrophy.

Authors:  Yaeseong Hong; An-Ping Zeng
Journal:  Adv Biochem Eng Biotechnol       Date:  2022       Impact factor: 2.635

Review 3.  Harnessing bioengineered microbes as a versatile platform for space nutrition.

Authors:  Briardo Llorente; Thomas C Williams; Hugh D Goold; Isak S Pretorius; Ian T Paulsen
Journal:  Nat Commun       Date:  2022-10-19       Impact factor: 17.694

4.  Structure-function studies with the unique hexameric form II ribulose-1,5-bisphosphate carboxylase/oxygenase (Rubisco) from Rhodopseudomonas palustris.

Authors:  Sriram Satagopan; Sum Chan; L Jeanne Perry; F Robert Tabita
Journal:  J Biol Chem       Date:  2014-06-18       Impact factor: 5.157

5.  Manipulating ATP supply improves in situ CO2 recycling by reductive TCA cycle in engineered Escherichia coli.

Authors:  Ching-Hsun Chen; I-Ting Tseng; Shou-Chen Lo; Zi-Rong Yu; Ju-Jiun Pang; Yu-Hsuan Chen; Chieh-Chen Huang; Si-Yu Li
Journal:  3 Biotech       Date:  2020-02-19       Impact factor: 2.406

6.  Protein allocation and utilization in the versatile chemolithoautotroph Cupriavidus necator.

Authors:  Michael Jahn; Nick Crang; Markus Janasch; Andreas Hober; Björn Forsström; Kyle Kimler; Alexander Mattausch; Qi Chen; Johannes Asplund-Samuelsson; Elton Paul Hudson
Journal:  Elife       Date:  2021-11-01       Impact factor: 8.140

7.  Quantitative analysis of an engineered CO2-fixing Escherichia coli reveals great potential of heterotrophic CO2 fixation.

Authors:  Fuyu Gong; Guoxia Liu; Xiaoyun Zhai; Jie Zhou; Zhen Cai; Yin Li
Journal:  Biotechnol Biofuels       Date:  2015-06-18       Impact factor: 6.040

8.  New Insight into the Role of the Calvin Cycle: Reutilization of CO2 Emitted through Sugar Degradation.

Authors:  Rie Shimizu; Yudai Dempo; Yasumune Nakayama; Satoshi Nakamura; Takeshi Bamba; Eiichiro Fukusaki; Toshiaki Fukui
Journal:  Sci Rep       Date:  2015-07-01       Impact factor: 4.379

Review 9.  CO2 - Intrinsic Product, Essential Substrate, and Regulatory Trigger of Microbial and Mammalian Production Processes.

Authors:  Bastian Blombach; Ralf Takors
Journal:  Front Bioeng Biotechnol       Date:  2015-08-03

10.  Identification and characterization of multiple rubisco activases in chemoautotrophic bacteria.

Authors:  Yi-Chin Candace Tsai; Maria Claribel Lapina; Shashi Bhushan; Oliver Mueller-Cajar
Journal:  Nat Commun       Date:  2015-11-16       Impact factor: 14.919

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.