Literature DB >> 23526955

Fine mapping of wheat stripe rust resistance gene Yr26 based on collinearity of wheat with Brachypodium distachyon and rice.

Xiaojuan Zhang1, Dejun Han, Qingdong Zeng, Yinghui Duan, Fengping Yuan, Jingdong Shi, Qilin Wang, Jianhui Wu, Lili Huang, Zhensheng Kang.   

Abstract

The Yr26 gene, conferring resistance to all currently important races of Puccinia striiformis f. sp. tritici (Pst) in China, was previously mapped to wheat chromosome deletion bin C-1BL-6-0.32 with low-density markers. In this study, collinearity of wheat to Brachypodium distachyon and rice was used to develop markers to saturate the chromosomal region containing the Yr26 locus, and a total of 2,341 F2 plants and 551 F2∶3 progenies derived from Avocet S×92R137 were used to develop a fine map of Yr26. Wheat expressed sequence tags (ESTs) located in deletion bin C-1BL-6-0.32 were used to develop sequence tagged site (STS) markers. The EST-STS markers flanking Yr26 were used to identify collinear regions of the rice and B. distachyon genomes. Wheat ESTs with significant similarities in the two collinear regions were selected to develop conserved markers for fine mapping of Yr26. Thirty-one markers were mapped to the Yr26 region, and six of them cosegregated with the resistance gene. Marker orders were highly conserved between rice and B. distachyon, but some rearrangements were observed between rice and wheat. Two flanking markers (CON-4 and CON-12) further narrowed the genomic region containing Yr26 to a 1.92 Mb region in B. distachyon chromosome 3 and a 1.17 Mb region in rice chromosome 10, and two putative resistance gene analogs were identified in the collinear region of B. distachyon. The markers developed in this study provide a potential target site for further map-based cloning of Yr26 and should be useful in marker assisted selection for pyramiding the gene with other resistance genes.

Entities:  

Mesh:

Substances:

Year:  2013        PMID: 23526955      PMCID: PMC3589488          DOI: 10.1371/journal.pone.0057885

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

Wheat (Triticum aestivum L.) is an important crop and a primary food source for humans. Stripe rust, caused by the fungal pathogen Puccinia striiformis Westend. f. sp. tritici Erikss. (Pst), is an important disease of wheat in China and many other countries. To date, 53 stripe rust resistance genes (Yr1–Yr53) and numerous temporarily designated genes have been reported in wheat (http://wheat.pw.usda.gov/cgi-bin/graingenes). Most of these genes have been mapped on chromosomes and/or specific chromosomal regions, and many of them have been used in wheat breeding programs worldwide. However, with the spread of Pst race CYR32, a large number of known resistance genes are no longer effective in China [1]. Despite considerable progress in the identification and mapping of stripe rust resistance genes, only two adult plant resistance (APR) genes, Yr18 [2] and Yr36 [3], have been cloned. Yr26 has been widely used in wheat breeding programs in China for developing stripe rust resistant cultivars [4], [5], varieties with Yr26 are grown on more than 3.4 million hectares in China. As the gene is still effective against the current Pst populations, cloning Yr26 is important for understanding the molecular mechanisms of resistance. The Yr26 gene, which is present in the common wheat line 92R137, was derived from Chinese T. turgidum landrace γ80-1 [6]. The gene was previously mapped near the centromere region, putatively on the short arm of wheat chromosome1 B with SSR markers Xgwm11, Xgwm18 and Xgwm413 [6]. A recent study located Yr26 to the deletion bin C-1BL-6-0.32 with molecular markers WE173 and Xbarc181 [7]. The genetic distances between Yr26 and the two closest flanking markers were 1.4 and 4.3 cM, respectively. Although several markers have been mapped to the Yr26 region, the number of the markers is still limited, and more are needed for more efficient marker-assisted selection, fine mapping and map-based cloning of Yr26. A perception is that fine mapping and map-based cloning in hexaploid wheat (T. aestivum, 2n = 6x = 42, genomic formula AABBDD) faces enormous challenges because of the huge genome size (17 Gb), polyploidy and highly repetitive sequences (>80%) within the genome. This problem can be solved, at least partially, by leveraging the physically mapped wheat ESTs [8], [9] and conserved syntenic relationship between wheat and model grass species [10], [11], [12], [13]. Collinearity of chromosome regions between wheat and model species, such as rice and B. distachyon, is well characterized [9], [14]. The available whole genomic sequences of rice and B. distachyon provide useful information for developing molecular markers, identifying candidate genes for traits of interest, predicting biological functions of genes and cloning genes. Such comparative genomic approaches have been used in map-based cloning of many wheat genes, including Yr18 [2] and Yr36 [3] for stripe rust resistance, and vernalization response genes Vrn1, Vrn2 and Vrn3 [15], [16], [17]. A particular challenge to map-based cloning of Yr26 is its proximity to the centromere and that small recombination distances in such regions may correspond to huge physical distances at the DNA level. Towards fine mapping and map-based cloning of Yr26, the objective of this study was to saturate the chromosome region containing Yr26 through comparative genomics analysis using genomic sequences of rice and B. distachyon and available wheat ESTs. Markers closely linked to Yr26 should be useful for marker-assisted selection and contribute towards map-based cloning of this gene.

Results

Genetic Analysis of Stripe Rust Response

Seedlings of 92R137 were resistant (IT 0;) and those of AvS were susceptible (IT 4) in a seedling test with race CYR32. The F2 population segregated in 1,747 resistant and 594 susceptible, fitting a 3∶1 ratio (χ2 3∶1 = 0.17, P = 0.68), indicating that Yr26 in the AvS×92R137 population behaved as a single dominant gene. Among the 551 F2∶3 families tested with the same race, 147 of 409 families derived from resistant F2 plants were homozygous resistant, 262 segregated and 142 families derived from susceptible F2 plants were homozygous susceptible. The segregation of these families conformed to a 1∶2: 1 ratio (χ2 1∶2:1 = 1.36, P = 0.51) as expected for a single gene. The 92 F2∶3 lines recombinant between markers WE201 and STS-BQ6 were further tested with CYR32 to verify their phenotypes. The responses were consistent with earlier F2 phenotypes; that is, 49 F2∶3 families derived from susceptible F2 plants were homozygous susceptible, 7 of 43 families derived from resistant F2 plants were homozygous resistant and 36 were segregating. The results from the recombinant evaluations indicated that the phenotypes of the F2 plants were accurately classified.

Development of Yr26-linked EST-STS Markers from Wheat ESTs

Six EST-STS markers (WE173, WE171, WE177, WE201, WE202 and WE210) linked with Yr26 in an F2 population of 92R137×Yangmai 5 [7] were tested for polymorphism in cross AvS×92R137. Only WE173 and WE201 showed clear polymorphisms between the parents and bulks. Of 163 newly developed EST-STS markers, eight (STS-BQ5, STS-BQ6, STS-CD28, STS-BQ33, STS-BE46, STS-BE68, STS-BQ74 and STS-CD77) produced stable polymorphic bands in the bulk segregant analysis. Among the 10 polymorphic EST-STS markers, 4 (STS-BQ5, STS-BQ33 and STS-BE46) were dominant and 7 were codominant (examples shown in Figure 1). The codominant markers STS-CD77 and WE173 were detected using both agarose gel and polyacrylamide gel electrophoresis. All ten EST-STS markers (Table 1) were used to genotype the entire F2 population of 2,341 plants.
Figure 1

PCR amplifications of the markers on partial plants of the F2 population.

A: dominant marker STS-BQ33; B: codominant marker STS-CD77; RP, 92R137; RB, resistant bulk; SP, AVS; SB, susceptible bulk; R, resistant plants; S, susceptible plants; M, 100 bp marker (A) and D 2000 (B); Arrows indicate the polymorphic bands.

Table 1

Molecular markers mapped at or close to the Yr26 locus.

MarkerWheat ESTForward primer (5′-3′)Reverse primer (5′-3′)Annealing Temperature (°C)
STS-BQ5 a BQ160738 TCCTGACACCAAAGTAACCG ATAGCCAAGCCCCATTCC 52
STS-BQ6 a BQ165938 GAAAAGGGTACAATGATGAGTG CCAGCAGAAACAAAAAAAGG 53
STS-CD28 a CD453471 ACTACTCTTTATTCGTCCCAAC TCGTCTCTGATGACCACAAC 52
STS-BQ33 a BQ160383 TAAACCAAGTCCCCCAAA GGAGTCCATCTTCACCGA 55
STS-BE46 a BE493918 CCGTACTACAGCTACTCGC CATCGTTCAGGTAATCGTC 51
STS-BE68 a BE443531 GAGGTAGATAACACTGATGCG CATAACTTCTCTCCCGACAC 52
STS-BQ74 a BQ169964 TGGATGAACCAACGATAGT TGGGAAACACTTGACTGC 53
STS-CD77 a CD490549 CGACGAAGCCGTTGTTAT TCAAGCAAAGACGAGAGGAT 50
WE201 a BE497109 GCCTGCGAAACTCAGAATGT CCAAAGCAAATGCCACAGTA 54
WE173 a BF474347 GGGACAAGGGGAGTTGAAGC GAGAGTTCCAAGCAGAACAC 55
CON-1 b DR741860 CGCAACAGTTCAACCATACA ATCCTGCTCAGACCCAAAG 61
CON-2 b CJ729769 GTTGGATTTGTCGGTGAA TCTGAGCGATGTAATGGTG 55
CON-3 b DR741641 GGCGGAAACCACGAGACC CGGCGAGATGGAGCGACT 55
CON-4 b CJ883804 GTGCTGTACCTGACGACGGA GTGGAGATGTTGGGCTTGG 58
CON-5 b CD936328 GTGACATCAAGCCAGACAACT GAATCTCAGGGAACGACAATA 52
CON-6 b CD939050 GCCGATGGGGAACTGAAT GTTGAACCGCTTGAACACC 53
CON-7 b CJ955255 CGGCTCCCAAAGGAAGAAT AGGGGAGTCACTTTATGGATTTT 58
CON-8 b GH728673 TTGGAAGTGTACCCGTGAG AGGGCATTTACTGCTGTGAG 55
CON-9 b CJ954892 GGCAGTAGCCAGGGCAAGA CCAAGCTGCGCCCATGTAA 60
CON-10 b CJ550732 ATACTTCAGGAAAATGTTCGA TTTATTAGGTTGCTTTAGGG 52
CON-11 b CA744306 TAGCCTTGACAAGTTCCTCT GTATCATTGATTTTCCGAC 50
CON-12 b BJ280972 CAGTGGACGGAAAGAAGTG TAGCAGTCAAAGTGGGAGC 53
CON-13 b CJ663781 GAACAGAGGCGAAGGCAGGA AGCGGGTGGAAGCCGTAGT 52
CON-14 b BQ246252 GCTTCAGCAGTTACCACATAC TACCTTCATCCAGCATCATC 50
CON-15 b CJ704659 GTAAACGGTTGTCAGACGG GTTCAGAACTAGCGATGCC 59
CON-16 b CF133841 CGTCTACAGGTTCGACAAC TCTTACGCTTCTTAGGGTTT 56
CON-17 b CJ831661 GGTATTCGCAGGCAACTCA ACATCACCTCCCACAGGCT 52
CON-18 b CJ675116 ACCCCGACGGCCTTCAACT ACGATGGTGCCGAAGAGCA 62
CON-19 b CJ805435 AAAATTGTACCACCAGATTG TTTGAAGCCTGTGAGAAAA 52
CON-20 b GH723446 ACGCTGCTGCTGGTGTCGT TCCAGGATGTAGGGGTCGC 60
CON-21 b CJ803731 TTATTGTCGGCTGAACCAG GCCAGGGATGAGCTTTTAT 53

Marker types: STS marker derived directly from wheat EST,

Conserved marker developed by comparative analysis of wheat with B. distachyon and rice, and designed using Conserved Primers 2.0.

PCR amplifications of the markers on partial plants of the F2 population.

A: dominant marker STS-BQ33; B: codominant marker STS-CD77; RP, 92R137; RB, resistant bulk; SP, AVS; SB, susceptible bulk; R, resistant plants; S, susceptible plants; M, 100 bp marker (A) and D 2000 (B); Arrows indicate the polymorphic bands. Marker types: STS marker derived directly from wheat EST, Conserved marker developed by comparative analysis of wheat with B. distachyon and rice, and designed using Conserved Primers 2.0.

Development of Conserved Markers through Comparative Genomics of Wheat with B. distachyon and Rice

To develop more markers for Yr26, 169 wheat ESTs in deletion bin C-1BL-6-0.32 were used to identify their similar genomic sequences in B. distachyon and rice; 126 had significant similarities to B. distachyon sequences and 107 had similar sequences in rice. The distributions of these similar ESTs on chromosomes of B. distachyon and rice are shown in Figure 2. Sixty-eight of 126 ESTs were located on B. distachyon chromosome 3 and 56 of 107 ESTs were closely related to sequences on rice chromosome 10. The results indicated a synteny between wheat chromosomal bin C-1BL-6-0.32, B. distachyon chromosome 3 and rice chromosome 10.
Figure 2

Frequency distributions of wheat ESTs related to B.distachyon and rice genes.

To accurately characterize the collinearity between the Yr26 region and the genomic regions of B. distachyon and rice, ten sequences corresponding to the mapped wheat ESTs were used as queries to perform a BLAST search against the rice and B. distachyon genome sequences. Orthologs of four wheat ESTs, BQ165938, CD453471, BQ160383 and BE443531, were detected on B. distachyon chromosome 3, and the first three were detected on rice chromosome 10. The other six wheat ESTs, BQ160738, BE493918, BQ169964, CD490549, BE497109 and BF474347, either had significant similarities to sequences on other chromosomes of B. distachyon and rice, or the scores and E values were not in accordance with the search parameters (Table S1). Comparative genomic analysis established the collinearity of the Yr26 genomic region with a 4.48 Mb region (Bradi3g28070 – Bradi3g31630) in B. distachyon chromosome 3 and a 3.33 Mb region (Os10g0462900 – Os10g0524500) in rice chromosome 10. The collinear regions in rice and B. distachyon were covered by the EST-STS markers STS-CD28 and STS-BQ33, and the Yr26 region was therefore identified to be syntenic to parts of B. distachyon chromosome 3 and rice chromosome 10. There are 328 genes in the 4.48 Mb region of B. distachyon and 237 genes in the 3.33 Mb region of rice. After alignment of all of the genes present in the collinear regions of rice and B. distachyon, 207 B. distachyon genes had significant similarities with the corresponding rice interval and 191 rice genes had similar DNA sequences in the collinear B. distachyon region. The relationship between wheat ESTs, the rice and B. distachyon genes located in the collinear regions was displayed using the Artemis Comparison Tool [30]. As shown in Figure 3, most gene orders were conserved, but there were some rearrangements. Genes located in the collinear regions of B. distachyon and rice were used as queries to search for orthologous wheat ESTs in the wheat EST database (http://wheat.pw.usda.gov/GG2/blast.shtml) and the identified wheat ESTs were used to design primers. A total of 358 conserved primers were designed using Conserved Primers 2.0 [26] and used to determine polymorphisms between the parents and bulks. Twenty one conserved markers were found to be polymorphic (Table 1). Among the 21 conserved polymorphic markers (Table 1) most, such as CON-3, CON-6, CON-8 and CON-11, were codominant (Figure. S1). All 21 conserved markers were used to genotype the 43 recombinants between STS-CD28 and STS-BQ33.
Figure 3

Collinearity between 4.48 Mb region of B. distachyon and 3.33 Mb region of rice and wheat ESTs.

4.48 Mb: Bd3g28070 – Bd3g31630; 3.33 Mb: Os10g0462900 – Os10g0524500; 24 wheat ESTs; The different colors showed the scores in the BLASTNn. Black, ≤40; Blue, 40–50; Green, 50–80; Purple, 80–200; Red, ≥200.

Collinearity between 4.48 Mb region of B. distachyon and 3.33 Mb region of rice and wheat ESTs.

4.48 Mb: Bd3g28070 – Bd3g31630; 3.33 Mb: Os10g0462900 – Os10g0524500; 24 wheat ESTs; The different colors showed the scores in the BLASTNn. Black, ≤40; Blue, 40–50; Green, 50–80; Purple, 80–200; Red, ≥200.

High Resolution Map for Yr26 and Collinearity Relationships of Wheat EST Markers with Orthologs in B. distachyon and Rice

A high resolution map for Yr26 in deletion bin C-1BL-6-0.32 (Figure 4A) was constructed with 31 markers, including the 10 EST-STS markers developed directly from wheat ESTs and 21 conserved markers developed through synteny analysis with B. distachyon and rice (Figure 4B, C, D; Table 1). The ten EST-STS markers were closely linked to Yr26 with genetic distances ranging from 0.43 to 2.14 cM (Table 2). The conserved markers, which further greatly saturated the linkage map (Figure 4B), were found to be closely linked with the Yr26 locus and fell within a genetic interval of 1.16 cM (0.39 and 0.77 cM on two sides of the gene), and six of them, CON-6, CON-7, CON-8, CON-9, CON-10 and CON-11, cosegregated with Yr26. Two conserved markers, CON-4 and CON-12, flanked the Yr26 locus at genetic distances of 0.08 and 0.17 cM (Figure 4B).
Figure 4

Physical and genetic maps for stripe rust resistance gene Yr26 corresponding to comparative genomic maps of B. distachyon and rice.

A: physical map of wheat 1B; B: genetic map of Yr26; C: B. Distachyon chromosome 3; D: rice chromosome 10; Marker names are indicated on the right side of the map. Map distances (cM) are shown on the left side. Collinear genes are indicated to the right of B. distachyon chromosome 3 and rice chromosome 10 based on chromosome Mb positions.

Table 2

Genetic linkages between Yr26 and 10 polymorphic EST-STS markers in AvS×92R137.

MarkerR plantsS plantsExpected ratioχ2 Distance from Yr26 (cM)a
AHBAHB
STS-BQ5 1740710584A:B = 3∶10.080.82
STS-BQ6 560116918322569A:H:B = 1∶2:11.091.88
STS-CD28 5701171605589A:H:B = 1∶2:10.570.47
STS-BQ33 17371022572A:B = 3∶10.021.39
STS-BE46 1737109585A:B = 3∶10.230.83
STS-BE68 568116613111582A:H:B = 1∶2:10.641.09
STS-BQ74 5671176406588A:H:B = 1∶2:10.760.43
STS-CD77 56311759110583A:H:B = 1∶2:11.030.90
WE173 564115618115578A:H:B = 1∶2:10.891.48
WE210 561116125321570A:H:B = 1∶2:11.042.14

For codominant markers: A = homozygous for the marker allele in resistant plants, B = homozygous for the marker allele in susceptible plants, H = heterozygous for the marker; for dominant markers: A = marker present; B = marker absent;

Distances were estimated by JOINMAP version 4.0.

Physical and genetic maps for stripe rust resistance gene Yr26 corresponding to comparative genomic maps of B. distachyon and rice.

A: physical map of wheat 1B; B: genetic map of Yr26; C: B. Distachyon chromosome 3; D: rice chromosome 10; Marker names are indicated on the right side of the map. Map distances (cM) are shown on the left side. Collinear genes are indicated to the right of B. distachyon chromosome 3 and rice chromosome 10 based on chromosome Mb positions. For codominant markers: A = homozygous for the marker allele in resistant plants, B = homozygous for the marker allele in susceptible plants, H = heterozygous for the marker; for dominant markers: A = marker present; B = marker absent; Distances were estimated by JOINMAP version 4.0. Comparative genomic analysis revealed that 23 and 17 wheat ESTs had similarities on B. distachyon chromosome 3 and rice chromosome 10, respectively (Figure 4C, D; Table 3), again revealing high levels of collinearity of the Yr26 region with B. distachyon chromosome 3 and rice chromosome 10 (Figure 4B, C, D). The orders of these markers were highly conserved between wheat and B. distachyon, but there was a rearrangement between wheat and rice. The rearrangement was observed between markers CON-5 (CD936328) and CON-4 (CJ883804) (Figure 4B, D). The two most closely linked markers CON-4 (CJ883804) and CON-12 (BJ280972) narrowed the genomic region carrying Yr26 to a 1.92 Mb (Bradi3g28410 – Bradi3g29600) on B. distachyon chromosome 3 and 1.17 Mb (Os10g0470700 – Os10g0489800) on rice chromosome 10. There are 135 and 68 genes in the narrowed collinear regions of B. distachyon and rice, respectively. No typical NBS-LRR resistance gene analog was found in the collinear regions of rice (Os10g0470700 – Os10g0489800) and B. distachyon (Bradi3g28410 – Bradi3g29600). However, Bradi3g28590 was annotated as “leucine-rich repeat (LRR) protein kinase”, and Bradi3g29120 was annotated as “protein kinase”. The relationships between the putative LRR and protein kinase genes and Yr26 need to be examined in more detail.
Table 3

Wheat ESTs corresponding to EST-STS markers and conserved markers, and similarity to B. distachyon and rice genomic sequences.

Wheat EST B. distachyon Rice
GeneE valuea PositionGeneE valueb Position
DR741860nac nsd na Os10g0469700 2e-10117822238
CJ729769 Bradi3g28380 029713444nansna
DR741641 Bradi3g28390 029740626nansna
CJ883804 Bradi3g28410 029765151 Os10g0470700 017872818
CD936328nansna Os10g0476300 4e-15418196432
CD939050 Bradi3g28590 1e-9429993923nansna
CJ955255 Bradi3g28730 030153785 Os10g0476400 018204024
GH728673 Bradi3g28760 030193649 Os10g047700 018235714
CJ954892 Bradi3g28900 6e-14630666893 Os10g0479500 018458067
CJ550732 Bradi3g29030 1e-2830875417 Os10g0481500 6e-3218626119
CA744306 Bradi3g29120 4e-17431031552nansna
BJ280972 Bradi3g29600 8e-13531689499 Os10g0489800 3e-11919045478
CJ663781 Bradi3g29770 2e-17731808164nana
BQ246252 Bradi3g30187 032237291nansna
CJ704659 Bradi3g30277 032330105 Os10g0504600 019733671
CF133841 Bradi3g30370 4e-17032457204 Os10g0507500 1e-8619868554
CJ831661 Bradi3g30880 033133705 Os10g0518100 020480254
CJ675116 Bradi3g31140 033293299 Os10g0519600 020547000
CJ805435 Bradi3g31410 4e-14333539338 Os10g0521000 3e-12020609894
GH723446 Bradi3g31440 5e-10733602254 Os10g0521400 1e-10720630918
CJ803731 Bradi3g31480 033625009nansna
BQ165938 Bradi3g33950 4e-2236391235 Os10g0571300 6e-1323105285
CD453471 Bradi3g28070 4e-3929414494 Os10g0462900 6e-2417505263
BQ160383 Bradi3g31630 1e-14033895891 Os10g0524500 1e-14320832477
BE443531 Bradi3g21200 9e-6720196538nansna

E values in BLASTn between wheat EST and B. distachyon gene.

E values in BLASTn between wheat EST and rice gene.

na, not applicable.

ns, not significant.

E values in BLASTn between wheat EST and B. distachyon gene. E values in BLASTn between wheat EST and rice gene. na, not applicable. ns, not significant.

PCR-based Markers for Marker-assisted Selection of Yr26

The 31 markers, including 25 closely-linked markers and 6 cosegregated markers, were used to test wheat cultivars/lines (Table 4) and to assess their potential in marker-assisted selection for Yr26. The results indicated that 11 markers (STS-BQ33, STS-CD77, STS-BQ74, WE173, CON-1, CON-3, CON-4, CON-5, CON-6, CON-10 and CON-19) could be useful in selection of Yr26 in breeding programs.
Table 4

Presence (+) and absence (−) of 11 molecular markers that can distinguish Yr26 from other Yr genes in wheat genotypes.

Wheat genotypeGene STS-BQ33 STS-BQ74 STS-CD77 WE173 CON-1 CON-3 CON-4 CON-5 CON-6 CON-10 CON-19
AvSYr1NILa Yr1 d
AvSYr24NIL Yr24 ++++++++++
AvSYr26NIL Yr26 +++++++++++
Chuanmai 42 YrCH42 ++++++++++
92R137b Yr26 +++++++++++
Chinese166c Yr1
AvS

The same pattern occurred for Avocet NILs possessing Yr5, Yr6, Yr7, Yr8, Yr9, Yr10, Yr15, Yr17, Yr18 and Yr27.

The same pattern occurred for 13 additional Chinese varieties with Yr26 (Shanmai 107, Shanmai 175, Shanmai 139, Mianmai 39, Mianmai 42, Mianmai 96-5, Lantian 17, Zhong G918, Neimai 8, Neimai 9, Neimai 11, Neimai 836 and Chuannong 22).

The same pattern occurred for 13 wheat varieties with known stripe rust resistance genes [Chinese 166 (Yr1), Triticum spelta album (Yr5), Mianyang 90–310/M 180 (Yr6), 8718/Chuanyu 12 (Yr7), Han 4599 (Yr9), Moro (Yr10), G-25 (Yr15), Chinese Spring (Yr18), Mian 2000–18 (Yr27), W7984 (Yr28), RSL65 (Yr36), Line 03524 (Yr38) and Chuannong 19 (Yr41)].

‘−’, same bands as AvS; ‘+’, same bands as AvSYr26 NIL and 92R137.

The same pattern occurred for Avocet NILs possessing Yr5, Yr6, Yr7, Yr8, Yr9, Yr10, Yr15, Yr17, Yr18 and Yr27. The same pattern occurred for 13 additional Chinese varieties with Yr26 (Shanmai 107, Shanmai 175, Shanmai 139, Mianmai 39, Mianmai 42, Mianmai 96-5, Lantian 17, Zhong G918, Neimai 8, Neimai 9, Neimai 11, Neimai 836 and Chuannong 22). The same pattern occurred for 13 wheat varieties with known stripe rust resistance genes [Chinese 166 (Yr1), Triticum spelta album (Yr5), Mianyang 90–310/M 180 (Yr6), 8718/Chuanyu 12 (Yr7), Han 4599 (Yr9), Moro (Yr10), G-25 (Yr15), Chinese Spring (Yr18), Mian 2000–18 (Yr27), W7984 (Yr28), RSL65 (Yr36), Line 03524 (Yr38) and Chuannong 19 (Yr41)]. ‘−’, same bands as AvS; ‘+’, same bands as AvSYr26 NIL and 92R137.

Discussion

Despite the increasing numbers of stripe rust resistance genes identified and deployed in wheat breeding programs, only two have been cloned and characterized [2], [3]. In the present study we established a high resolution map of Yr26 using a comparative genomics approach to provide a sound basis for further progress in map-based cloning of this gene. There is collinearity among wheat chromosome 1B, rice chromosome 10 and B. distachyon chromosome 3 [9], [14], [31]. In the present study, most of the 169 wheat ESTs in the deletion bin C-1BL-6-0.32 were found to have significant similarities with genes on B. distachyon chromosome 3 and rice chromosome 10, confirming a close syntenic relationship and indicating that the genomic sequences of B. distachyon and rice should be useful for comparative analysis wheat genes. Rice was the first selected grass species for genome sequencing [32], [33] and B. distachyon is considered as the best model for wheat at present [34], [35]. In the present study, we found a higher number of orthologs between wheat and B. distachyon than between wheat and rice. This is consistent with the relationships among the three species as reported in the above studies. Nevertheless, many exceptions to collinearity were observed in the comparisons of wheat, rice and B. distachyon due to rearrangements involving gene transposition, duplication, deletion and inversion [13], [36], [37]. Such anomalies in collinearity complicated the use of model species for genetics. These model grass genomes may not always provide sequence information to assist in identification of candidate gene. In the present study, gene deletions were observed when comparing the orthologous regions of rice and B. distachyon, in the collinear regions of rice (Os10g0462900 – Os10g0524500) and B. distachyon (Bradi3g28070 – Bradi3g31630), 46 rice genes had no orthologs in the corresponding region of the B. distachyon genome, and 121 genes predicted in B. distachyon had no orthologs in the corresponding region of the rice genome. Within the narrowed collinear regions between markers CON-4 and CON-12, only two genes, Bradi3g28590 and Bradi3g29120 annotated as LRR and protein kinases, were present in the 1.92Mb region (Bradi3g28410 – Bradi3g29600) of B. distachyon, but these were absent in the collinear region of rice (Os10g0470700 – Os10g0489800). Even if a target gene has no orthlogs in rice and B. distachyon, the flanking genes in those species are sufficiently conserved to provide useful information for developing conserved markers to saturate the target gene region in wheat. With 25 wheat genes found to have orthologs in B. distachyon and rice and six cosegregated markers for Yr26, the present study demonstrates a comparative genomics approach using the B. distachyon and rice sequences is effective for identifying markers for genes in wheat. High resolution physical maps of wheat chromosomes showed that most disease resistance genes are arranged in clusters and are present mainly in the distal parts of the chromosomes [38]. Resistance genes cloned by map-based cloning, such as leaf rust resistance genes Lr21 [39] and stripe rust resistance gene Yr36 [3], are all distally located. In contrast, the target gene Yr26 in this study maps to deletion bin C-1BL-6-0.32, a region that is near the centromere of chromosome 1B. Because recombination is limited around the centromere regions, with a consequent inflation in physical/genetic distances [40], map-based cloning of Yr26 will be extremely difficult. However, we believe the difficulty can be overcome by integrating comparative genomics with BAC based chromosome walking torward the gene. The cosegregating and closely linked markers identified in the present study will be useful for screening the BAC library and identify BAC clones containing Yr26. Based on the high level of effectiveness and some evidence of race specificity, we hypothesize that Yr26 could be a NBS-LRR type gene. The resistance gene candidates of the NBS-LRR type can be tested for resistance functions using gene silencing, mutation and transformation. Cloning of the Yr26 gene may contribute to understanding the mechanism of resistance at the molecular level and to a better understanding of this gene and its possible alleles. New markers developed in this study are diagnostic for Yr26 and should facilitate rapid detection of Yr26 (and putative alleles) in wheat cultivars and breeding lines, and therefore, can be used for pyramiding Yr26 with other resistance genes to develop wheat cultivars with durable resistance.

Materials and Methods

Wheat Genotypes and Evaluation of Stripe Rust Reactions

A F2 population of 2,341 plants and 551 F3 line progenies with 30–40 plants in each, derived from a cross between susceptible genotype Avocet S (AvS) and resistant line 92R137 (Yr26), were used for genetic analysis and fine mapping of Yr26. For 92 F2 plants identified as recombinants between markers WE201 and STS-BQ6 flanking Yr26 [7], 30–40 plants in each of their F2∶3 families were tested with Pst race CYR32 to confirm the phenotypes of the corresponding F2 plants. A total of 41 wheat genotypes were used to validate the molecular markers identified to be linked to the Yr26 locus, including 13 Yr near-isogenic lines (NILs) of Avocet S (AvS), 13 Chinese wheat cultivars with Yr26, 13 wheat genotypes with known Yr genes and 2 genotypes (92R137 and AvS) as positive and negative controls for the Yr26 allele (Table 4). A predominant Chinese Pst race CYR32, which was avirulent on the AvSYr26 NIL and virulent on AvS, was used to test the F2 and F2∶3 populations and their parents. Seedlings grown in the greenhouse under controlled conditions were inoculated with fresh urediniospores when second leaves were fully expanded. Inoculated plants were incubated at 9°C and 100% relative humidity for 24 h and then transferred into a greenhouse with 14 h light (22,000 lx) at 17°C and 10 h of darkness at 12°C. Infection types (IT) were scored on a 0–4 scale [18] 15 days after inoculation when stripe rust symptoms were fully developed on the susceptible parent.

DNA Extraction and Bulked Segregant Analysis

Genomic DNA was extracted from F2 seedlings of cross 92R137×AvS and the wheat genotypes described above using the sodium lauroylsarcosine protocol [19], [20]. Based on stripe rust response phenotypes, 10 resistant and 10 susceptible F2 plants with the same infection types as the resistant (IT 0;) and susceptible (IT 4) parents were selected to establish the resistant (BR) and susceptible (BS) bulks for bulked segregant analysis [21].

Development of EST-STS Markers

Because Yr26 was previously assigned to wheat chromosome deletion bin C-1BL-6-0.32 with six EST-STS markers (WE201, WE202, WE210, WE171, WE173 and WE177) [7], these markers were used to test for polymorphisms between the present parents and bulks. In addition to those markers, 163 new pairs of EST-STS primers were designed from wheat ESTs mapped in the deletion bin (http://www.wheat.pw.usda.gov/index.shtml) using Primer Premier 5 software, and used in the bulked segregant analysis.

Comparative Genomic Analysis and Conserved Marker Development

To develop more markers for Yr26, a comparative genomics approach was used. First, all of the 169 wheat ESTs assigned to deletion bin C-1BL-6-0.32 were used in BLASTn searching to identify collinear regions in the genomes of B. distachyon (http://www.brachypodium.org/) and rice (http://rice.plantbiology.msu.edu/cgi-bin/gbrowse/rice/). Homologous sequences of B. distachyon and rice were selected using an expected value of 1E−10 and identity ≧80% as cutoff points. Then ten mapped ESTs sequences were selected to identify collinear regions between the Yr26 region, B. distachyon and rice based on the BLASTn results. The genes of B. distachyon and rice located in the collinear regions were used as queries to search the wheat EST database (http://wheat.pw.usda.gov/GG2/blast.shtml) using BLASTn. A total of 358 wheat ESTs were identified and used to design conserved markers [22], [23], [24], [25] using Conserved Primers 2.0 software [25].

PCR Amplification and Electrophoresis

PCR was performed in a S1000 Thermal Cycler (BIO-RAD) for each DNA sample in a volume of 15 µl containing 1.0 U Taq DNA polymerase, 1.5 µl of 10× buffer (50 mmol KCl, 10 mmol Tris-HCl, pH 8.3), 2.0 mmol MgCl2, 200 µmol of each dNTP, 0.6 µmol of each primer and 50–100 ng of template DNA. The PCR conditions were: denaturation at 94°C for 4 min, followed by 35 cycles of 94°C for 1 min, 55°C for 1 min, 72°C for 1 min and a final extension for 10 min at 72°C. PCR products were separated in 6% denaturing polyacrylamide gels, 8% non-denaturing polyacrylamide gels or 1.5% agarose gels, depending upon the marker, visualized using silver staining [26] for polyacrylamide gels or ethidium bromide for agarose gels and photographed.

Statistical Analysis and Genetic Linkage Map

Chi-squared analysis (χ2) was used to test agreement of expected and obtained segregation ratios. The genetic distances between markers and the Yr26 locus were calculated with software JOINMAP version 4.0 [27] using the Kosambi mapping function [28] and a LOD score of 3.0 as a threshold. The genetic linkage map was drawn with the software Mapdraw V2.1 [29]. Examples of PCR products amplified with four conserved markers. CON-1 (a), CON-4 (b), CON-6 (c) and CON-7 (d); RP, 92R137; RB, resistant bulk; SP, AVS; SB, susceptible bulk; R, resistant plants; S, susceptible plants; Arrow indicated the polymorphic amplification products. (TIF) Click here for additional data file. BLASTn search of and rice with ten mapped wheat ESTs. (DOC) Click here for additional data file.
  29 in total

1.  Identification of wheat chromosomal regions containing expressed resistance genes.

Authors:  Muharrem Dilbirligi; Mustafa Erayman; Devinder Sandhu; Deepak Sidhu; Kulvinder S Gill
Journal:  Genetics       Date:  2004-01       Impact factor: 4.562

2.  [MapDraw: a microsoft excel macro for drawing genetic linkage maps based on given genetic linkage data].

Authors:  Ren-Hu Liu; Jin-Ling Meng
Journal:  Yi Chuan       Date:  2003-05

3.  Identification of markers linked to disease-resistance genes by bulked segregant analysis: a rapid method to detect markers in specific genomic regions by using segregating populations.

Authors:  R W Michelmore; I Paran; R V Kesseli
Journal:  Proc Natl Acad Sci U S A       Date:  1991-11-01       Impact factor: 11.205

4.  A putative ABC transporter confers durable resistance to multiple fungal pathogens in wheat.

Authors:  Simon G Krattinger; Evans S Lagudah; Wolfgang Spielmeyer; Ravi P Singh; Julio Huerta-Espino; Helen McFadden; Eligio Bossolini; Liselotte L Selter; Beat Keller
Journal:  Science       Date:  2009-02-19       Impact factor: 47.728

5.  Intron-flanking EST-PCR markers: from genetic marker development to gene structure analysis in Rhododendron.

Authors:  Hui Wei; Yan Fu; Rajeev Arora
Journal:  Theor Appl Genet       Date:  2005-11-15       Impact factor: 5.699

6.  Construction and analysis of a BAC library in the grass Brachypodium sylvaticum: its use as a tool to bridge the gap between rice and wheat in elucidating gene content.

Authors:  Tracie N Foote; Simon Griffiths; Sebastien Allouis; Graham Moore
Journal:  Funct Integr Genomics       Date:  2004-01-16       Impact factor: 3.410

7.  Fine scale genetic and physical mapping using interstitial deletion mutants of Lr34 /Yr18: a disease resistance locus effective against multiple pathogens in wheat.

Authors:  W Spielmeyer; R P Singh; H McFadden; C R Wellings; J Huerta-Espino; X Kong; R Appels; E S Lagudah
Journal:  Theor Appl Genet       Date:  2007-12-12       Impact factor: 5.699

8.  Map-based isolation of the leaf rust disease resistance gene Lr10 from the hexaploid wheat (Triticum aestivum L.) genome.

Authors:  Catherine Feuillet; Silvia Travella; Nils Stein; Laurence Albar; Aurélie Nublat; Beat Keller
Journal:  Proc Natl Acad Sci U S A       Date:  2003-11-25       Impact factor: 11.205

9.  Map-based cloning of leaf rust resistance gene Lr21 from the large and polyploid genome of bread wheat.

Authors:  Li Huang; Steven A Brooks; Wanlong Li; John P Fellers; Harold N Trick; Bikram S Gill
Journal:  Genetics       Date:  2003-06       Impact factor: 4.562

10.  The wheat VRN2 gene is a flowering repressor down-regulated by vernalization.

Authors:  Liuling Yan; Artem Loukoianov; Ann Blechl; Gabriela Tranquilli; Wusirika Ramakrishna; Phillip SanMiguel; Jeffrey L Bennetzen; Viviana Echenique; Jorge Dubcovsky
Journal:  Science       Date:  2004-03-12       Impact factor: 47.728

View more
  16 in total

1.  Fine mapping and identification of a candidate gene for the barley Un8 true loose smut resistance gene.

Authors:  Wen Zang; Peter E Eckstein; Mark Colin; Doug Voth; Axel Himmelbach; Sebastian Beier; Nils Stein; Graham J Scoles; Aaron D Beattie
Journal:  Theor Appl Genet       Date:  2015-04-17       Impact factor: 5.699

2.  Molecular mapping of genes Yr64 and Yr65 for stripe rust resistance in hexaploid derivatives of durum wheat accessions PI 331260 and PI 480016.

Authors:  P Cheng; L S Xu; M N Wang; D R See; X M Chen
Journal:  Theor Appl Genet       Date:  2014-08-21       Impact factor: 5.699

3.  Genetic mapping of a putative Thinopyrum intermedium-derived stripe rust resistance gene on wheat chromosome 1B.

Authors:  Q Huang; X Li; W Q Chen; Z P Xiang; S F Zhong; Z J Chang; M Zhang; H Y Zhang; F Q Tan; Z L Ren; P G Luo
Journal:  Theor Appl Genet       Date:  2014-02-02       Impact factor: 5.699

Review 4.  Brachypodium as an emerging model for cereal-pathogen interactions.

Authors:  Timothy L Fitzgerald; Jonathan J Powell; Katharina Schneebeli; M Mandy Hsia; Donald M Gardiner; Jennifer N Bragg; C Lynne McIntyre; John M Manners; Mick Ayliffe; Michelle Watt; John P Vogel; Robert J Henry; Kemal Kazan
Journal:  Ann Bot       Date:  2015-04       Impact factor: 4.357

5.  Toward a better understanding of the genomic region harboring Fusarium head blight resistance QTL Qfhs.ndsu-3AS in durum wheat.

Authors:  Xianwen Zhu; Shaobin Zhong; Shiaoman Chao; Yong Qiang Gu; Shahryar F Kianian; Elias Elias; Xiwen Cai
Journal:  Theor Appl Genet       Date:  2015-09-18       Impact factor: 5.699

6.  Molecular mapping and marker development for the Triticum dicoccoides-derived stripe rust resistance gene YrSM139-1B in bread wheat cv. Shaanmai 139.

Authors:  Hong Zhang; Lu Zhang; Changyou Wang; Yajuan Wang; Xinli Zhou; Shikai Lv; Xinlun Liu; Zhensheng Kang; Wanquan Ji
Journal:  Theor Appl Genet       Date:  2015-12-09       Impact factor: 5.699

7.  SNP-based pool genotyping and haplotype analysis accelerate fine-mapping of the wheat genomic region containing stripe rust resistance gene Yr26.

Authors:  Jianhui Wu; Qingdong Zeng; Qilin Wang; Shengjie Liu; Shizhou Yu; Jingmei Mu; Shuo Huang; Hanan Sela; Assaf Distelfeld; Lili Huang; Dejun Han; Zhensheng Kang
Journal:  Theor Appl Genet       Date:  2018-04-17       Impact factor: 5.699

8.  Genetic mapping of a barley leaf rust resistance gene Rph26 introgressed from Hordeum bulbosum.

Authors:  Xiaohui Yu; Hoi Yee Kong; Vijitha Meiyalaghan; Seona Casonato; Soonie Chng; E Eirian Jones; Ruth C Butler; Richard Pickering; Paul A Johnston
Journal:  Theor Appl Genet       Date:  2018-09-03       Impact factor: 5.699

9.  Defeating the Warrior: genetic architecture of triticale resistance against a novel aggressive yellow rust race.

Authors:  Dominik Losert; Hans Peter Maurer; Willmar L Leiser; Tobias Würschum
Journal:  Theor Appl Genet       Date:  2016-12-30       Impact factor: 5.699

Review 10.  Recent trends and perspectives of molecular markers against fungal diseases in wheat.

Authors:  Umesh Goutam; Sarvjeet Kukreja; Rakesh Yadav; Neha Salaria; Kajal Thakur; Aakash K Goyal
Journal:  Front Microbiol       Date:  2015-08-25       Impact factor: 5.640

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.