Literature DB >> 20544028

The sudden dominance of blaCTX-M harbouring plasmids in Shigella spp. Circulating in Southern Vietnam.

Nhu Thi Khanh Nguyen1, Vinh Ha, Nga Vu Thieu Tran, Richard Stabler, Duy Thanh Pham, Thi Minh Vien Le, H Rogier van Doorn, Ana Cerdeño-Tárraga, Nicholas Thomson, James Campbell, Van Minh Hoang Nguyen, Thi Thu Nga Tran, Minh Van Pham, Thuy Thu Cao, Brendan Wren, Jeremy Farrar, Stephen Baker.   

Abstract

BACKGROUND: Plasmid mediated antimicrobial resistance in the Enterobacteriaceae is a global problem. The rise of CTX-M class extended spectrum beta lactamases (ESBLs) has been well documented in industrialized countries. Vietnam is representative of a typical transitional middle income country where the spectrum of infectious diseases combined with the spread of drug resistance is shifting and bringing new healthcare challenges.
METHODOLOGY: We collected hospital admission data from the pediatric population attending the hospital for tropical diseases in Ho Chi Minh City with Shigella infections. Organisms were cultured from all enrolled patients and subjected to antimicrobial susceptibility testing. Those that were ESBL positive were subjected to further investigation. These investigations included PCR amplification for common ESBL genes, plasmid investigation, conjugation, microarray hybridization and DNA sequencing of a bla(CTX-M) encoding plasmid. PRINCIPAL
FINDINGS: We show that two different bla(CTX-M) genes are circulating in this bacterial population in this location. Sequence of one of the ESBL plasmids shows that rather than the gene being integrated into a preexisting MDR plasmid, the bla(CTX-M) gene is located on relatively simple conjugative plasmid. The sequenced plasmid (pEG356) carried the bla(CTX-M-24) gene on an ISEcp1 element and demonstrated considerable sequence homology with other IncFI plasmids. SIGNIFICANCE: The rapid dissemination, spread of antimicrobial resistance and changing population of Shigella spp. concurrent with economic growth are pertinent to many other countries undergoing similar development. Third generation cephalosporins are commonly used empiric antibiotics in Ho Chi Minh City. We recommend that these agents should not be considered for therapy of dysentery in this setting.

Entities:  

Mesh:

Substances:

Year:  2010        PMID: 20544028      PMCID: PMC2882334          DOI: 10.1371/journal.pntd.0000702

Source DB:  PubMed          Journal:  PLoS Negl Trop Dis        ISSN: 1935-2727


Introduction

Enterobacteriaceae that have the capability to express CTX-M (so named because of their hydrolytic activity against cefotaxime) family extended spectrum beta lactamases (ESBLs) have emerged as a major health threat worldwide [1], [2]. Most of the research in this area is conducted in industrialized countries, where organisms, such as Escherichia coli and Klebsiella spp., mostly from urinary tract infections are the commonest source [3], [4], [5]. Relatively little is known about the distribution of such genes in organisms found developing or countries undergoing an economic transition, where the circulating pathogens may differ. Enterobacteriaceae capable of producing ESBLs have been described previously in South East Asia [6], [7]. Ho Chi Minh City in southern Vietnam is typical of many cities where patterns of infectious diseases are changing due to rapid economic growth, better access to health care and improving infrastructure. We recently showed that 42% of healthy people carried ESBL producing bacteria as part of their regular intestinal flora [8]. This previous work suggested that commensal organisms play a role in the dissemination and maintenance of such antimicrobial resistance genes in the population. Furthermore, the uncontrolled use of antimicrobials in the human population and in livestock rearing may lead to further problems with drug resistance and even more limited therapeutic options. Shigellosis is a gastrointestinal infection caused by members by Shigella spp. Due to the faecal oral route of transmission of the Shigellae, children less than five years old and living in developing countries have the highest incidence [9], [10]. In our hospital in Ho Chi Minh City, shigellosis is the leading cause of paediatric diarrhoeal admission with bacterial aetiology. The infection is typically self limiting, although antimicrobial treatment is necessary for the young and those that are severely ill as it ensures fewer complications and curtails the duration of the disease [11]. Fluoroquinolones are the drugs of choice to treat Shigella infections in both adults and children [12]. However, as with many other members of the Enterobacteriaceae, mutations in the genes encoding the target proteins for fluoroquinolones are common in Shigella [13], [14]. Our recent findings show that patients with shigellosis are staying in hospital for longer periods compared with 5 and 10 years ago and the disease severity has concurrently increased [15]. Interestingly, at the same time there has been a significant species shift from S. flexneri to S. sonnei isolated from patients [15]. Patients here are treated with fluoroquinolones, however, those patients that do not respond to the standard therapy are treated with third generation cephalosporins (mainly ceftriaxone). The intravenous third generation cephalosporins are amongst the most commonly used antimicrobials in hospitals in Ho Chi Minh City and the oral second and third generation cephalosporins are also widely available in the community. Antimicrobial resistance in the Shigellae is common; these organisms are closely related to E. coli and are readily transformed by exogenous DNA [16], [17], [18]. The distribution of antimicrobial resistance is, however, often different depending on the species. A multi-centre study across Asia demonstrated that S. flexneri were more likely to be resistant to ampicillin, whilst S. sonnei were more likely to be resistant to co-trimoxazole [19]. Resistance patterns and species dominance are variable depending on the specific location [20], [21], [22]. We have previously reported the rapid emergence of third generation cephalosporin resistant Shigella in Vietnam, where we noted the routine isolation of a number of ESBL producing microorganisms [15]. Here, we present data suggesting that ESBL negative organisms have been replaced with ESBL positive organisms.

Materials and Methods

Ethics statement

This study was conducted according to the principles expressed in the Declaration of Helsinki. This study was approved by the scientific and ethical committee of the HTD and Oxford tropical research ethics committee (OXTREC) number 010-06 (2006). All parents of the subject children were required to provide written informed consent for the collection of samples and subsequent analysis.

Patient criteria

The work was conducted on the paediatric gastrointestinal infections ward at the hospital for tropical diseases (HTD) in Ho Chi Minh City in Vietnam. The HTD is a 500 bed tertiary referral hospital treating patients from the surrounding provinces and from the districts within Ho Chi Minh City. All patients from which Shigella spp. were isolated were enrolled into a randomized controlled trial comparing treatment with ciprofloxacin and gatifloxicin as described previously [15] (trial number ISRCTN55945881). Briefly, all children (aged 0–14 years) with dysentery (defined as passing bloody diarrhoea or mucoid stools with additional abdominal pain or tenesmus) whose parent or guardian gave fully informed written consent were eligible for admission to the study. The primary outcome of the trial was treatment failure, defined as the patient not clearing symptoms after five days of antimicrobial treatment.

Microbiological culture and antimicrobial testing

Stool samples were collected from patients and cultured directly on the day of sampling. Samples were cultured overnight in selenite F broth (Oxoid, Basingstoke, UK) and plated onto MacConkey and XLD agar (Oxoid) at 37°C. Colonies suggestive of Shigella were sub-cultured on to nutrient agar and were identified using a ‘short set’ of sugar fermentation reactions (Kliger iron agar, urea agar, citrate agar, SIM motility-indole media (Oxoid, United Kingdom)). Serologic identification was performed by slide agglutination with polyvalent somatic (O) antigen grouping sera, followed by testing with available monovalent antisera for specific serotype identification as per the manufacturer's recommendations (Denka Seiken, Japan). Antimicrobial susceptibility testing of all Shigella isolates against ampicillin (AMP), chloramphenicol (CHL), trimethoprim – sulfamethoxazole (SXT), tetracycline (TET), nalidixic acid (NAL), ofloxacin (OFX;) and ceftriaxone (CRO) was performed by disk diffusion (Oxoid, United Kingdom). The minimum inhibitory concentrations (MICs) were additionally calculated for all isolates by E-test, according to manufacturer's recommendations (AB Biodisk, Sweden). Those strains that were identified as resistant to ceftriaxone using the disk diffusion susceptibility test were further subjected to the combination disc method to confirm ESBL production [23], [24]. The combination disc method utilizes discs containing only cefotaxime (CTX) (30 µg) and ceftazidime (CAZ) (30 µg) and both antimicrobials combined with clavulanic acid (CLA) (10µg). ESBL producing strains were identified as those with a greater than 5 mm increase in zone with the single antimicrobial compared to the combined antimicrobial, i.e. demonstrating ESBL inhibition [25]. All antimicrobial testing was performed on Mueller-Hinton agar, data was interpreted according to the Clinical and Laboratory Standards Institute guidelines [26].

Genomic DNA isolation and DNA microarray hybridisation

Genomic DNA was isolated from strains that were subjected to PCR and DNA microarray hybridisation from 1 ml of a 5 ml overnight bacterial culture using the wizard genomic DNA extraction kit (Promega, USA), as per the manufacturer's recommendations. For characterization of gene content of isolated Shigella strains, genomic DNA was hybridized to an active surveillance of pathogens (ASP) oligonucleotide microarray [27], [28]. The ASP array contains over 6,000 gene markers, including species signature genes, virulence genes and antimicrobial resistance genes from over a hundred bacterial species. Thus the ASP array provides data for assessing horizontally transferred genes, such data is helpful for diagnosis and for guiding antimicrobial therapy. The ASP array used in this study was version 6.2 and was designed and constructed as described previously [28]. Test samples were labelled and hybridised as described previously [29]. Briefly, 5 µg genomic DNA was labelled with Cy5 and hybridised with a formamide based hybridisation buffer solution in a final volume of 48 µl at 50°C for 16–20 hours. The ASP arrays were washed as described previously but with the initial wash at 50°C [29]. The ASP arrays were scanned using a 418 microarray Scanner (Affymetrix, USA) and intensity fluorescence data acquired using ImaGene 7.5 (BioDiscovery, USA). Data was analysed as described previously by Stabler et al. [28]. Briefly, a reporter was considered positive if the background corrected mean reporter signal from duplicate spots was both greater than one standard deviation of reporter signal (reporter variation) and the mean reporter signal was greater than the whole background corrected microarray mean plus one standard deviation, as shown for S. sonnei EG1007 in Dataset S1 in supporting information. The raw microarray data for all isolates is presented in Dataset S2 in supporting information.

Plasmid extraction and visualisation

Plasmid DNA was isolated from ESBL positive and ESBL negative Shigella isolates using a modified version of the methodology previously described by Kado and Liu [30]. The resulting plasmid DNA was separated by electrophoresis in 0.7% agarose gels made with 1× E buffer. Gels were run at 90 V for 3 h, stained with ethidium bromide and photographed. For DNA sequencing plasmid DNA containing an ESBL gene was extracted from an E. coli transconjugant using a NucleoBond® Xtra Midi kit as per the manufacturers recommendations (Clontech, USA)

ESBL gene PCR amplification and characterisation

Genomic DNA was subjected to PCR amplification targeting known classes of bla genes using, initially, primers that would recognise sequences encoding SHV, (F; 5′ TCTCCCTGTTAGCCACCCTG, R; 5′; CCACTGCAGCAGCTGC) TEM (F; 5′ TGCGGTATTATCCCGTGTTG, R; 5′ TCGTCGTTTGGTATGGCTTC) and CTX-M (F; 5′ CGATGTGCAGTACCAGTAA, R; 5′ TTAGTGACCAGAATCAGCGG) class ESBLs [31], [32]. Further characterisation of the various sub-group of bla CTX ESBL genes was performed using primers, CTX-M-1; (F 5′ ATGGTTAAAAAATCACTGCG, R 5′ TTACAAACCGTCGGTGAC), CTX-M-2; (F 5′ TGGAAGCCCTGGAGAAAAGT and R 5′ CTTATCGCTCTCGCTCTGT) and CTX-M-9; (F 5′ATGGTGACAAAGAGAGTGCAAC, R 5′ TTACAGCCCTTCGGCGATG) using previously outlined PCR amplification conditions [31], [32]. To identify an association with CTX-M genes and the adjacent ISEcp1 transposase, all ESBL positive strains were subjected to PCR with primers forward primers Tnp24F 5′ CACTCGTCTGCGCATAAAGCGG, Tnp15F 5′ CCGCCGTTTGCGCATA CAGCGG (for bla CTX-M-24 and bla CTX-M-15 respectively) and reverse primer TnpR 5′ AGATATGTAATCATGAAGTTGTCGG. The Tnp24F and Tnp15F were located within the bla CTX-M-24 and bla CTX-M-15 genes respectively and TnpR was located within the ISEcp1 transposase gene. The bla-transposase PCR was performed under the following conditions; 95°C for 1 minute, 30 cycles of 95°C for 30 seconds, 56°C for 30 seconds, 72°C for 1 minute 30 seconds and 72°C for 2 minutes. All PCRs were performed using Taq DNA polymerase and appropriate recommended concentrations of reagents (Bioline, UK). Positive PCR amplicons were cloned into cloning vector pCR 2.1 (Invitrogen, USA) and sequencing reactions were carried out as recommended by the manufacturer using big dye terminators in forward and reverse orientation on an ABI 3700 sequencing machine (ABI, USA). All sequencing reactions were performed twice to ensure correct sequencing and sequences were verified, aligned and manipulated using Bioedit software (http://www.mbio.ncsu.edu/BioEdit/bioedit.html). All ESBL gene sequences were compared to other ESBL sequences by BLASTn at NCBI. The DNA sequence of various classes of bla CTX were downloaded and aligned with the produced sequences.

Bacterial conjugation

Bacterial conjugation experiments were performed by combining equal volumes (3 ml) of overnight Luria-Bertani cultures of donor and recipient strains. The donor strains were Shigella clinical isolates carrying bla CTX genes and the recipient was E. coli J53 (sodium azide resistant). Bacteria were conjugated for 12 hours at 37°C and transconjugants were selected on Luria-Bertani media containing sodium azide (100 µg/ml) and ceftriaxone (6 µg/ml). Potential transconjugants were verified by serotyping and plasmid extraction.

Plasmid sequencing and annotation

Plasmid pEG356 was selected for DNA sequencing and annotation as previously described [33]. The DNA sequence was annotated to identify coding sequences and repeat sequences in Artemis. To identify plasmids with similar sequences, pEG356 was compared by BLASTn at NCBI. pAPEC-01-ColBM (Ac. DQ381420) [34] was downloaded and aligned with pEG356 and viewed in Artemis Comparison Tool (ACT) [35]. Schematic drawing of the sequence of pEG356 was constructed using DNAplotter [36]. Artemis, ACT and DNAplotter are freely available at (http://www.sanger.ac.uk/Software). The full sequence and annotation of pEG356 was submitted to EMBL with the accession number FN594520.

Results

The escalating isolation rate of ESBL positive Shigella spp. in Ho Chi Minh City

During a 24 month period between April 2007 and March 2009 we isolated 94 Shigella strains from the stools of children admitted with dysentery. Of these 94 strains, 24 were S. flexneri and 70 were S. sonnei, confirming the species substitution previously noted from isolates in this region [15]. The general antibiotic sensitivity patterns in these strains were variable, although resistance to trimethoprim – sulfamethoxazole, tetracycline and latterly nalidixic acid were ubiquitous and there was an overall propensity of sensitivity towards older generation antimicrobials such as chloramphenicol (Table 1). A reversion of sensitivity to older therapies highlights how antimicrobial resistance genes can be maintained (or otherwise) by selective antimicrobial pressure in the population.
Table 1

Resistance profiles and isolation date of ceftriaxone resistance Shigella from southern Vietnam.

Antimicrobial Tested
AMPCHLSXTTETNALOFXCRO
Strain IDSerotypeAge (months)SexMonthYearProvinceESBL (+/−)DiscMICDiscMICDiscMICDiscMICDiscMICDiscMICDiscMIC
DE0611 S. sonnei 10MFebruary2001HCMC+R>256R8R>32R128S2S0.06R>255
EG0356 S. sonnei 48MMay2007HCMC+R>256S6.0R>32R64R64S0.38R>256
EG0373 S. sonnei 30MJune2007HCMC+R>256S6.0R>32R128S1.5S0.064R>256
EG0384 S. sonnei 36MJuly2007HCMC+R>256S6R>32R256R32S0.38R>256
EG0390 S. sonnei 17MAugust2007VINH LONG+R>256S6R>32R128R>256S0.38R>256
EG0395 S. sonnei 36FSeptember2007HCMC+R>256S12R>32R96R>256S0.5R>256
EG0162 S. sonnei 28MOctober2007DONG THAP+R>256S8R>32R48R64S0.38R>256
EG0419 S. flexneri 23FDecember2007HCMCR>256R>256R>32R48R>256S0.5R128
EG0187 S. sonnei 16MJanuary2008DONG THAP+R>256S3R>32R192S1.5S0.047R24
EG0421 S. sonnei 36FJanuary2008HCMC+R>256S4R>32R>256R128S0.38R>32
EG0424 S. sonnei 48FJanuary2008HCMC+R>256S6R>32R64R>256S0.38R>256
EG0204 S. sonnei 26FMarch2008DONG THAP+R>256S6R>32R32R64S0.38R>256
EG0430 S. sonnei 36FMarch2008HCMC+R>256S6R>32R>256R48S0.25R128
EG1008 S. sonnei 18MMay2008LONG AN+R>256S8R>32R96R128S0.38R>256
EG1009 S. sonnei 8MMay2008HCMC+R>256S8R>32R96R192S0.38R>256
EG1010 S. sonnei 60FMay2008HCMC+R>256S6R>32R96R>256S0.5R>256
EG1013 S. sonnei 25MJune2008HCMC+R>256S6R>32R96R>256S0.25R>256
EG1012 S. sonnei 15FJune2008HCMC+R>256S8R>32R96R192S0.38R>256
EG1011 S. sonnei 108FJune2008HCMC+R>256S8R>32R96R128S0.38R>256
EG1007 S. sonnei 48MJuly2008LONG AN+R>256S6R>32R64R48S0.38R192
EG0250 S. sonnei 35MAugust2008DONG THAP+R>256S6R>32R48R48S0.25R>256
EG0250a S. sonnei 36MSeptember2008DONG THAP+R>256S6R>32R48R48S0.25R>256
EG0471 S. flexneri 49MSeptember2008HCMC+R>256R>256R>32R128R>256S0.5R>256
EG0472 S. sonnei 66MSeptember2008HCMC+R>256S4R>32R96R48S0.38R>256
EG1014 S. sonnei 29MJanuary2009LONG AN+R>256S6R>32R>256R>256S0.25R>256
EG1015 S. sonnei 72FJanuary2009HCMC+R>256S4R>32R32R48S0.25R>256
EG1016 S. sonnei 39MJanuary2009HCMC+R>256S6S0.38S1.5R48S0.25R>256
EG1017 S. sonnei 11FFebruary2009HCMC+R>256S5R>33R97R49S1.38R>256
EG1018 S. sonnei 29MFebruary2009HCMC+R>256S6R>32R48R>256S0.38R>256
EG1019 S. sonnei 120FFebruary2009HCMC+R>256S6R>32R>256R48S0.25R>256
EG1020 S. sonnei 48MMarch2009HCMC+R>256S8R>32R64R192S0.38R>256
EG1021 S. sonnei 20MMarch2009HCMC+R>256S8R>32R64R>256S0.25R>256
EG1022 S. sonnei 29MMarch2009HCMC+R>256S8R>32R48R>256S0.25R>256
EG1023 S. sonnei 9FMarch2009LONG AN+R>256S6R>32R48R96S0.38R>256
EG1024 S. sonnei 84MMarch2009LONG AN+R>256S6R>32R64R96S0.25R>256
EG1025 S. sonnei 30MMarch2009LONG AN+R>256S6R>32R48R96S0.25R>256

Ampicillin (AMP), chloramphenicol (CHL), trimethoprim – sulfamethoxazole (SXT), tetracycline (TET), nalidixic acid (NAL), ofloxacin (OFX) and ceftriaxone (CRO).

Ampicillin (AMP), chloramphenicol (CHL), trimethoprim – sulfamethoxazole (SXT), tetracycline (TET), nalidixic acid (NAL), ofloxacin (OFX) and ceftriaxone (CRO). The first isolation of a ceftriaxone resistant organism during the transitional period occurred in May 2007 and similar strains were isolated in low numbers for the following months (Figure 1). The numbers of Shigellae isolated that were resistant to ceftriaxone fluctuated over the following 18 months. However, there was increase in the proportion of resistant to sensitive isolates 19% to 41% (5 to 11) between the periods from April 2007–September 2007 and April 2008–September 2008, respectively. This trend peaked in March 2009, with six out of seven Shigella strains isolated resistant to ceftriaxone (MIC>256). The overall rate of resistance to ceftriaxone between September 2008 and March 2009 was 75%.
Figure 1

Graph depicting an increase in number and proportion of ceftriaxone resistant Shigella spp. isolated between April 2007 and March 2009 at the hospital for tropical diseases in Ho Chi Minh City.

The thick black line with circles represents the number of ceftriaxone resistant Shigella isolates per month (x axis); the thin black line with triangles represents the total number of Shigella isolates per month (both related to the left y axis). The broken line represents the proportion of strains isolated in six month periods resistant to ceftriaxone (right y axis). The increasing proportion of ceftriaxone resistant organisms over six month periods is statistically significant (p = 0.024) as calculated using the chi-squared test.

Graph depicting an increase in number and proportion of ceftriaxone resistant Shigella spp. isolated between April 2007 and March 2009 at the hospital for tropical diseases in Ho Chi Minh City.

The thick black line with circles represents the number of ceftriaxone resistant Shigella isolates per month (x axis); the thin black line with triangles represents the total number of Shigella isolates per month (both related to the left y axis). The broken line represents the proportion of strains isolated in six month periods resistant to ceftriaxone (right y axis). The increasing proportion of ceftriaxone resistant organisms over six month periods is statistically significant (p = 0.024) as calculated using the chi-squared test.

The combined resistance patterns of ESBL producing Shigella spp.

We initially cultured a ceftriaxone resistant S. sonnei strain in 2001 (DE 0611) (Table 1), however, this strain was a single, isolated organism and a secondary ceftriaxone resistant Shigella was not isolated again until 2007. Between 2007 and 2009, 35 (34%) Shigella isolates cultured were resistant to ceftriaxone (Table 1). Of these strains, 33 were S. sonnei and the other two isolates were S. flexneri. In total, we isolated 36 ceftriaxone resistant organisms between 2001 and 2009. The mechanism of ceftriaxone resistance was examined by the double disc inhibition method to identify ESBL producing organisms. All the S. sonnei and one S. flexneri strain (35 from 36 ceftriaxone resistant Shigella) produced the characteristic ESBL pattern on investigation, whereas the hydrolysing activity of the other S. flexneri organism was not inhibited by clavulanic acid [23], [24] (Table 1). The median age of patients harbouring third generation cephalosporin resistant Shigellae was 32 months (range; 8 to 120 months), the median age of shigellosis patients during the same period was 30 months [15]. Owing to the rapid increase in the rate isolation of such organisms we hypothesised that an individual dominant strain had began circulating in one area of Ho Chi Minh City. However, residence data procured on the time of admission showed that such strains were circulating over a wide area of the city and not purely limited to an isolated outbreak (Table 1). 12 patients were resident in surrounding provinces, some 150 km from the hospital. In conjunction with ceftriaxone, all strains were examined for resistance to an additional five antimicrobials by disc diffusion and MIC (Table 1). As predicted, all strains demonstrated co-resistance to ampicillin. Thirty five of the 36 strains (97%) were resistant to trimethoprim – sulfamethoxazole and tetracycline, whilst 33/36 were resistant to nalidixic acid. Only three isolates; DE0611, EG0419 and EG0471 were co-resistant to chloramphenicol, of which two, EG0419 and EG0471 (6%), were resistant to five of the six antimicrobials tested (Table 1).

Identifying the genetic nature of ceftriaxone resistance in Shigella spp.

The most common mechanism of dissemination of ESBL genes in the Enterobacteriaceae is plasmid mediated transfer. Our previous studies have suggested that Vietnam (and other parts of South East Asia) may be hotspot for the origin and further transmission of antimicrobial resistant organisms [8], [13], [37], [38]. Enterobacteriaceae which carry MDR plasmids are common in Vietnam and the isolation of MDR Shigella strains has been repeatedly reported [19], [20], [39]. We hypothesised that the ESBL phenotype was related to the insertion of a transposon carried on an MDR plasmid that had permeated into and was circulating within the Shigella population. To investigate the genetic nature of the ESBL positive isolates compared to the ESBL negative isolates we hybridised genomic DNA to an active surveillance of pathogens (ASP) DNA microarray. In total, 15 isolates (seven ESBL positive and eight ESBL negative) were compared. The ASP array is designed to monitor gene flux, genetic content and the nature of horizontally transferred DNA in a bacterial population. The resulting hybridisation is shown in Figure 2. Concurrently, plasmid DNA was isolated and compared from the same bacterial isolates to assess plasmid content.
Figure 2

Demonstration of the absence and presence of genes from DNA isolated from ceftriaxone resistant and ceftriaxone sensitive S. sonnei isolates using the ASParray.

Red boxes indicate presence of genes; green boxes indicate absence of genes. BLAST indicates reporter DNA identity (%) to the S. sonnei Ss046 genome. DNA was hybridized from isolates (left to right) DE0115, DE0477, DE0685, DE0891, DE1150, DE1198, DE1256, DE0611, EG0204, EG0373, EG0395, EG0430, EG1007, EG1008 and EG1009.

Demonstration of the absence and presence of genes from DNA isolated from ceftriaxone resistant and ceftriaxone sensitive S. sonnei isolates using the ASParray.

Red boxes indicate presence of genes; green boxes indicate absence of genes. BLAST indicates reporter DNA identity (%) to the S. sonnei Ss046 genome. DNA was hybridized from isolates (left to right) DE0115, DE0477, DE0685, DE0891, DE1150, DE1198, DE1256, DE0611, EG0204, EG0373, EG0395, EG0430, EG1007, EG1008 and EG1009. Figure 2 is a heatmap representation of the 142 ASP microarray reporters which demonstrated positive hybridisation to DNA in two or more of the S. sonnei samples and the 11 reporters representing the S. sonnei Ss046 plasmid pSS_046. The overall hybridisation data and the names and predicted functions of the genes are presented in Dataset S2 (supporting information). The pattern of relative hybridisation across all strains was remarkably homogenous, with only 30% (42/142+11 pSS_046) of the total proportion of the positive coding sequences demonstrating variable hybridisation patterns. The coding sequences demonstrating common hybridisation patterns across all 15 strains included a number of signature E. coli, Shigella spp. regions and sequences corresponding to virulence and antimicrobial resistance (Figure 2 and Supporting information Datasets S1 and S2). The common antimicrobial resistance genes identified between isolates included genes conferring resistance to streptomycin, macrolides, tetracycline, beta lactams and also some unspecific antimicrobial resistance efflux genes. The homogenous nature of hybridisation suggests that variation between isolates is limited and dependent on plasmid content. All the ESBL producing strains demonstrated significant hybridisation to sequences corresponding to bla genes, highlighted in Figure 2, DNA from the ESBL negative strains failed to hybridise to these targets. Plasmid visualisation of plasmid DNA by agarose gel electrophoresis with all hybridised strains revealed that in contrast to the ESBL negative isolates, all the ESBL producing isolates had a large plasmid, we roughly estimated to be greater than 63 Kbp in size (according to the marker plasmid). Despite the ESBL negative isolates lacking a large plasmid; these strains demonstrated similar resistance profiles, with the obvious exception of ceftriaxone (data not shown). These data suggested that the ESBL genes may be located on simple (none MDR) extrachromosomal elements. This hypothesis was supported by evidence of in vivo horizontal plasmid transfer; two strains cultured two days apart from the same patient were identical in serotype, plasmid content and MIC resistance profile, with the exception of the secondary strain carrying a large plasmid and displaying resistance to ceftriaxone (data not shown). Furthermore, sequencing of a conjugative, ESBL encoding plasmid confirmed our suggestion of a simple extrachromosomal element.

Characterisation of bla genes

PCR was performed to detect the bla TEM, bla SHV and bla CTX-M genes. Further PCR amplifications were performed on DNA from all strains that produced amplicons with the bla CTX-M primers. Primers that were specific for the three major CTX-M clusters, bla CTX-M-9, bla CTX-M-1 and bla CTX-M-2 were selected [40]. Three strains (DE0611, EG0187 and EG0356) produced amplicons with the bla CTX-M-9 primers and the remaining 32 isolates produced amplicons with the bla CTX-M-1 primers (Table 2). All 35 PCR amplicon were sequenced.
Table 2

Characterisation of bla CTX-M genes and the corresponding plasmids of ESBL expressing Shigella spp.

Strain IDCeftazidime zone (mm) bla CTX-M Plasmid size (kbp)a Conjugation frequencyb bla -transposon PCR (+/−)
DE061128CTX-M-24704.43×10 −2 +
EG016218CTX-M-151002.73×10 −2 +
EG018727CTX-M-24702.58×10 −2 +
EG020419CTX-M-151001.93×10 −2 +
EG025019CTX-M-151004.43×84 −2 +
EG0250a19CTX-M-151004.00×84 −2 +
EG035628CTX-M-24702.41×10 −2 +
EG037318CTX-M-151001.50×10 −2 +
EG038420CTX-M-151002.92×10 −2 +
EG039022CTX-M-151001.38×10 −2 +
EG039520CTX-M-151002.33×10 −2 +
EG042120CTX-M-151001.83×10 −4 +
EG042421CTX-M-151003.77×10 −3 +
EG043021CTX-M-151002.00×10 −4 +
EG047120CTX-M-151001.38×10 −2 +
EG047220CTX-M-151003.59×10 −3 +
EG100722CTX-M-151001.60×10 −2 +
EG100820CTX-M-151001.43×10 −2 +
EG100921CTX-M-151003.11×10 −5 +
EG101021CTX-M-151001.82×10 −2 +
EG101121CTX-M-151005.68×10 −6 +
EG101220CTX-M-151002.37×10 −2 +
EG101319CTX-M-151004.88×10 −6 +
EG101419CTX-M-151002.50×10 −3 +
EG101522CTX-M-151002.75×10 −3 +
EG101620CTX-M-151003.00×10 −4 +
EG101720CTX-M-151003.20×10 −2 +
EG101820CTX-M-151001.45×10 −2 +
EG101920CTX-M-151002.00×10 −2 +
EG102020CTX-M-151000+
EG102121CTX-M-151001.85×10 −3 +
EG102221CTX-M-151003.75×10 −2 +
EG102321CTX-M-151008.57×10 −4 +
EG102420CTX-M-151003.43×10 −2 +
EG102520CTX-M-151002.36×10 −2 +

Estimated plasmid size by agarose gel electrophoresis with known markers.

Conjugation frequency calculated per donor cell from the mean of two replicates.

Estimated plasmid size by agarose gel electrophoresis with known markers. Conjugation frequency calculated per donor cell from the mean of two replicates. Sequence analysis of the PCR amplicons demonstrated that there were two differing bla CTX-M genes present in the Shigella population, these were, bla CTX-M-24 (n = 3, 8%) and bla CTX-M-15 (n = 32, 92%) (Table 2). Both genes (bla CTX-M-24 and bla CTX-M-15) share 74% DNA homology with each other; bla CTX-M-15 and bla CTX-M-24 differ by 12 and 6 nucleotides from the precursor genes within their respective parent groups, (bla CTX-M-1 and bla CTX-M-9). Plasmid sizing, by visualisation of the previous agarose gel electrophoresis demonstrated that the estimated plasmid size corresponded with either the bla CTX-M gene (Table 2); bla CTX-M-15 was consistently located on a plasmid larger than that associated with bla CTX-M-24. These observations were confirmed by Southern blotting hybridisation of plasmid DNA extractions (data not shown). The differing plasmid sizes and ESBL genes correlated precisely with two distinct zone clearance areas when strains were susceptibility tested with ceftazidime. The strains expressing CTX-M-24 demonstrated less activity against ceftazidime when compared to CTX-M-15 (median zone size, CTX-M-24; 28mm, CTX-M-15; 20mm) (Table 2). All bla CTX-M harbouring plasmids with the exception of the plasmid in strain EG1020 were transmissible with high conjugation frequencies, ranging from 4.84×102 to 4.88×106 (median 1.55×102) per donor cell (Table 2). The mobilisation of one of these bla CTX harbouring plasmids was further demonstrated by conjugative transfer of the plasmid originally from S. sonnei EG356 from an E.coli transconjugant back into a fully susceptible, naive S. sonnei strain at a similarly high frequency.

DNA sequence analysis of the pEG356 plasmid

The ESBL encoding gene bla CTX-M-24 appears to be generally restricted to Enterobacteriaceae in Asia [41], [42], with only sporadic reports of this gene in other locations [43]. Therefore, we selected the plasmid from isolate EG0356, carrying a bla CTX-M-24, as it is applicable to this location, for further characterisation by DNA sequencing. Plasmid pEG356 was found to be a circular replicon consisting of 70,275 nucleotides, similar in size to another bla CTX-M-24 encoding plasmid from Asia; pKP96. pKP96 was isolated from a Klebsiella pneumoniae strain from China in 2002, yet demonstrates limited DNA homology to pEG356, with exception to the ESBL encoding region [44]. pEG356 was comparatively GC neutral (52.26%) and belonged to incompatibility group FI (on the basis of the DNA sequence homology to the replication region) (Figure 3). pEG356 was predicted to contain 104 coding sequences, of which 14 were considered to be pseudogenes on the basis of apparent premature stop codons, frameshifts or missing start codons. The density of coding sequencing approached 95% and contained four main structural features, a replication region, the ESBL gene encoding region with predicted homology to an ISEcp1 element, an iron ABC transport system and a DNA transfer region (labelled red, pink, dark blue and light blue, respectively in Figure 3).
Figure 3

A schematic representation of the bla CTX-M-24 encoding plasmid, pEG356.

pEG356 is a 70,275bp IncFI plasmid containing 104 coding sequences. The various features are highlighted by the various concentric circles according to the annotation of the of the plasmid (ac. FN594520). The outer colored circle represents coding sequences on the forward strand, the second circle represents coding sequences on the reverse strand. The coding sequences are coded by colour, red; plasmid replication, orange; conserved hypothetical, brown; pseudogene, dark blue; adaptation, grey; segregation, light blue; conjugation/transfer, light pink; transposition, dark pink; degradation/resistance and yellow; metabolism. The third concentric circle represents the location of pseudogenes and the fourth circle represents the four main modules of predicted function, red; replication, pink; transposition, dark blue; iron transport and light blue; conjugational transfer. The fifth and final coloured circle represents the location of the repeat sequences. The primary central graph (a) represents GC content, ranging from high (black) to low (grey) (mean 52%) and the secondary central graph (b) represents G/C coding bias ranging from high (black) to low (grey). The ISEcp1 type element carrying the bla CTX-M-24 is distinguished by grey shading.

A schematic representation of the bla CTX-M-24 encoding plasmid, pEG356.

pEG356 is a 70,275bp IncFI plasmid containing 104 coding sequences. The various features are highlighted by the various concentric circles according to the annotation of the of the plasmid (ac. FN594520). The outer colored circle represents coding sequences on the forward strand, the second circle represents coding sequences on the reverse strand. The coding sequences are coded by colour, red; plasmid replication, orange; conserved hypothetical, brown; pseudogene, dark blue; adaptation, grey; segregation, light blue; conjugation/transfer, light pink; transposition, dark pink; degradation/resistance and yellow; metabolism. The third concentric circle represents the location of pseudogenes and the fourth circle represents the four main modules of predicted function, red; replication, pink; transposition, dark blue; iron transport and light blue; conjugational transfer. The fifth and final coloured circle represents the location of the repeat sequences. The primary central graph (a) represents GC content, ranging from high (black) to low (grey) (mean 52%) and the secondary central graph (b) represents G/C coding bias ranging from high (black) to low (grey). The ISEcp1 type element carrying the bla CTX-M-24 is distinguished by grey shading. pEG356 encoded the complete tra gene-set encoding a conjugative pilus with high sequence similarity to the transfer region from the F plasmid sequence from E. coli K12 [45] (Ac. AP001918). This is consistent with the in vitro data demonstrating that this plasmid is transmissible into an E. coli recipient. The IncFI replication region was highly similar to other IncF plasmids, including the recently described CTX-M-15 encoding plasmid pEK499 (Ac. EU935739) isolated from an E. coli O25:H4-ST131 epidemic strain circulating in the United Kingdom [46]. Additionally, pEG356 shared another 30 Kbp (position 15,152 to 44,255 in pEG356) of high sequence similarity with pEK499 [46]. This region contains multiple common hypothetical plasmid genes of unknown function, genes involved in conjugative transfer (traM to traC), plasmid partitioning and a predicted single stranded DNA binding protein (ssb). Unlike pEK499 the mok and hok post segregational killing genes are missing from within the plasmid maintenance region [46]. With respect to pEK499 and other ESBL carrying plasmids, pEG356 does not carry multiple antimicrobial resistance genes, transposons, insertion sequences or any additional virulence associated genes [44], [46], [47](Chen et al. 2007; Shen et al. 2008; Woodford et al. 2009)(Chen et al. 2007; Shen et al. 2008; Woodford et al. 2009). In overall structure, but not size, pEG356 shared the most DNA sequence similarity with the ColBM plasmid pAPEC-O1 (Ac. DQ381420), isolated from an avian pathogenic E. coli strain [34] (Figure 4). pEG356 shared around 80% of the gene content with pAPEC-O1, including the conjugation (tra), replication (rep) and a putative ATP iron transport system (iro). The iro region consisted of four coding sequences, which include, a putative permease, an iron binding protein and an export associated protein.
Figure 4

A schematic representation of ISEcp1-pEG356 and DNA sequence alignment highlighting corresponding DNA homology between pEG356 and pAPEC-O1-ColBM.

The DNA sequences for pEG356 and pAPEC-O1-ColBM were aligned and compared in Artemis comparison tool (ACT). The numbers on the diagram correspond to the respective plasmid sizes and the black integers highlight 10 Kbp intervals. The genetic backbone of the pEG356 and pAPEC-O1-ColBM is shown in yellow along with the various modules, red; rep (replication), pink; tn (transposition), dark blue; iro (iron uptake) and light blue; tra (DNA transfer/conjugation). Areas with high DNA homology between pEG356 and pAPEC-O1-ColBM are shown with grey shading and the pink shading corresponds to a magnified view of ISEcp1-pEG356. The numbers on ISEcp1-pEG356 correspond to the location of the element on the host plasmid, with integers representing 1 Kb intervals. The genes are functionally coded, pink; tn (transposition), orange; unk (unknown function), brown; psu (pseudogene) and dark pink; bla CTX-M-24, primer locations for the transposon PCR are highlight by Tnp24F and TnpR. The location of the IS908D downstream of the bla CTX-M-24 is highlighted The region is flanked by an inverted repeat (blue triangles) and contains an additional inverted repeat sequence flanking the transposase gene. Corresponding inverted repeats are linked by arrows.

A schematic representation of ISEcp1-pEG356 and DNA sequence alignment highlighting corresponding DNA homology between pEG356 and pAPEC-O1-ColBM.

The DNA sequences for pEG356 and pAPEC-O1-ColBM were aligned and compared in Artemis comparison tool (ACT). The numbers on the diagram correspond to the respective plasmid sizes and the black integers highlight 10 Kbp intervals. The genetic backbone of the pEG356 and pAPEC-O1-ColBM is shown in yellow along with the various modules, red; rep (replication), pink; tn (transposition), dark blue; iro (iron uptake) and light blue; tra (DNA transfer/conjugation). Areas with high DNA homology between pEG356 and pAPEC-O1-ColBM are shown with grey shading and the pink shading corresponds to a magnified view of ISEcp1-pEG356. The numbers on ISEcp1-pEG356 correspond to the location of the element on the host plasmid, with integers representing 1 Kb intervals. The genes are functionally coded, pink; tn (transposition), orange; unk (unknown function), brown; psu (pseudogene) and dark pink; bla CTX-M-24, primer locations for the transposon PCR are highlight by Tnp24F and TnpR. The location of the IS908D downstream of the bla CTX-M-24 is highlighted The region is flanked by an inverted repeat (blue triangles) and contains an additional inverted repeat sequence flanking the transposase gene. Corresponding inverted repeats are linked by arrows. The bla CTX-M-24 was located on an ISEcp1 like element. The overall sequence of the ISEcp1 variant on pEG356 is 4,725 bp and 3,000 bp shares 99% DNA homology with an ESBL gene encoding element from an E. coli strain that was isolated in China; pOZ174 (AF252622) [48]. The bla CTX-M-24 carrying region is also highly similar (99% DNA homology) to the equivalent region in the previously described plasmid, pKP96, including the IS903D downstream of the bla CTX-M-24 gene (Figure 4) [44].The ISEcp1 element contains two pairs of inverted repeat (Figure 4): the larger inverted repeat (31 bp) flanks the complete element, inclusive of six coding sequences. The 3′end of the ISEcp1 element contained a ISEcp1 transposase and a small hypothetical coding sequence of unknown function which is spanned by two IS1380 elements. The bla CTX-M-24 isadjacent to two pseudogenes, which were understood to have encoded a conserved hypothetical transposon protein and a maltose-inducible porin precursor, it is not clear what significance, if any, these genes are to the overall functionality of the element or the plasmid. All ESBL producing Shigella were subjected to PCR to demonstrate if all bla genes were associated with the ISEcp1 transposase. The location of the PCR primers Tnp24F and TnpR are highlighted in Figure 4 and were designed to produce an amplicon if the bla gene and the adjacent ISEcp1 transposase were in the same location and orientation in strains with a bla CTX-M-24. A secondary forward primer was designed in equivalent location for those strains with a bla CTX-M-15 (Tnp15F). Therefore, if bla CTX-M-24 or the bla CTX-M-15 was consistently adjacent to the ISEcp1 transposase it would produce an amplicon of 414 bp in all strains. All ESBL positive strains (CTX-M-15 and CTX-M-24) generated a PCR amplicon of the predicted size (Table 2). Sequencing of all PCR products demonstrated that all the bla CTX-M-15 and the bla CTX-M-24 gene were associated with an ISEcp1 transposase, The DNA sequence from all PCR products was identical from within the transposase gene up to and including the IS1380.

Discussion

Members of the Enterobacteriaceae that carry CTX-M family ESBLs have been isolated from many parts of the world since the mid 1990s [40]. CTX-M genes have been previously identified from pathogenic Enterobacteriaceae circulating in South East Asia; such as Vietnam, Thailand, Cambodia and Singapore [6], [7], [49], [50]. Additionally, our work has shown that ESBLs are commonly found in organisms which constitute the “normal” gastrointestinal flora in the general population living in Ho Chi Minh City [8]. Such data predicts that intestinal flora may be a considerable reservoir of ESBL encoding genes and the genetic elements they circulate on, permitting potential transmission to their pathogenic counterparts. CTX-M genes in the Shigellae have been previously reported in Argentina, (CTX-M-2) [51], Korea (CTX-M-14) [52] and from a traveler returning from India (CTX-M-15) [53]. More recently, Nagano et al. described a novel CTX-M-64 hybrid from a shigellosis patient infected with S. sonnei after returning to Japan from China [54]. The S. sonnei strains isolated here in Ho Chi Minh City harbored the bla CTX-M-15 and bla CTX-M-24 genes. Current data suggests that bla CTX-M-24 is found mainly in Asia [41], [42], yet may have been transferred to other locations [43]. MDR CTX-M-15 producing E. coli is emerging worldwide as an important pathogen causing hospital-acquired infections [2]. The potential impact of MDR Shigella combined with CTX-M-15/24 carrying plasmids is substantial, with implications for local treatment policy and the transportation of such plasmids into other countries as has been implicated in Canada [43], [55]. The structure of pEG356 as a vector for transferring bla CTX-M-24 implies that such plasmids may be common. The streamlined nature of pEG356, remarkably high conjugation frequency may ensure onward circulation of the genetic cargo as it becomes stable in the bacterial population. The simplistic nature of pEG356, with a lack of additional resistance genes suggests that this is a contemporary element, with the bla CTX-M-24 a recent acquisition. The bla CTX-M-24 gene has been located on a relatively uncomplicated plasmid in Asia, however, pKP96 only demonstrates limited homology to pEG356 [44]. All ESBL gene were located adjacent to a ISEcp1 transposase (as identified by PCR). We are currently unable to substantiate if it is the ISEcp1-like element, the plasmids or the circulation of bacterial clone is responsible for the increasing rate of isolation. However, the geographical spread of these strains suggests that they are widely disseminated throughout southern Vietnam. S. sonnei is a monophyletic bacterial pathogen, and owing to the lack of sensitivity of existing sequence based methods such as multi locus sequence typing [56], we are currently unable to confirm clonality satisfactorily (data not shown). Further epidemiological investigation of CTX-M containing strains combined with a more sensitive sequenced based methodology, such as is used for Salmonella Typhi is required [57]. We are currently assessing the genetic nature of the strain and the plasmids carrying the ESBL genes. Our findings show a transfer from 0% to 75% ceftriaxone resistance in S. sonnei over just two years in the key age group (1 to 3 years) for this disease. By sampling across the Ho Chi Minh City area, covering approximately 150 sq kilometres of Vietnam and a population of approximately 15 million people we have shown that the genetic explanation for this resistance pattern is the dissemination two distinct ESBL genes, of which one is dominant. These are the leading source of ESBLs in clinical Shigella cases and their rapid spread suggests that these organisms are under strong selection pressure. The use of third generation cephalosporins, such as oral cefpodoxime and cefixime in the community is common in Vietnam, and places the even the short term usage of ceftriaxone and other broad-spectrum cephalosporins in jeopardy. Shigella spp. are capable of carrying multiple plasmids with an array of phenotypes including virulence and antimicrobial resistance [16], [18]. The presence of Shigella in the gastrointestinal tract of humans is an ideal environment to acquire horizontally transferred genetic material. Small highly transmissible plasmids that impinge on the fitness of the host may be rapidly disseminated under appropriate conditions. Vietnam is a country that in many respects is representative of many parts of the world. The Vietnamese economy is developing rapidly and the country is undergoing transition with an increasing population, urbanisation and shifting patterns of infectious diseases. In the past decade there has been a transition in species from S. flexneri to S. sonnei in the Southern provinces of Vietnam. With this shift has come the emergence of ESBL S. sonnei. These findings from the Vietnamese population should perhaps serve as a warning for other countries encountering the same economic transition. The progressive evolution of pan-resistant Shigella makes vaccine development an increasingly important objective. Translation of abstract into Vietnamese by Tran Vu Thieu Nga. (0.04 MB DOC) Click here for additional data file. Corrected microarray data mean plus one standard deviation for S. sonnei EG1007. (1.03 MB XLS) Click here for additional data file. Raw microarray data for all S. sonnei isolates. (1.03 MB XLS) Click here for additional data file.
  55 in total

1.  Rapid emergence of third generation cephalosporin resistant Shigella spp. in Southern Vietnam.

Authors:  Ha Vinh; Stephen Baker; James Campbell; Nguyen Van Minh Hoang; Ha Thi Loan; Mai Thu Chinh; Vo Thi Cuc Anh; To Song Diep; Le Thi Phuong; Constance Schultsz; Jeremy Farrar
Journal:  J Med Microbiol       Date:  2009-02       Impact factor: 2.472

2.  Extended broad-spectrum beta-lactamases conferring transferable resistance to newer beta-lactam agents in Enterobacteriaceae: hospital prevalence and susceptibility patterns.

Authors:  V Jarlier; M H Nicolas; G Fournier; A Philippon
Journal:  Rev Infect Dis       Date:  1988 Jul-Aug

3.  Treatment of bacillary dysentery in Vietnamese children: two doses of ofloxacin versus 5-days nalidixic acid.

Authors:  H Vinh; J Wain; M T Chinh; C T Tam; P T Trang; D Nga; P Echeverria; T S Diep; N J White; C M Parry
Journal:  Trans R Soc Trop Med Hyg       Date:  2000 May-Jun       Impact factor: 2.184

4.  Antibiotic resistance in diarrheagenic Escherichia coli and Shigella strains isolated from children in Hanoi, Vietnam.

Authors:  Trung Vu Nguyen; Phung Van Le; Chinh Huy Le; Andrej Weintraub
Journal:  Antimicrob Agents Chemother       Date:  2005-02       Impact factor: 5.191

5.  Complete DNA sequence of a serogroup A strain of Neisseria meningitidis Z2491.

Authors:  J Parkhill; M Achtman; K D James; S D Bentley; C Churcher; S R Klee; G Morelli; D Basham; D Brown; T Chillingworth; R M Davies; P Davis; K Devlin; T Feltwell; N Hamlin; S Holroyd; K Jagels; S Leather; S Moule; K Mungall; M A Quail; M A Rajandream; K M Rutherford; M Simmonds; J Skelton; S Whitehead; B G Spratt; B G Barrell
Journal:  Nature       Date:  2000-03-30       Impact factor: 49.962

6.  Global burden of Shigella infections: implications for vaccine development and implementation of control strategies.

Authors:  K L Kotloff; J P Winickoff; B Ivanoff; J D Clemens; D L Swerdlow; P J Sansonetti; G K Adak; M M Levine
Journal:  Bull World Health Organ       Date:  1999       Impact factor: 9.408

7.  Spread of CTX-M-type extended-spectrum beta-lactamases among bloodstream isolates of Escherichia coli and Klebsiella pneumoniae from a Korean hospital.

Authors:  Sang-Guk Lee; Seok Hoon Jeong; Hyukmin Lee; Chang Ki Kim; Yangsoon Lee; Eunmi Koh; Yunsop Chong; Kyungwon Lee
Journal:  Diagn Microbiol Infect Dis       Date:  2009-01       Impact factor: 2.803

8.  Novel chimeric beta-lactamase CTX-M-64, a hybrid of CTX-M-15-like and CTX-M-14 beta-lactamases, found in a Shigella sonnei strain resistant to various oxyimino-cephalosporins, including ceftazidime.

Authors:  Yukiko Nagano; Noriyuki Nagano; Jun-ichi Wachino; Keiko Ishikawa; Yoshichika Arakawa
Journal:  Antimicrob Agents Chemother       Date:  2008-10-27       Impact factor: 5.191

9.  High-throughput sequencing provides insights into genome variation and evolution in Salmonella Typhi.

Authors:  Kathryn E Holt; Julian Parkhill; Camila J Mazzoni; Philippe Roumagnac; François-Xavier Weill; Ian Goodhead; Richard Rance; Stephen Baker; Duncan J Maskell; John Wain; Christiane Dolecek; Mark Achtman; Gordon Dougan
Journal:  Nat Genet       Date:  2008-07-27       Impact factor: 38.330

10.  Geographic analysis of shigellosis in Vietnam.

Authors:  Deok Ryun Kim; Mohammad Ali; Vu Dinh Thiem; Jin-Kyung Park; Lorenz von Seidlein; John Clemens
Journal:  Health Place       Date:  2007-12-28       Impact factor: 4.078

View more
  22 in total

1.  Differential phenotypic and genotypic characteristics of qnrS1-harboring plasmids carried by hospital and community commensal enterobacteria.

Authors:  Le Thi Minh Vien; Manal Abuoun; Victoria Morrison; Nicholas Thomson; James I Campbell; Martin J Woodward; Nguyen Van Vinh Chau; Jeremy Farrar; Constance Schultsz; Stephen Baker
Journal:  Antimicrob Agents Chemother       Date:  2011-01-31       Impact factor: 5.191

2.  In vitro selection of variants resistant to beta-lactams plus beta-lactamase inhibitors in CTX-M beta-lactamases: predicting the in vivo scenario?

Authors:  Aida Ripoll; Fernando Baquero; Angela Novais; Mario J Rodríguez-Domínguez; Maria-Carmen Turrientes; Rafael Cantón; Juan-Carlos Galán
Journal:  Antimicrob Agents Chemother       Date:  2011-07-25       Impact factor: 5.191

3.  F33:A-:B- and F2:A-:B- plasmids mediate dissemination of rmtB-blaCTX-M-9 group genes and rmtB-qepA in Enterobacteriaceae isolates from pets in China.

Authors:  Yuting Deng; Liangying He; Sheng Chen; Hongqing Zheng; Zhenling Zeng; Yahong Liu; Yan Sun; Junying Ma; Zhangliu Chen; Jian-Hua Liu
Journal:  Antimicrob Agents Chemother       Date:  2011-07-25       Impact factor: 5.191

Review 4.  The genomic signatures of Shigella evolution, adaptation and geographical spread.

Authors:  Hao Chung The; Duy Pham Thanh; Kathryn E Holt; Nicholas R Thomson; Stephen Baker
Journal:  Nat Rev Microbiol       Date:  2016-02-29       Impact factor: 60.633

5.  Plasmid-mediated resistance to cephalosporins and fluoroquinolones in various Escherichia coli sequence types isolated from rooks wintering in Europe.

Authors:  Ivana Jamborova; Monika Dolejska; Jiri Vojtech; Sebastian Guenther; Raluca Uricariu; Joanna Drozdowska; Ivo Papousek; Katerina Pasekova; Wlodzimierz Meissner; Jozef Hordowski; Alois Cizek; Ivan Literak
Journal:  Appl Environ Microbiol       Date:  2014-11-07       Impact factor: 4.792

6.  Exploring the inhibition of CTX-M-9 by beta-lactamase inhibitors and carbapenems.

Authors:  Christopher R Bethel; Magdalena Taracila; Teresa Shyr; Jodi M Thomson; Anne M Distler; Kristine M Hujer; Andrea M Hujer; Andrea Endimiani; Krisztina Papp-Wallace; Richard Bonnet; Robert A Bonomo
Journal:  Antimicrob Agents Chemother       Date:  2011-05-09       Impact factor: 5.191

7.  Tracking the establishment of local endemic populations of an emergent enteric pathogen.

Authors:  Kathryn E Holt; Tran Vu Thieu Nga; Duy Pham Thanh; Ha Vinh; Dong Wook Kim; My Phan Vu Tra; James I Campbell; Nguyen Van Minh Hoang; Nguyen Thanh Vinh; Pham Van Minh; Cao Thu Thuy; Tran Thi Thu Nga; Corinne Thompson; Tran Thi Ngoc Dung; Nguyen Thi Khanh Nhu; Phat Voong Vinh; Pham Thi Ngoc Tuyet; Hoang Le Phuc; Nguyen Thi Nam Lien; Bui Duc Phu; Nguyen Thi Thuy Ai; Nguyen Manh Tien; Nguyen Dong; Christopher M Parry; Tran Tinh Hien; Jeremy J Farrar; Julian Parkhill; Gordon Dougan; Nicholas R Thomson; Stephen Baker
Journal:  Proc Natl Acad Sci U S A       Date:  2013-09-30       Impact factor: 11.205

8.  The co-selection of fluoroquinolone resistance genes in the gut flora of Vietnamese children.

Authors:  Le Thi Minh Vien; Ngo Ngoc Quang Minh; Tang Chi Thuong; Huynh Duy Khuong; Tran Vu Thieu Nga; Corinne Thompson; James I Campbell; Menno de Jong; Jeremy J Farrar; Constance Schultsz; H Rogier van Doorn; Stephen Baker
Journal:  PLoS One       Date:  2012-08-24       Impact factor: 3.240

9.  Increasing clinical resistance rate of Shigella sonnei to cefotaxime in Jiangsu Province, China, between 2012 and 2015.

Authors:  Huimin Qian; Guoye Liu; Yin Chen; Ping Ma; Xiaoxiao Kong; Lu Zhou; Jie Hong; Changjun Bao; Bing Gu
Journal:  Ann Transl Med       Date:  2018-06

10.  CTX-M-55-type extended-spectrum β-lactamase-producing Shigella sonnei isolated from a Korean patient who had travelled to China.

Authors:  Wonmok Lee; Hae-Sun Chung; Hyukmin Lee; Jong Hwa Yum; Dongeun Yong; Seok Hoon Jeong; Kyungwon Lee; Yunsop Chong
Journal:  Ann Lab Med       Date:  2013-02-21       Impact factor: 3.464

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.