Literature DB >> 18218072

Demonstration of IS711 transposition in Brucella ovis and Brucella pinnipedialis.

Alain A Ocampo-Sosa1, Juan M García-Lobo.   

Abstract

BACKGROUND: The Brucella genome contains an insertion sequence (IS) element called IS711 or IS6501, which is specific to the genus. The copy number of IS711 varies in the genome of the different Brucella species, ranging from 7 in B. abortus, B. melitensis and B. suis to more than 30 in B. ovis and in Brucella strains isolated from marine mammals. At present, there is no experimental evidence of transposition of IS711, but the occurrence of this element with a high copy number in some species, and the isolation of Brucella strains with "ectopic" copies of IS711 suggested that this IS could still transpose.
RESULTS: In this study we obtained evidence of transposition of IS711 from the B. ovis and B. pinnipedialis chromosomes by using the "transposon trap" plasmid pGBG1. This plasmid expresses resistance to tetracycline only if the repressor gene that it contains is inactivated. The strains B. melitensis 16 M, B. abortus RB51, B. ovis BOC22 (field strain) and B. pinnipedialis B2/94, all containing the plasmid pGBG1, were grown in culture media with tetracycline until the appearance of tetracycline resistant mutants (TcR). TcR mutants due to IS711 transposition were only detected in B. ovis and B. pinnipedialis strains.
CONCLUSION: Four different copies of IS711 were found to transpose to the same target sequence in the plasmid pGBG1. This demonstrated that IS711 are active in vivo, specially in Brucella species with a high number of IS711 copies as B. ovis and B. pinnipedialis.

Entities:  

Mesh:

Substances:

Year:  2008        PMID: 18218072      PMCID: PMC2266754          DOI: 10.1186/1471-2180-8-17

Source DB:  PubMed          Journal:  BMC Microbiol        ISSN: 1471-2180            Impact factor:   3.605


Background

Bacteria in the genus Brucella are the etiological agents of brucellosis, one of the most important zoonotic diseases, affecting human and domestic animals of high economic and social value. The genus contains several species that are defined mainly on the basis of animal host specificity [1]. A growing interest in development of tools for molecular epidemiology and control of brucellosis has resulted in a large amount of published genome sequence data. The complete genome sequences of B. melitensis [2], B. suis [3], and two B. abortus strains [4,5] are already published, and the genome sequences of B. ovis, B. canis and the B. abortus vaccine strain S19 are also completed but not published yet. The genus Brucella bears an Insertion sequence (IS) element, originally detected in Brucella ovis as a repeated polymorphic DNA sequence in 1990 [6]. Subsequently, this repeat was proposed to be an IS based on its genetic organisation, which is similar to that of some elements described before, and named as IS711 [7] or IS6501 [8]. IS elements are defined as small segments of DNA with a simple genetic organisation and capable of inserting at multiple sites into target DNA molecules. The best known ISs are those of the Gram-negative bacteria, but these mobile elements have been widely reported in a variety of bacterial genera. A compilation of the available data on insertion sequences can be found in the IS database [9]. IS711 is an 842 bp element bounded by 20 bp imperfect inverted repeats. This IS contains two overlapping open reading frames, which are believed to translate into a single polypeptide by means of a -1 frameshift of the translation apparatus, a feature also present in other ISs [10,11]. IS711 appears to duplicate the dinucleotide TA of the consensus target site, YTAR [7]. IS711 is exclusively present in the genome of all described species of the genus Brucella. The sequenced genomes of closely related α-proteobacteria do not contain an IS obviously related to IS711, suggesting that this insertion sequence is an element native to the genus Brucella. Furthermore IS711 has been shown to be associated with the repeated elements BRU-RS1 and BRU-RS2 that could represent insertion hot spots for this IS [12,13]. Some published work already suggested that IS711 could be an active transposon [14]. The copy number of IS711 is different in the species of the genus. B. melitensis has 7 copies of this element; the same number as B. abortus and B. suis. However, B. ovis contains about 35 copies [7,8], and the recently discovered Brucella from marine mammals carry more than 20 IS711 copies [15]. Furthermore, the finding of a new IS711 copy inactivating the wboA gene in the vaccine strain RB51[14] also indicated that IS711 could be an active element. However, there is no experimental evidence of IS711 transposition up to now. Due to its proven genomic stability, IS711 has been used as a target to identify Brucella species and biovars [12,16]. Other ISs have been described in Brucella in addition to IS711, such as the elements named ISBm1, ISBm2 and ISBm3 [17] and ISBm4 [18], as well as IS2020, which forms part of the composite transposon Tn2020 [19], but the mobility of these elements has not been observed experimentally. In this study we report evidence for IS711 transposition from B. ovis and B. pinnipedialis by using pGBG1, a plasmid for isolating mobile DNA elements [20]. This constitutes the first experimental report of activity of a transposon in the genus Brucella.

Results and discussion

Isolation and characterisation of tetracycline resistant derivatives of PGBG1 in Brucella

The transposon trap plasmid pGBG1 was introduced into Brucella by conjugation as described in the Materials and Methods. Plasmid PGBG1 carries a tetracycline resistance gene whose transcription is blocked by the repressor of bacteriophage lambda. Insertions of resident transposons into the repressor gene result in transcription of the TcR gene of pGBG1 and can be selected on tetracycline containing media. As a preliminary step for the transposition experiments, we determined the stability of pGBG1 and the MIC of tetracycline for the different Brucella species to be used, since this plasmid had not been employed before in this genus. As result of these studies we found that Brucella strains must be grown in the presence of chloramphenicol in order to maintain pGBG1, and also determined that the most appropriate tetracycline concentration to avoid the appearance of spontaneous mutants in plasmid free Brucella was 30 μg ml-1. To assay for transposition, various independent colonies (10–20) of each Brucella strain carrying pGBG1 were grown in appropriate media. Cultures (0.1 ml) were then plated separately on agar plates with 30 μg ml-1 of tetracycline or with 25 μg ml-1 of chloramphenicol (after dilution), and incubated at 37°C in 5% CO2 atmosphere until growth was observed. The frequencies of occurrence of tetracycline resistant colonies relative to chloramphenicol resistant CFU's ranged from 10-7 to 10-9, depending on the strain (Table 1). To determine whether the appearance of tetracycline resistant colonies was due either to transposition into pGBG1 of a Brucella transposon or to any other mutational event, selected colonies from each independent experiment were analysed by PCR using the primers G11 and G12 (Fig. 1, Table 2), which amplified the selection cartridge of pGBG1 plasmid as a 1.2 kb fragment. Some of the tetracycline resistant isolates produced a PCR amplification fragment of around 2.0 kb. The size of these DNA fragments represented an increase of approximately 0.8 kb relative to the size of the target region of pGBG1, which was consistent with the integration of a copy of IS711 into the repressor controlling the tetracycline resistance gene of pGBG1. From the four Brucella strains in which the transposon trap pGBG1 was used, only B. ovis BOC22 and B. pinnipedialis B2/94 produced tetracycline resistant plasmids containing insertions (Fig. 2). No tetracycline resistant colonies containing insertions in the experiments that used B. abortus or B. melitensis as hosts were obtained. Some tetracycline resistant colonies were obtained with these two donors. PCR analysis of the corresponding plasmids in these cases, (and in some colonies from B. ovis and B. pinnipedialis as well) could not be explained by integration events. These resistant mutants probably resulted from point mutations (when the size of target region was apparently unchanged) or from deletions (when the size of target region decreased) in the pGBG1 selection cartridge (Fig. 1).
Table 1

Frequencies of appearance of TcR mutants in Brucella containing pGBG1

StrainFrequency of TcR mutants*Number of TcR mutants analysedNumber of mutants with insertions% of insertions detectedMobile element involved
B. ovis BOC22(20) 8.6 × 10-8523057.7IS711
B. abortus RB51(10) 2.9 × 10-94600none
B. melitensis 16M-N(10) 3.05 × 10-71300none
B. pinnipedialis B2/94(10) 5.0 × 10-835411.4IS711

* Average frequency of all experiments. The number of independent experiments is in parentheses

Figure 1

Schematic drawing showing the selection cartridge of the plasmid pGBG1 after the insertion of IS. Brucella strains containing these plasmids were resistant to tetracycline. The IS711 insertion is represented by a white box flanked by grey arrowheads. The target sequence is indicated and the duplicated bases appear as underlined capital letters. The primers used to amplify and determine the precise location of insertions in the selection cartridge are indicated with the primer name and black arrow heads.

Table 2

Oligonucleotide primers

Primer nameSequence 5'-3'Reference
711uCACAAGACTGCGTTGCCGACAGAThis study
711dCATATGATGGGACCAAACACCTAGGGThis study
G11TATCAGCTATGCGCCGACCAGAAC[20]
G12GCCAATCCCCATGGCATCGAGTAA[20]
REPTC1GGCGTTATAAGCATTTAATGThis study
REPTC2AAAAAGAAACCATTAACACAThis study
ISOUT1GCGGCCGGGCGTACCAACTCGThis study
ISOUT2GCTATCGTCGTATTGCGCTGCThis study
Figure 2

PCR analysis of the plasmids found in tetracycline resistant mutants. PCR with primers G11 and G12 was carried out in order to amplify the selection cartridge of pGBG1 in tetracycline resistant mutants obtained in Brucella. The black arrow indicates the position of the PCR fragment obtained from pGBG1/TcR mutants due to insertions encountered in B. ovis BOC22 and B. pinnipedialis B2/94 strains (Lanes 3, 7, 8, 9, 10, 12, 13, 14 and 15). Mutants due to deletions and point mutations (Lanes 2, 4, 5, 6, 11, 16, 17 and 18) produced PCR products of the same size or smaller than the vector pGBG1 (Lane 1). M: Molecular Weight Marker 1 Kb plus DNA Ladder.1. Lane 19. Negative control (PCR reaction mixture without DNA).

Schematic drawing showing the selection cartridge of the plasmid pGBG1 after the insertion of IS. Brucella strains containing these plasmids were resistant to tetracycline. The IS711 insertion is represented by a white box flanked by grey arrowheads. The target sequence is indicated and the duplicated bases appear as underlined capital letters. The primers used to amplify and determine the precise location of insertions in the selection cartridge are indicated with the primer name and black arrow heads. PCR analysis of the plasmids found in tetracycline resistant mutants. PCR with primers G11 and G12 was carried out in order to amplify the selection cartridge of pGBG1 in tetracycline resistant mutants obtained in Brucella. The black arrow indicates the position of the PCR fragment obtained from pGBG1/TcR mutants due to insertions encountered in B. ovis BOC22 and B. pinnipedialis B2/94 strains (Lanes 3, 7, 8, 9, 10, 12, 13, 14 and 15). Mutants due to deletions and point mutations (Lanes 2, 4, 5, 6, 11, 16, 17 and 18) produced PCR products of the same size or smaller than the vector pGBG1 (Lane 1). M: Molecular Weight Marker 1 Kb plus DNA Ladder.1. Lane 19. Negative control (PCR reaction mixture without DNA). Frequencies of appearance of TcR mutants in Brucella containing pGBG1 * Average frequency of all experiments. The number of independent experiments is in parentheses Oligonucleotide primers

Identification of IS711 in pGBG1 TcR insertions

As a first step towards identification of the DNA inserted into the tetracycline resistant insertional mutants, the PCR products were digested with the restriction enzyme HaeIII. Six different restriction patterns were observed, four in B. ovis BOC22 (C, D, E and F) and two in B. pinnipedialis B2/94 (A and B, Fig. 3A).
Figure 3

Diversity of restriction profiles and nucleotide sequence of IS. A) PCR products from several pGBG1/TcR mutants digested with HaeIII. Lanes 1 to 6 contain insertions obtained in B. pinnipedialis B2/94. Lanes 7–10 insertions obtained in B. ovis BOC22 Lane 11, PCR product from pGBG1. M: Molecular size marker (1 Kb DNA ladder, Invitrogen). Letters under the picture indicate the different restriction patterns obtained. In B) the nucleotide sequences of the IS711 copies transposed into cI lambda repressor gene were compared with IS711A from B. ovis (GenBank Accession number: M94960). Only the variable regions and the HaeIII sites are shown. Identical nucleotides are represented by dots. Numerals in the top indicate the positions where nucleotide changes occur. Nucleotide substitutions are boldface and shaded. The HaeIII restriction sites are indicated within open boxes.

Diversity of restriction profiles and nucleotide sequence of IS. A) PCR products from several pGBG1/TcR mutants digested with HaeIII. Lanes 1 to 6 contain insertions obtained in B. pinnipedialis B2/94. Lanes 7–10 insertions obtained in B. ovis BOC22 Lane 11, PCR product from pGBG1. M: Molecular size marker (1 Kb DNA ladder, Invitrogen). Letters under the picture indicate the different restriction patterns obtained. In B) the nucleotide sequences of the IS711 copies transposed into cI lambda repressor gene were compared with IS711A from B. ovis (GenBank Accession number: M94960). Only the variable regions and the HaeIII sites are shown. Identical nucleotides are represented by dots. Numerals in the top indicate the positions where nucleotide changes occur. Nucleotide substitutions are boldface and shaded. The HaeIII restriction sites are indicated within open boxes. To confirm whether the insertions were due to integration of IS711 into pGBG1, the HaeIII digested PCR products containing insertions were transferred to a nylon membrane and hybridised with an IS711 probe. Southern hybridisation analysis showed that all insertions in pGBG1 were due to the presence of IS711 (Fig. 4).
Figure 4

Southern blot hybridisation of amplified regions from Tc. PCR products obtained with primers G11 and G12 from several pGBG1/TcR insertion mutants were digested with HaeIII and hybridised with an IS711 probe. Lane 1: IS711 probe, lanes 2–10: insertion mutants containing IS711, lane 11: PCR product from pGBG1. Molecular sizes of the fragments are indicated in bp.

Southern blot hybridisation of amplified regions from Tc. PCR products obtained with primers G11 and G12 from several pGBG1/TcR insertion mutants were digested with HaeIII and hybridised with an IS711 probe. Lane 1: IS711 probe, lanes 2–10: insertion mutants containing IS711, lane 11: PCR product from pGBG1. Molecular sizes of the fragments are indicated in bp. The different restriction patterns obtained with HaeIII could indicate that the IS had inserted in different positions of the target gene, but could also be the result of IS711 sequence polymorphism in B. ovis and B. pinnipedialis, as both species are poorly characterised. In order to clarify this point, the PCR products obtained from selected tetracycline resistant insertional mutants (pGBG1::IS711) were purified and sequenced with the ISOUT1/ISOUT2, and the REPTC1/REPTC2 pairs of primers (Fig. 1 and Table 2).

Sequence analysis of the IS711 inserted copies

Twenty one PCR products from pGBG1::IS711 tetracycline resistant mutants were selected to determine the complete sequence of the IS711 copy which integrated into cI gene. The sequence analysis showed that all the IS711 insertions had taken place at the same point within the cI gene, near its 5' terminal end. In all cases the insertion occurred at the sequence TTAA according to the predicted IS711 target. The central dinucleotide TA was duplicated at both sides of the element as was expected. IS711 insertions at this point occurred in the two possible orientations. It was surprising to find that all the IS711 insertions occurred in the same point of the cI gene. Transposons vary in the degree of target specificity from highly specific (i.e. Tn7) to near random insertion transposons [21]. The observance of a single insertion site among 40 independent transposition experiments indicated a strong degree of specificity in target selection. The reported target for IS711 integration was the very frequent YTAR sequence. However, a preference for insertion of IS711 into the Bru-RS palindromic repeats has also been reported, indicating the existence of some undetermined determinants of integration specificity. Our experimental system can only detect insertions into the 1 kb cI gene, which contains around fifteen YTAR sites. The reason for the observed transposition preference for a single site remains unexplained. Sequence analysis indicated the presence of four different copies of IS711 disrupting the cI gene. Each copy was designated with a different nomenclature: IS711-IsoA, IS711-IsoB, IS711-IsoC and IS711-IsoD. Nucleotide sequences of these IS711 copies were compared with the copy named IS711A from B. ovis (GenBank Accession number: M94960). The copy designated as IS711-IsoB was identical to IS711A. Differences between other IS711 copies were due to a few nucleotide substitutions that in some cases led to the appearance or disappearance of some of HaeIII restriction sites (Figure 3b). These sequence differences were responsible of the remaining diversity in HaeIII digestions shown in Fig. 3. Some of these nucleotide changes were silent and the putative transposases of the different IS711 copies were identical to that of IS711A, with the exception of IS711-IsoD which was different to other copies by 3 amino acids which were Gly in place of Arg, Lys replacing Glu and Val instead of Ala. These results demonstrate that some of the IS711 copies in B. ovis and B. pinnipedialis were transpositionally active even when the observed transposition frequency was very low. We were unable to precisely determine transposition frequencies with this assay but if we consider that the tetracycline resistant colonies selected for analysis were representative of the whole population, we know that 57.7% of the mutants obtained in B. ovis and 11.4% of those obtained in B. pinnipedialis were due to IS711 transposition (Table 1). These percentages allowed us to estimate the average transposition frequency around 10-8 in both species. These frequencies are low when compared with other transposons.

Transposition activity of IS711

Transposition of IS711 was detected only in B. ovis and B. pinnipedialis. We were unable to detect transposition either in B. abortus or in B. melitensis under the same experimental conditions. Many attempts to detect IS711 transposition in E. coli from plasmids containing cloned copies of IS711 were also unsuccessful, even when powerful detection systems as the sacB transposon trap [22] were used (data not shown). All these data indicated that IS711 transposition activity was very low, restricted to Brucella maybe due to the requirement for specific host factors, and only detectable in species with a high number of copies of IS711 per genome. The presence of some IS711 copies in these species encoding a full length transposase without the need for a frameshift event, could explain the observed transposition capability. However, such a copy of IS711 has not been observed in the genomic sequence of B. ovis released recently to GenBank and a gene dosage effect is a more favoured hypothesis for transposition in B. ovis and B. pinnipedialis. The requirement for many copies of the IS could be due either to a very low level of expression of the transposase, requiring an increased dose effect for activity, or to the presence of point mutations leading to inactivity of some of the copies found in B. abortus and B. melitensis. There are several reasons that could explain a low level of IS711 transposase expression. Firstly, that the regular initiation codon for IS711 OrfA is GTG, a less efficient initiation codon than the canonic ATG. Secondly, that a -1 frameshift could be necessary in order to have an active IS711 transposase molecule. This event is usually very inefficient with less than 5% of the translation products shifted to translate into the complete transposase. Furthermore, in some insertion sequences OrfA possesses an inhibitory action on the transposition process [23]. We examined the nucleotide sequence of the IS711 copies in the genomes of the three sequenced Brucella species and analysed them to detect the reasons for their inactivity. In some of the copies either OrfA or OrfB were truncated or altered by single nucleotide insertions or deletions. Furthermore, we found that in many of these copies the start codon for OrfA was TTG instead of GTG as happens in all the copies rescued after inactivation of the cI repressor in pGBG1. TTG has been reported to be less efficient than GTG as a translation initiation codon [24]. These data support that the lack of activity observed in B. abortus and B. melitensis as well as the low transposition frequency observed in B. ovis and B. pinnipedialis could be due to the low expression (translation) of the IS711 transposase protein.

Distribution and analysis of IS711 in the Brucella sequenced genomes

The reported sequence of IS711 [7], (GenBank accession M94960) was compared with the available Brucella genomic sequences using local BLAST searches. The results showed the presence of 7 IS711 copies in B. suis and B melitensis. B abortus 9_941 also presented 7 IS711 copies but one of them was severely truncated and reduced to a 100 bp terminal remnant. B. abortus 2308 contained the same IS711 copies as the strain 9_941 and one additional IS711 copy located at exactly the same position as one of the pre-existing copies. It is well known that the B. abortus vaccine strain RB51, which is a derivative of 2308, contains an extra copy of IS711 interrupting the wboA gene [14]. The genome of B. ovis was known to contain a high copy number of IS711 estimated by hybridisation in around 30 copies [8]. The genome sequence of this species has been recently deposited in GenBank (Accesion Numbers CP000708 and CP000709). Genome sequence analysis revealed the presence of 38 complete copies of IS711 in the B. ovis genome, 25 and 13 in each chromosome respectively. Upon analysis of the genomic location of the IS711 copies we could determine that the position of six out of the seven copies was conserved in all the Brucella species. Four of the conserved copies were found in the large chromosome and two in the small chromosome. The common copies will be numbered from 1 to 6 plus a species or strain identifier (Fig. 5). When the nucleotide sequence of individual IS copies was analyzed it was evident that some sequence divergence existed among them. This indicated that IS sequence had drifted along with the other chromosomal genes in Brucella. At the same time this sequence variation allowed us to interpret the sequence identity between IS copies in the same organism as an indicator of recent transposition. In B. abortus the extra copy 711_xa was found to be identical to 711_1a. In B. abortus 2308 there is an additional IS711 copy found next to 711_3a. This copy was also identical to 711_1a. These observations strongly suggest that IS711_1a could be active and also show the strong preference of IS711 to transpose to some sites on the genome. On the other hand the IS711 copy found in the wboA gene of the B. abortus vaccine strain RB51 was found to be identical to 711_a6. This finding was rather unexpected, since 711_a6 lacks the first five nucleotides from the left IR, which would usually result in loss of the transposition ability. Insertion of this copy of IS711 into the wboA gene could also be explained by a different mobility mechanism other than transposition.
Figure 5

Position of IS. The two blocks contain the large and the small chromosomes respectively. Key to the species: S, B. suis; M, B. melitensis; A9, B abortus 9_941; A8, B abortus 2308; O, B. ovis. Common copies numbered from 1 to 6 are marked on the top. xs, xiii, x-08 and xa are IS711 species specific copies. The inverted segment of B. abortus chromosome II is marked in grey.

Position of IS. The two blocks contain the large and the small chromosomes respectively. Key to the species: S, B. suis; M, B. melitensis; A9, B abortus 9_941; A8, B abortus 2308; O, B. ovis. Common copies numbered from 1 to 6 are marked on the top. xs, xiii, x-08 and xa are IS711 species specific copies. The inverted segment of B. abortus chromosome II is marked in grey. If we correlate the sequence analysis with the results presented in this study, we can conclude that the natural transposition of IS711 occurs at very low frequency, probably due to a poor expression of IS711 transposase. This limitation can be overcome in B. ovis by the high copy number of IS711.

Conclusion

In conclusion, our results demonstrate experimentally for the first time that IS711 is an active insertion sequence of the Brucellae. On the other hand, the low transpositional activity of the sequence allows the use of this element as a tool for molecular identification, at least for the species containing a low number of copies of this insertion sequence.

Methods

Bacterial strains plasmids and growth conditions

The bacterial strains and plasmids used in this study are listed in Table 3. Escherichia coli cells were cultivated overnight at 37°C in Luria-Bertani (LB) medium (Pronadisa). Brucella strains were grown at 37°C for 48–96 hours in a 5% CO2 atmosphere in Brucella broth (BB) (Pronadisa), Blood agar (Difco) or Brucella agar (BA) medium (Pronadisa). Plates were supplemented with 10% foetal bovine serum to grow B. ovis and B. pinnipedialis.
Table 3

Bacterial strains and plasmids used in this study

Strain/PlasmidRelevant characteristicsReference
E. coli strains
S17.1TpR SmR, recA, thi, pro, hsdR-M+ RP4: 2-Tc:Mu: Km Tn7 λ pir[30]
Brucella strains
B. abortus RB51RifR, rough mutant of 2308[31]
B. melitensis 16M-NSpontaneous NalR mutant of ATCC 23456This study
B. ovis BOC 22Rough field strain, CO2 dependentThis study
B. pinnipedialis B2/94Brucella marine strain isolated from common seal, CO2 dependent[32]
Plasmids
pGBG1CmR, transposon trap derivative of pBBR-MCS1[20]

CmR: Chloramphenicol resistant, NalR: Nalidixic acid resistant, RifR: Rifampicin resistant, TpR: Trimethoprim resistant, SmR: Streptomycin resistant,

Bacterial strains and plasmids used in this study CmR: Chloramphenicol resistant, NalR: Nalidixic acid resistant, RifR: Rifampicin resistant, TpR: Trimethoprim resistant, SmR: Streptomycin resistant, pGBG1 (courtesy of M. Blot), is a derivative from the broad host-range, mobilizable plasmid pBBR1-MCS [25] containing a transposition selection module with a tetracycline resistance gene (tetA) whose expression is blocked by λ repressor cI. This plasmid allows positive selection for tetracycline resistance of transposon insertions inactivating the repressor [20].

General DNA manipulations, PCR and Southern blot hybridisations

DNA preparations, purifications, restriction endonuclease digestions and agarose gel electrophoresis were carried out according to described standard protocols [26]. Oligonucleotide primers used in this study were purchased from MWG Biotech and are listed in Table 2. PCR reactions were usually performed in 25 μl reaction volumes containing 0.2 μM of each primer, 2.5 μl of 10× PCR reaction buffer, 1.5 mM of MgCl2, 0.2 mM of dNTPs (Applied Biosystems), 25 ng of template DNA and 1 unit of BioTaq DNA polymerase (Bioline). Amplification was performed in a thermal cycler (GeneAmp PCR System 2400, Perkin Elmer) as follows: denaturation step at 94°C for 3 min and 25 cycles of 94°C for 30 s, 50°C for 30 s and 72°C for 1 min. After the last cycle the reaction mixture was reincubated at 72°C for 5 min. Preparation of the IS711 probe was performed by PCR amplification with two primers, 711u and 711d, using genomic DNA from B. melitensis 16 M as template. The PCR reaction was carried out as described and the amplified DNA fragment to be used as a probe was recovered from an agarose gel by using the QIAquick Gel Extraction Kit (QIAGEN). The probe was labelled with digoxigenin using a DIG-High Prime DNA Labelling and Detection Kit (Roche Diagnostics GmbH) as described by the supplier. Southern blot hybridisation with the DIG-labelled probe was performed as described before [27].

Conjugation experiments

Introduction of plasmid pGBG1 into Brucella was performed by conjugation from E. coli S17.1. The experiments were carried out by filter mating as follows. Equal volumes (500 μl) of mid-log-phase cultures of E. coli S.17 (pGBG1) as donor and B. abortus RB51, B. melitensis 16M-N, B. ovis BOC22 or B. pinnipedialis B2/94 as recipients were mixed and then washed with sterile PBS by centrifugation. The mixtures were spread on 0.22 μm filters (24 mm diameter, GSWP, Millipore), placed on a Brucella agar plate and incubated at 37°C for 12 h in 5% CO2atmosphere. After this period of incubation the filters with the conjugation mixtures were washed in 3 ml of BB medium. Different serial dilutions (10-1-10-3) of the conjugation mixtures were plated onto the appropriated media until growth was observed. The transconjugants of B. melitensis 16M-N and B. abortus RB51 were selected on Brucella agar medium with chloramphenicol (25 μg ml-1) and either nalidixic acid (20 μg ml-1) or rifampicin (50 μg ml-1) respectively. Transconjugants of B. ovis BOC22 and B. pinnipedialis B2/94 strains were selected on BA medium supplemented with 10% of foetal bovine serum containing chloramphenicol (25 μg ml-1) and a mixture of antibiotics (vancomycin, 3 μg ml-1; colistin, 7.5 μg ml-1; nystatin 12.5 units ml-1 and nitrofurantoin 10 μg ml-1) to counterselect against the donors. The presence of pGBG1 in the transconjugants was confirmed by extraction of plasmid DNA and analysis on agarose gels.

DNA sequencing and data analysis

PCR products were purified for sequencing by using the QIAquick Gel Extraction Kit (QIAGEN). All PCR products were sequenced by our Sequencing Service using a commercial cycle sequencing kit (Perkin Elmer, Dye Terminator Cycle Sequencing Ready Fraction Kit) according to the manufacturer's conditions. Both, the nucleotide and protein sequence analysis of the different IS711 copies isolated from each Brucella strains were performed by using the Vector NTI version 5.5 computer program (Informax Inc.). Sequences were compared with the IS711 copies reported in GenBank with the BLAST sequence comparison tool [28]. Preliminary sequence data of the B. ovis genome was obtained from The Institute for Genomic Research [29]

Authors' contributions

AOS performed most of the experimental work and wrote a draft of the paper. JMGL designed and supervised the experimental work and wrote the paper. Both authors have read an approved the final manuscript.
  28 in total

1.  The initiation codon affects ribosome binding and translational efficiency in Escherichia coli of cI mRNA with or without the 5' untranslated leader.

Authors:  S M O'Donnell; G R Janssen
Journal:  J Bacteriol       Date:  2001-02       Impact factor: 3.490

2.  Evidence for lateral transfer to Brucellae: characterization of a locus with a Tn-like element (Tn2020).

Authors:  Shirley M Halling; Richard L Zuerner
Journal:  Biochim Biophys Acta       Date:  2002-02-20

3.  A broad-host-range plasmid for isolating mobile genetic elements in gram-negative bacteria.

Authors:  D Schneider; D Faure; M Noirclerc-Savoye; A C Barrière; E Coursange; M Blot
Journal:  Plasmid       Date:  2000-09       Impact factor: 3.466

4.  An IS711 element downstream of the bp26 gene is a specific marker of Brucella spp. isolated from marine mammals.

Authors:  A Cloeckaert; M Grayon; O Grepinet
Journal:  Clin Diagn Lab Immunol       Date:  2000-09

5.  The genome sequence of the facultative intracellular pathogen Brucella melitensis.

Authors:  Vito G DelVecchio; Vinayak Kapatral; Rajendra J Redkar; Guy Patra; Cesar Mujer; Tamara Los; Natalia Ivanova; Iain Anderson; Anamitra Bhattacharyya; Athanasios Lykidis; Gary Reznik; Lynn Jablonski; Niels Larsen; Mark D'Souza; Axel Bernal; Mikhail Mazur; Eugene Goltsman; Eugene Selkov; Philip H Elzer; Sue Hagius; David O'Callaghan; Jean-Jacques Letesson; Robert Haselkorn; Nikos Kyrpides; Ross Overbeek
Journal:  Proc Natl Acad Sci U S A       Date:  2001-12-26       Impact factor: 11.205

6.  Completion of the genome sequence of Brucella abortus and comparison to the highly similar genomes of Brucella melitensis and Brucella suis.

Authors:  Shirley M Halling; Brooke D Peterson-Burch; Betsy J Bricker; Richard L Zuerner; Zhang Qing; Ling-Ling Li; Vivek Kapur; David P Alt; Steven C Olsen
Journal:  J Bacteriol       Date:  2005-04       Impact factor: 3.490

7.  Genetic organisation of the lipopolysaccharide O-antigen biosynthesis region of brucella melitensis 16M (wbk).

Authors:  F Godfroid; A Cloeckaert; B Taminiau; I Danese; A Tibor; X de Bolle; P Mertens; J J Letesson
Journal:  Res Microbiol       Date:  2000-10       Impact factor: 3.992

8.  Development of a new PCR assay to identify Brucella abortus biovars 5, 6 and 9 and the new subgroup 3b of biovar 3.

Authors:  Alain A Ocampo-Sosa; Jesús Agüero-Balbín; Juan M García-Lobo
Journal:  Vet Microbiol       Date:  2005-09-30       Impact factor: 3.293

Review 9.  Brucellosis: a worldwide zoonosis.

Authors:  M L Boschiroli; V Foulongne; D O'Callaghan
Journal:  Curr Opin Microbiol       Date:  2001-02       Impact factor: 7.934

10.  The Brucella suis genome reveals fundamental similarities between animal and plant pathogens and symbionts.

Authors:  Ian T Paulsen; Rekha Seshadri; Karen E Nelson; Jonathan A Eisen; John F Heidelberg; Timothy D Read; Robert J Dodson; Lowell Umayam; Lauren M Brinkac; Maureen J Beanan; Sean C Daugherty; Robert T Deboy; A Scott Durkin; James F Kolonay; Ramana Madupu; William C Nelson; Bola Ayodeji; Margaret Kraul; Jyoti Shetty; Joel Malek; Susan E Van Aken; Steven Riedmuller; Herve Tettelin; Steven R Gill; Owen White; Steven L Salzberg; David L Hoover; Luther E Lindler; Shirley M Halling; Stephen M Boyle; Claire M Fraser
Journal:  Proc Natl Acad Sci U S A       Date:  2002-09-23       Impact factor: 11.205

View more
  12 in total

1.  The genome sequence of Brucella pinnipedialis B2/94 sheds light on the evolutionary history of the genus Brucella.

Authors:  Stéphane Audic; Magali Lescot; Jean-Michel Claverie; Axel Cloeckaert; Michel S Zygmunt
Journal:  BMC Evol Biol       Date:  2011-07-11       Impact factor: 3.260

2.  Complete genome sequence of Brucella canis strain HSK A52141, isolated from the blood of an infected dog.

Authors:  Jong-So Kim; Wooseog Jeong; Hye-Young Jeoung; Jae-Young Song; Hyungtae Kim; Jeong-Hun Beak; Vinuselvi Parisutham; Sung Kuk Lee; Jong Wan Kim; Ji-Yeon Kim; Suk Chan Jung; Moon Her; Dong-Jun An
Journal:  J Bacteriol       Date:  2012-09       Impact factor: 3.490

Review 3.  Laboratory Diagnosis of Human Brucellosis.

Authors:  Pablo Yagupsky; Pilar Morata; Juan D Colmenero
Journal:  Clin Microbiol Rev       Date:  2019-11-13       Impact factor: 26.132

4.  Transposition of an insertion sequence, ISTth7, in the genome of the extreme thermophile Thermus thermophilus HB8.

Authors:  Steven T Gregory; Albert E Dahlberg
Journal:  FEMS Microbiol Lett       Date:  2008-10-28       Impact factor: 2.742

5.  Identification of new IS711 insertion sites in Brucella abortus field isolates.

Authors:  Marcos Mancilla; Marcos Ulloa; Ignacio López-Goñi; Ignacio Moriyón; Ana María Zárraga
Journal:  BMC Microbiol       Date:  2011-08-03       Impact factor: 3.605

6.  A sensitive & specific multiplex PCR assay for simultaneous detection of Bacillus anthracis, Yersinia pestis, Burkholderia pseudomallei & Brucella species.

Authors:  Sai Arun Batra; S Krupanidhi; Urmil Tuteja
Journal:  Indian J Med Res       Date:  2013       Impact factor: 2.375

7.  Brucella abortus Strain 2308 Wisconsin Genome: Importance of the Definition of Reference Strains.

Authors:  Marcela Suárez-Esquivel; Nazareth Ruiz-Villalobos; Amanda Castillo-Zeledón; César Jiménez-Rojas; R Martin Roop Ii; Diego J Comerci; Elías Barquero-Calvo; Carlos Chacón-Díaz; Clayton C Caswell; Kate S Baker; Esteban Chaves-Olarte; Nicholas R Thomson; Edgardo Moreno; Jean J Letesson; Xavier De Bolle; Caterina Guzmán-Verri
Journal:  Front Microbiol       Date:  2016-09-29       Impact factor: 5.640

8.  Brucella Genetic Variability in Wildlife Marine Mammals Populations Relates to Host Preference and Ocean Distribution.

Authors:  Marcela Suárez-Esquivel; Kate S Baker; Nazareth Ruiz-Villalobos; Gabriela Hernández-Mora; Elías Barquero-Calvo; Rocío González-Barrientos; Amanda Castillo-Zeledón; César Jiménez-Rojas; Carlos Chacón-Díaz; Axel Cloeckaert; Esteban Chaves-Olarte; Nicholas R Thomson; Edgardo Moreno; Caterina Guzmán-Verri
Journal:  Genome Biol Evol       Date:  2017-07-01       Impact factor: 3.416

9.  Persistence of Brucella abortus lineages revealed by genomic characterization and phylodynamic analysis.

Authors:  Marcela Suárez-Esquivel; Gabriela Hernández-Mora; Nazareth Ruiz-Villalobos; Elías Barquero-Calvo; Carlos Chacón-Díaz; Jason T Ladner; Gerardo Oviedo-Sánchez; Jeffrey T Foster; Norman Rojas-Campos; Esteban Chaves-Olarte; Nicholas R Thomson; Edgardo Moreno; Caterina Guzmán-Verri
Journal:  PLoS Negl Trop Dis       Date:  2020-04-14

Review 10.  Brucella Genomics: Macro and Micro Evolution.

Authors:  Marcela Suárez-Esquivel; Esteban Chaves-Olarte; Edgardo Moreno; Caterina Guzmán-Verri
Journal:  Int J Mol Sci       Date:  2020-10-20       Impact factor: 5.923

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.