Literature DB >> 6255437

Two drosophila melanogaster tRNAGly genes are contained in a direct duplication at chromosomal locus 56F.

N D Hershey, N Davidson.   

Abstract

One Drosophila melanogaster tRNAGly gene occurs on each 1.1-2.0 kb unit of a direct duplication at chromosomal region 56F. The nucleotide sequence of the gene and the 5' flanking region has been determined. The non-transcribed strand sequence of the tRNA gene is: 5' GCATCGGTGGTTCAGTGGTAGAATGCTCGCCTGCCACGCGGGCGGCCCGGGTTCGATTCCCGGCCGATGCA 3'. This nucleotide sequence is identical to that of the major glycine tRNA in Bombyx mori posterior silk gland. Within the 22 kb region mapped, additional tRNA genes are found, an observation consistent with reports that genes for other isoacceptors are present at this locus.

Entities:  

Mesh：

Substances：

Year:  1980        PMID： 6255437      PMCID： PMC324267          DOI： 10.1093/nar/8.21.4899

Source DB:  PubMed          Journal:  Nucleic Acids Res        ISSN： 0305-1048            Impact factor:   16.971


  30 in total

1.  Colony hybridization: a method for the isolation of cloned DNAs that contain a specific gene.

Authors:  M Grunstein; D S Hogness
Journal:  Proc Natl Acad Sci U S A       Date:  1975-10       Impact factor: 11.205

2.  Detection of specific sequences among DNA fragments separated by gel electrophoresis.

Authors:  E M Southern
Journal:  J Mol Biol       Date:  1975-11-05       Impact factor: 5.469

3.  Construction of biologically functional bacterial plasmids in vitro.

Authors:  S N Cohen; A C Chang; H W Boyer; R B Helling
Journal:  Proc Natl Acad Sci U S A       Date:  1973-11       Impact factor: 11.205

4.  The 5 s RNA genes of Drosophila melanogaster.

Authors:  K D Tartof; R P Perry
Journal:  J Mol Biol       Date:  1970-07-28       Impact factor: 5.469

5.  Charon phages: safer derivatives of bacteriophage lambda for DNA cloning.

Authors:  F R Blattner; B G Williams; A E Blechl; K Denniston-Thompson; H E Faber; L Furlong; D J Grunwald; D O Kiefer; D D Moore; J W Schumm; E L Sheldon; O Smithies
Journal:  Science       Date:  1977-04-08       Impact factor: 47.728

6.  Localization of tRNA genes in the salivary chromosomes of Drosophila by RNA:DNA hybridization.

Authors:  D M Steffensen; D E Wimber
Journal:  Genetics       Date:  1971-10       Impact factor: 4.562

7.  On the redundancy of DNA complementary to amino acid tranfer RNA and its absence from the nucleolar organizer region of Drosophila melanogaster.

Authors:  F M Ritossa; K C Atwood; S Spiegelman
Journal:  Genetics       Date:  1966-08       Impact factor: 4.562

8.  Base sequence complexity of the stable RNA species of Drosophila melanogaster.

Authors:  L Weber; E Berger
Journal:  Biochemistry       Date:  1976-12-14       Impact factor: 3.162

9.  Nucleotide sequence of the rightward operator of phage lambda.

Authors:  T Maniatis; A Jeffrey; D G Kleid
Journal:  Proc Natl Acad Sci U S A       Date:  1975-03       Impact factor: 11.205

10.  The localization of transfer RNA5Lys genes in Drosophila melanogaster.

Authors:  T A Grigliatti; B N White; G M Tener; T C Kaufman; D T Suzuki
Journal:  Proc Natl Acad Sci U S A       Date:  1974-09       Impact factor: 11.205
View more
  13 in total

1.  Compilation of tRNA sequences and sequences of tRNA genes.

Authors:  M Sprinzl; N Dank; S Nock; A Schön
Journal:  Nucleic Acids Res       Date:  1991-04-25       Impact factor: 16.971

2.  Five glycyl tRNA genes within the noc gene complex of Drosophila melanogaster.

Authors:  Y B Meng; R D Stevens; W Chia; S McGill; M Ashburner
Journal:  Nucleic Acids Res       Date:  1988-07-25       Impact factor: 16.971

3.  Genes and pseudogenes in a reiterated rat tRNA gene cluster.

Authors:  A Rosen; S Sarid; V Daniel
Journal:  Nucleic Acids Res       Date:  1984-06-25       Impact factor: 16.971

4.  Isolation and characterization of cloned rat DNA fragment carrying tRNA genes.

Authors:  M Lasser-Weiss; N Bawnik; A Rosen; S Sarid; V Daniel
Journal:  Nucleic Acids Res       Date:  1981-11-25       Impact factor: 16.971

5.  Cloning and delimiting one chloroplast DNA replicative origin of Chlamydomonas.

Authors:  X M Wang; C H Chang; J Waddell; M Wu
Journal:  Nucleic Acids Res       Date:  1984-05-11       Impact factor: 16.971

6.  Localization of tRNA genes of Drosophila melanogaster by in situ hybridization.

Authors:  S Hayashi; I C Gillam; T A Grigliatti; G M Tener
Journal:  Chromosoma       Date:  1982       Impact factor: 4.316

7.  Genes for tRNALys5 from Drosophila melanogaster.

Authors:  D DeFranco; K B Burke; S Hayashi; G M Tener; R C Miller; D Söll
Journal:  Nucleic Acids Res       Date:  1982-10-11       Impact factor: 16.971

8.  Glutamate tRNA genes are adjacent to 5S RNA genes in Drosophila and reveal a conserved upstream sequence (the ACT-TA box).

Authors:  Z K Indik; K D Tartof
Journal:  Nucleic Acids Res       Date:  1982-07-24       Impact factor: 16.971

9.  Organization of soybean chalcone synthase gene clusters and characterization of a new member of the family.

Authors:  S Akada; S K Dube
Journal:  Plant Mol Biol       Date:  1995-10       Impact factor: 4.076

10.  The initiator tRNA genes of Drosophila melanogaster: evidence for a tRNA pseudogene.

Authors:  S Sharp; D DeFranco; M Silberklang; H A Hosbach; T Schmidt; E Kubli; J P Gergen; P C Wensink; D Söll
Journal:  Nucleic Acids Res       Date:  1981-11-25       Impact factor: 16.971
View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.