Repair of mismatched templates during Rad51-dependent Break-Induced Replication.

Using budding yeast, we have studied Rad51-dependent break-induced replication (BIR), where the invading 3' end of a site-specific double-strand break (DSB) and a donor template share 108 bp of homology that can be easily altered. BIR still occurs about 10% as often when every 6th base is mismatched as with a perfectly matched donor. Here we explore the tolerance of mismatches in more detail, by examining donor templates that each carry 10 mismatches, each with different spatial arrangements. Although 2 of the 6 arrangements we tested were nearly as efficient as the evenly-spaced reference, 4 were significantly less efficient. A donor with all 10 mismatches clustered at the 3' invading end of the DSB was not impaired compared to arrangements where mismatches were clustered at the 5' end. Our data suggest that the efficiency of strand invasion is principally dictated by thermodynamic considerations, i.e., by the total number of base pairs that can be formed; but mismatch position-specific effects are also important. We also addressed an apparent difference between in vitro and in vivo strand exchange assays, where in vitro studies had suggested that at a single contiguous stretch of 8 consecutive bases was needed to be paired for stable strand pairing, while in vivo assays using 108-bp substrates found significant recombination even when every 6th base was mismatched. Now, using substrates of either 90 or 108 nt-the latter being the size of the in vivo templates-we find that in vitro D-loop results are very similar to the in vivo results. However, there are still notable differences between in vivo and in vitro assays that are especially evident with unevenly-distributed mismatches. Mismatches in the donor template are incorporated into the BIR product in a strongly polar fashion up to ~40 nucleotides from the 3' end. Mismatch incorporation depends on the 3'→ 5' proofreading exonuclease activity of DNA polymerase δ, with little contribution from Msh2/Mlh1 mismatch repair proteins, or from Rad1-Rad10 flap nuclease or the Mph1 helicase. Surprisingly, the probability of a mismatch 27 nt from the 3' end being replaced by donor sequence was the same whether the preceding 26 nucleotides were mismatched every 6th base or fully homologous. These data suggest that DNA polymerase δ "chews back" the 3' end of the invading strand without any mismatch-dependent cues from the strand invasion structure. However, there appears to be an alternative way to incorporate a mismatch at the first base at the 3' end of the donor.

Introduction

DNA double-strand breaks (DSBs) are the most toxic lesions that can occur in DNA, and failure to repair these breaks can result in genome instability. Eukaryotes have evolved two major types of DNA repair mechanisms to deal with DSBs: non-homologous end joining (NHEJ) and homologous recombination (HR). In “classic” NHEJ, broken ends are ligated back together using little or no base pairing of the broken ends whereas microhomology-mediated end-joining (MMEJ), also known as alternative nonhomologous end-joining (Alt-NHEJ) uses several bases of shared microhomology at the junction to align the broken strands that are revealed after DSB ends are resected by 5’ to 3’ exonucleases [1-4]. Both NHEJ and MMEJ may result in small insertions or deletions of sequences surrounding the DSB.

When both ends of a DSB share homology with a donor–on a sister chromatid, a homologous chromosome or at an ectopic location–repair most often occurs by gene conversion in which the DSB is patched up by copying the intact donor sequence [5]. HR is initiated by 5’ to 3’ resection that creates 3’-ended single strands that are bound by the Rad51 recombinase that facilitates the search for homology and promotes strand invasion, enabling the 3’ end of the invading strand to be extended by DNA polymerase. In synthesis-dependent strand annealing, the most common gene conversion outcome in mitotic cells, subsequent steps allow the second end of the DSB to anneal to the newly copied strand and initiate another round of DNA synthesis to complete the repair.

Here we focus on break-induced replication (BIR), an alternative HR pathway that is engaged when only one of the ends of a DSB shares homology with a donor sequence [5]. BIR allows the extension of eroded telomeres and the re-initiation of DNA replication at stalled and broken replication forks [6,7]. As in gene conversion, BIR is initiated by 5’→ 3’ resection of a broken DNA end to generate a 3’ single-stranded DNA (ssDNA) tail (S1A Fig). Initially, replication protein complex A (RPA) coats the ssDNA tails but is then displaced by the recombination protein Rad51 [8,9]. Each monomer of Rad51, like its bacterial homolog, RecA, binds 3 nucleotides of ssDNA to form a nucleoprotein filament that catalyzes base-pairing and strand invasion between the Rad51-coated ssDNA end of DSB and a homologous double-stranded DNA (dsDNA) donor [10-13]. Strand invasion and the formation of a displacement loop (D-loop) enables DNA polymerase δ to prime DNA synthesis and extend the 3’ end of invading strand to the end of the chromosome [14-16]. In many respects, BIR events studied in budding yeast resemble mammalian alternative lengthening of telomeres (ALT) [7,17-19]. BIR also appears to be critical for DNA synthesis that occurs very late in the cell cycle as cells enter mitosis (MiDAS) [7,20-22]. Both in yeast and in mammalian cells, the nonessential Pol32 (POLD3) subunit of DNA polymerase δ is required for BIR but not for normal DNA replication [23,24].

Precisely how Rad51 performs strand exchange remains a subject of great interest [25-28]. HR depends on both the length and the degree of homology between donor and recipient. In budding yeast, efficient gene conversion or BIR can be accomplished with at least 50–100 bp of sequence homology [17,27,29]. In the intrachromosomal BIR system that we use in this study (Fig 1), a site-specific DSB is induced by the expression of HO endonuclease and repair occurs at an ectopic 108-bp donor sequence. Approximately 14% of cells repaired the DSB by BIR when the homologous region is 108 bp; but repair dropped to 1% with a 54-bp template and to 0.02% when there were only 26 bp [17]. Repair was also reduced by the presence of heterologies (the presence of non-complementary bases between donor and recipient sequences). However, repair was still possible when every 6th base was mismatched, at a rate that was about 10% of that seen when the templates were identical [17]. These in vivo results contrasted with in vitro single-molecule studies using substrates with just a short tract of sequence homology, flanked by regions without sequence homology, which found that a minimum of at least 8 consecutive bases must be present for a stable association with double-stranded DNA promoted by the bacterial strand exchange protein RecA, or its eukaryotic homologs Rad51 or Dmc1 [10]. Other in vitro studies also concluded that 8 contiguous base pairs are required for stable substrate binding by bacterial RecA [30-32]. These differences could have reflected the fact that some key recombination proteins acting in vivo were not included in the in vitro assays; but in fact, as we show here, the differences among these studies likely reflect the differences in the overall size of the homologous regions that were studied. When we performed in vitro D-loop assays mediated by Rad51 in the presence of Rad54, analyzing substrates identical to the 108-base regions used in our in vivo studies, the results are comparable, with D-loop formation occurring even when every 6th base was mismatched.

Fig 1

BIR-dependent formation of a functional Ura3+ recombinant.

The recipient sequence shares the 108-bp region of homology and contain the 5’ sequences from the URA3 gene (UR), the splice donor site (5’ SD) of an artificial intron and the HO cut site. 108-bp donor sequences containing different mismatch distributions were assembled into a plasmid containing the 3’ sequences from the URA3 gene (A3), the 3’ splice-acceptor (3’ SA) of the intron and the TRP1 auxotrophic maker. A DSB was created using the galactose-inducible HO endonuclease. This break is repaired by BIR using the donor sequences that share 108-bp of homology located on the opposite arm of chromosome V. Once BIR is complete, a functional intron is formed, and yeast become Ura3+ recombinants.

In our previous study, we used donor templates in which the heterologies were evenly-distributed [17]. Here, we extended our study of mismatch tolerance by examining several templates each with ten mismatches but distributed unevenly, every 6th base. We wished to determine if these different distributions would be treated equivalently, which would be the case if strand invasion in BIR were principally governed by thermodynamic considerations, in which the total number of base pairs that can be formed would dictate repair efficiency. Donor templates with majority of mismatches towards the 3’ end proved to be nearly as efficient as a donor with 10 mismatches evenly-distributed (every 10 bases); but, unexpectedly, donor templates with majority of mismatches positioned towards the 5’ end were statistically significantly lower than the evenly-distributed control. There were distinctive differences between the in vivo results and those obtained for the in vitro D-loop assay, suggesting that other repair factors may play a role when mismatches are closely spaced. However, this discrimination does not appear to be monitored by the Msh2-dependent mismatch repair system.

A second important aspect of our analysis of repair involving mismatched substrates came from analyzing the assimilation of heterologies from the donor into the BIR product. Mismatches close to the 3’ end of the invading strand are very frequently replaced by the template sequence (i.e. a gene conversion event), but there is a steep decline in their incorporation further away from the 3’ end, so that by about 40 bp from the 3’ end, incorporation of the template sequence is rare [17]. The assimilation of the template sequence is dependent on the 3’ to 5’ proofreading activity of DNA polymerase δ, which presumably chews back the 3’ end of the invading strand before initiating copying of the donor template (S1B Fig). There was little effect when Msh2/Mlh1-dependent mismatch repair was ablated, although the extent of mismatch assimilation was shortened [17]. Here, we make the surprising discovery that 3’ to 5’ removal of the 3’ end of the strand-invading DNA is evident even when the first 26 nucleotides are completely homologous to the template, suggesting that this resection is not provoked by a nearby mismatch. Moreover, there appears to be another means of removing a heterology at the first base position.

Results

To study the effect of different distributions of mismatches on BIR repair efficiency we used the assay shown in Fig 1. A galactose-inducible site-specific DSB is created by HO endonuclease at a site just distal to the 5’ end of the URA3 gene (UR) joined to an mRNA splicing donor sequence (SD) [17]. Only the centromere-proximal end of the DSB shares homology with the donor, which in this case is located on the opposite arm of the same chromosome, about 30 kb from the telomere. The donor consists of a 108-bp region of homology such that the DSB end is perfectly matched to the donor (i.e., there are no additional nonhomologous sequences at the 3’ end). The 108-bp homologous segment is adjacent to 3’ splice acceptor (SA) site, followed by the 3’ end of the URA3 gene (A3). Thus, BIR results in a nonreciprocal translocation producing an intron-containing, intact URA3 gene so that cells can grow in the absence of uracil.

We confirmed that strain yRA280 (with every 10th base pair mismatched) and yRA321 (with every 6th base pair mismatched) had reduced, but significant levels of repair compared to yRA253 (a fully homologous donor) (Fig 2B). We note that the % BIR we report in this publication are lower than those previously reported by Anand et al. (2017), although results are proportionally very similar. We are not certain what methodological or environmental conditions have changed, but the results have been confirmed by several authors and the conclusions from the previous publication and this work are the same. We then created six new strains, each of which had 10 mismatches, but arranged so that they were clustered every 6 bases apart (Fig 2A). The mismatches included both transversion and transition mismatches (S2 Table).

Fig 2

The effect of different distributions of mismatches on a 108-bp donor template on the efficiency of Rad51-dependent BIR.

A. Arrangement of mismatches in 108-bp donors. yRA253 (no mismatch), yRA280 (10 mismatches every 10th bp) and yRA321 (18 mismatches every 6th). The set of donors with even mismatch distribution was compared with a set of divergent 108-bp donor templates containing a total of 10 mismatches that are distributed unevenly throughout the template. The spacing between the clustered mismatches are every 6th bp. DNA sequences are shown in S2 Table. B. Percent BIR efficiency of 108-bp donors with perfect homology and even mismatch distribution. One-way ANOVA multiple comparison was used to determine the p-value, **p ≤ 0.001, ns = not significant. Error bars indicate standard deviation. A minimum of three measurements were performed. C. Percent BIR efficiency of 108-bp donors with even and uneven distribution. The set of donors with uneven mismatch distribution was compared to yRA280 which contains the same mismatch density as all unevenly-mismatched donors and to yRA321 which has the same 6th bp spacing between clustered mismatches. Significance determined using a Dunnett’s method (GraphPad Prism 9). Error bars refer to standard deviation. ** p<0.001, ns = not significant.

When compared to yRA280, donor template B, with all mismatches clustered at the 3’ invading end of the DSB (Fig 2C) was nearly as efficient as yRA280. In contrast, a substrate with a 48 bp of perfect homology at the 3’ end (Fig 2C, donor template D) was statistically significantly less efficient than yRA280. Thus, although the 3’ end must be synapsed with the donor to allow DNA polymerase δ to initiate new DNA synthesis at the 3’ end, BIR efficiency was less impaired when the 3’ invading end of the DSB was mismatched (donor template B) than when distal 5’ end of homologous sequence was mismatched (donor template D). However, among all 6 templates there was no clear correlation between the location of the mismatches and their efficiency of usage (S4 Fig). Moreover, donor templates E and F, with 26 bp perfect homology at the 3’ end performed worse than the four other substrates.

The variation among these templates cannot be attributed to differences in thermal stability of base-pairing in the 108-bp region as measured by the calculated melting temperature (Tm) between complementary 108-nt DNA strands (S2 Table and Fig 3A). Interestingly, the slopes of the linear regression lines were nearly identical for the evenly-distributed controls (y = 0.053x - 3.74; R2 = 0.98) as for the 6 unevenly spaced cases (y = 0.053x - 4.08; R2 = 0.62) but the unevenly-distributed series lie on a line shifted below the controls. Thus the templates with a higher GC content that can form a more stable heteroduplex–and have a higher Tm—with the invading 3’-end of the DSB yield an increased BIR efficiency. We note that the invading strand is always the same sequence.

Fig 3

Rad51-mediated strand annealing is less efficient when the mismatches are spaced every 6bp apart.

A. Percent BIR of both evenly- and unevenly-mismatched donor templates are plotted against their melting temperatures Tm (°C). The melting temperature of single-stranded DNA of each donor template, synapsed with the complementary single-strand DNA of recipient sequence (S2 Table), was calculated by the method of Markham and Zucker [37]. A least-squares line (solid black line) was determined for the three samples with 0, evenly-distributed every 10th and evenly-distributed every 6th bp mismatches (yRA253, yRA280, and yRA321). A least-squares line for the six donor templates with 10 uneven mismatch distributions was plotted separately (black dotted line). B. Similar comparisons were made for strains deleted for MSH2. C. Efficiency of in vitro D-loop formation for 108-bp templates identical to A through F, as noted above. See also Fig 4.

Fig 4

Comparison of BIR with in vitro D-loop formation.

A. Normalized D-loop fraction, using 90-nt ssDNA substrates containing only evenly-distributed mismatches. B. Normalized Ura3+ viability (reproduced from [17]), using 108-bp donor DNA templates containing only evenly-distributed mismatches. C. Correlation between normalized Ura3+ viability and normalized D-loop fraction, using 108-bp donor templates and 90-nt ssDNA substrates, respectively, containing only evenly-distributed mismatches. D. Normalized D-loop fraction of 108-nt ssDNA substrates containing both evenly- and unevenly-distributed mismatches (same sequences as those in Fig 2A). Statistical significance determined by comparing between donor templates A-F to yRA280 as control by using a Dunnett’s method (GraphPad Prism 9). **** p<0.0001, ns = not significant. E. Comparison of normalized Ura3+ BIR efficiencies and D-loop fractions, using 108-bp donor templates and corresponding 108-nt ssDNA substrates, respectively, containing both evenly- and unevenly-distributed mismatches.

Comparison of in vivo and in vitro strand invasion assays

We next investigated how our in vivo results compare with in vitro assays of recombination, specifically strand invasion, by analyzing the ability of a single-stranded template to form a D-loop with a supercoiled plasmid carrying a region of homology [14] (see Methods). Previous single molecule studies, using short duplex DNA of 70 base pairs in length, but designed to contain just a single tract of sequence homology ≥8 bases in length had suggested that stable substrate binding required at a minimum of 8 consecutive base pairs of homologous sequence in assays with Rad51, Dmc1, or RecA, but lacking any other protein cofactors [33]. These data were quite different from the results found in vivo, where substrates containing 18 tracts of five consecutive base pairs of sequence homology (i.e. every 6th bp mismatched) had significant levels of recombination (Fig 2B). This difference could reflect the presence in vivo of additional protein factors not present in the single molecule in vitro assay (e.g., Rad52, Rad54, etc.), or differential substrate and protein requirements for stable substrate binding in vitro versus the complete recombination outcomes in vivo. Additionally, it could also be a consequence of the differences in the cumulative length of the homologous sequences within substrates themselves (i.e., 8 homologous base pairs in vitro versus a total of 90 homologous bases within the 108-bp substrate with every 6th base mismatched in vivo), where additional base pairing along a longer substrate might compensate for the lack of 8 consecutive paired bases. To investigate this question, we first carried out a series of in vitro D-loop assays with Rad51 and Rad54 using 90-base single-stranded DNA containing evenly-distributed mismatches (see Methods) (Fig 4A, S5 Table). Indeed, quite similar to the previous in vivo results (Fig 4B), D-loops could be detected even when every 6th base was mismatched. Overall, the influence of evenly-distributed mismatches on in vivo and in vitro assays proved to be strikingly similar (Fig 4B and 4C). Thus, the cumulative length of the homologous sequences present in these substrates allows mismatch densities as high as every 6th base pair to be tolerated during in vitro D-loop formation.

We then performed a similar D-loop analysis for the same six 108-nt unevenly-mismatched templates that we had analyzed in vivo (Fig 4D). As shown in Fig 3, there was a weak correlation between D-loop formation and Tm for both the in vivo (Fig 3A and 3B) and in vitro (Fig 3C) assays with these unevenly-distributed mismatches. But unlike the results in vivo, there was no general reduction in product formation compared to the evenly-distributed controls in the in vitro assays. Since the same set of donor template and ssDNA sequences were used in both in vivo and in vitro experiments, we also compared in vivo BIR efficiencies with the quantified in vitro D-loop product formation, which revealed a general positive correlation between these results (Pearson R2 = 0.43, Fig 4E). A Mann-Whitney test confirmed that the results between these in vivo and in vitro sets are statistically significantly different (p = 0.001). There may be some additional factors in vivo such as mismatch-stimulated heteroduplex rejection [34,35] that reduce the likelihood of successful BIR. The variation among the in vitro D-loop outcomes also suggest there are likely to be additional sequence-specific features that have yet to be understood.

Effect of the mismatch repair gene MSH2 on BIR with mismatched templates

We then asked if the generally lower values for the unevenly-distributed series for BIR was attributable to the action of the mismatch repair protein, Msh2. Although Msh2 plays an important role in heteroduplex rejection, it proved to be primarily dependent on the presence of a nonhomologous tail at the 3’ end of the invading strand [17]. Here there 3’ end is perfectly matched. We assessed the effect of deleting MSH2 on BIR efficiencies among the set of different donors. In general, the efficiency of BIR was lower in the absence of Msh2, even in the absence of mismatches in the donor (Fig 3). Compared to wild type cells, in the absence of Msh2 there was a lower slope of the relation between BIR efficiency and the Tm of the sequence, both for the three controls (y = 0.044x - 2.98 compared to y = 0.053x - 3.74) and for the 6 unevenly-distributed cases (y = 0.036x - 2.55 versus y = 0.053x - 4.08) (Fig 3B). Again, the six mismatched cases appeared to lie on a separate line, with a slope similar to that for the evenly-distributed controls. Although none of the pairwise comparisons between WT and msh2Δ for individual templates were statistically significant (S5 Fig), the differences between the WT and msh2Δ data as a whole were significant by a Mann-Whitney test (p = 0.004). Because msh2Δ did not suppress the difference between the evenly-spaced and the clustered mismatch arrangements, we conclude that there is some other factor beyond the mismatch repair machinery that causes the unevenly-distributed mismatches to be less successful in BIR than the evenly-distributed controls. We note also that we did not find any difference in the thermal stability of possible secondary structures that could be formed by the different 108-nt regions, viewed as single-strand sequences (see Methods).

Assimilation of mismatches from the donor into BIR products reveals the role of DNA polymerase δ

Once heteroduplex DNA forms by strand invasion, mismatch correction may lead to the incorporation of donor sequences into the BIR product. However, the assimilation of heterologies into the BIR product does not proceed through the general Msh2/Mlh1-dependent mismatch repair system [17], but instead is dependent on the 3’ to 5’ exonuclease activity of DNA polymerase δ, which chews away 3’ end of the invading strand and then copies the donor sequence [36]. Thus, mismatches very close to the 3’ end of the invading DNA are very frequently replaced by the donor allele. There is a steep drop in the incorporation of donor alleles, extending 40–50 nt from the DSB end, after which there was little or no incorporation of the mismatches (Fig 5E) [17].

Fig 5

Incorporation of mismatches into the BIR product.

A-D. Percent mismatch incorporation of individual donor templates containing 10 mismatches distributed unevenly throughout the 108-bp donor template. The number of sequenced recombinant clones for each template are indicated. E. Composite of % mismatch corrections for 6 different templates with different distributions of 10 mismatches.

To determine the extent of incorporating donor mismatches into the final product, we sequenced approximately 50 BIR products from each of the templates shown in Fig 2A. In each case, mismatches were incorporated into the BIR product with the same strong polarity seen with the evenly-distributed mismatches [17]. Mismatch assimilation was seen as far as 55 nucleotides from the 3’ invading end (Fig 5A, donor template B). For template D, containing 10 mismatches clustered near the 5’ end and with 48 bp perfect homology near the 3’ end of the break, none of the 10 mismatches were incorporated (Fig 5B). However, for all the constructs in which there were mismatches in the first 48 bp, the pattern of incorporation was the same (Fig 5E). Surprisingly, in donor templates E and F (Fig 5C), the degree of incorporation of mismatches at positions 27, 33 and 39 bp from the invading end was indistinguishable from the correction of these same sites when all the mismatches are present at the 3’ end (Fig 5A, donor template B). These data suggest that 3’ to 5’ exonuclease activity of DNA polymerase δ removes the 3’ end of the invading strand to incorporate mismatches beyond 26 bp even when this region lacks any mismatches.

Almost all mismatch incorporation was eliminated when the 3’ to 5’ proofreading exonuclease activity of DNA polymerase δ became defective (pol3-01) (Fig 6B, for every 10th base mismatched), suggesting that proofreading activity is responsible for incorporating mismatches as far as 40 nt. Consistent with previous observation, both evenly- and unevenly-mismatched donor templates showed significant ablation of mismatch incorporation in pol3-01 background (Fig 6B and 6C). Even if the first 26 nt of the 3’ invading end was identical to the donor, the assimilation of mismatches at the 27th base was dependent on Polδ proofreading.

Fig 6

3’ to 5’ proofreading activity of DNA polymerase δ is responsible for incorporating most mismatches into the BIR product.

A. Effect of proofreading-defective DNA polymerase δ mutant (pol3-01) on BIR efficiency of donor templates with perfect homology (yRA253) and donor template mismatched every 10th bp (yRA280). Unpaired t-test with Welch’s correction was used to determine the p-value. Error bars indicate standard deviation. A minimum of at least five measurements were performed. B. Percent mismatch assimilation of donor template mismatched every 10th bp (yRA280). A minimum of 40 samples were DNA sequenced. C. Percent mismatch assimilation of donor template with even mismatch distribution with proofreading-defective DNA Polymerase δ mutant (pol3-01). C. Effect of pol3-01 on mismatch assimilation of donor templates with uneven mismatch distributions.

Unexpectedly, we found that donor templates A and B, with a cluster of mismatches near the 3’ invading end of the DSB, showed that the mismatch at the first base was still efficiently incorporated in pol3-01, even though all the other mismatches were generally not incorporated in this mutant (Fig 6C, donor template A and B). Previous study has shown that pol3-01 is both almost completely exonuclease-deficient and strand displacement-proficient [37]. However, there may be some residual 3’ to 5’ proofreading exonuclease activity of DNA polymerase δ that could explain why we still see efficient incorporation of the first nucleotide mismatch in donor templates A and B (Fig 6C).

To confirm that assimilation of mismatches was independent of the Msh2/Mlh1-dependent mismatch repair system, we examined repair in the two reference strains, yRA280 and yRA321, as well as in donor template A (Fig 7A and 7B). In each case, cells lacking MLH1 or MSH2 still can extend and correct mismatches >30 bp from the 3’ invading end of the DSB (Fig 7A and 7B). The mismatch assimilation of msh2Δ derivatives of remaining donor templates (templates B through F) with uneven distribution also did not proceed through Msh2-dependent mismatch repair (S3 Fig).

Fig 7

The mismatch assimilation of the template sequence does not proceed through Msh2/Mlh1-dependent mismatch repair.

Effect of deleting mismatch repair genes MSH2 or MLH1 on mismatch incorporation pattern and BIR efficiency for strains yRA280 and yRA321 (A) or donor template A (B). Welch’s t-test was used to determine the p-value. Error bars refer to standard error of the mean. A minimum of at least three measurements were performed. For all % mismatch incorporation data, a minimum of 40 samples were DNA sequenced.

Effect of the 3’ flap endonuclease Rad1 on BIR with mismatched templates

The Rad1/Rad10 protein complex is required to remove 3’ nonhomologous tails during strand annealing or strand invasion, to allow DNA polymerase to extend the paired 3’ end [38-40]. Although in the design of the BIR substrates used here, there are no additional nonhomologous sequences at the HO cleavage site that would need to be removed, we asked if Rad1-Rad10 might still play a role in removing the 3’ end when correction extends back as far as 20 to 40 bases. Deleting Rad1 did not affect the BIR efficiency or mismatch incorporation of mismatches on both evenly- and unevenly-mismatched donor templates (Fig 8A and 8B).

Fig 8

The mismatch assimilation of donor sequences does not depend on Rad1-Rad10 flap endonuclease.

A. The effect of deleting the 3′-flap endonuclease RAD1 or RAD10 on BIR efficiency for yRA253 with mismatches every 9th bp, and donor template E. Welch’s t-test was used to determine the p-value. Error bars refer to standard error of the mean. A minimum of at least five measurements were performed. B. The effect of deleting the 3′-flap endonuclease Rad1 or Rad10 on mismatch incorporation pattern for yRA253 (WT) with mismatches every 9th bp and donor template E. For all % mismatch incorporation data, a minimum of 40 samples were DNA sequenced.

Effect of Mph1 and Srs2 helicases on BIR with mismatched templates

In budding yeast, Mph1 is known to suppress BIR [41-43]. Previous in vitro studies suggested that Mph1 dissociates the invading strand of Rad51-generated D-loops or extended D-loops, possibly preventing inappropriate recombination or its resolution [44,45]. We confirmed that deleting Mph1 significantly increased the repair frequency by BIR (Fig 9A); however, there was no change in the pattern of incorporating mismatches into the BIR product (Fig 9B).

Fig 9

DNA helicase Mph1 suppresses BIR efficiency.

A. The effect of deleting the DNA helicase Mph1 on BIR efficiency for yRA280 and donor templates B and E. Welch’s t-test was used to determine the p-value. Error bars refer to standard error of the mean. A minimum of at least five measurements were performed. B. The effect of deleting Mph1 on mismatch incorporation pattern for yRA280, donor templates B and E. For all % mismatch incorporation data, a minimum of 40 samples were DNA sequenced.

Srs2 is another DNA helicase that dislodges Rad51 from ssDNA to prevent any promiscuous strand invasions [46-48]. Srs2 is known to play a pro-recombinogenic role in DSB repair pathways via HR [49]. Our previous study showed that 98% of srs2Δ cells resulted massive cell death despite of successful completion of DSB repair [50]; lethality was attributed to the incomplete unloading of recombination factors, allowing Rad51 and RPA to bind persistently to the ssDNA even after the completion of the repair [51,52]. Here, we tested the role of Srs2 in Rad51-mediated BIR during mitotic recombination. Consistent with previous observations, deleting Srs2 significantly reduced the repair efficiency (S7 Fig). This observation agrees with a previous study that Srs2 is required for bubble migration during BIR and deleting Srs2 promotes formation of toxic joint molecules from uncontrolled Rad51 binding to the intact donor, interfering with BIR completion [53].

Discussion

Although properties of budding yeast Rad51 have been well-studied in vitro [11,16,54,55], the ability of Rad51 to search and strand-invade donor sequences with mismatched sequences in vivo is not well understood. Here we have examined Rad51-dependent BIR where the 3’ invading end of DSB and its donor templates share 108-bp homology, each carrying 10 mismatches, but arranged in several different ways with a spacing of every 6th bp. Donor templates that clustered their mismatches near the 3’ end—where strand pairing must be accomplished before repair DNA synthesis can be initiated—were not less efficient in their repair compared to those with mismatches clustered at the 5’ end or in other arrangements. Indeed, three templates with at least 26 nt of perfect homology at the 3’ end were statistically significantly reduced in BIR. These results support in vitro studies that have suggested that Rad51-mediated pairing does not have to begin at the 3’ end [9,11,12,56,57]; but it is not clear why substrates with a well-matched 3’ end should be less efficient.

In the course of this work, we have resolved an apparent major difference in the measurement of tolerance of Rad51 for mismatched substrates in vitro versus in vivo. Previous in vitro studies had suggested that Rad51 was incapable of stably binding substrates in which there were fewer than 8 consecutive homologous base pairs [10,30,31], whereas in vivo we found significant levels of exchange when there are only 5 consecutive bases that can pair (every 6th base mismatched). A key difference between these findings is that Qi et al. [33] examined stable in vitro binding of a substrate that contained just a single tract of ≥ 8 base pairs of sequence homology, flanked by nonhomology, whereas the in vivo experiments presented in Anand et al. [17] and here, employed substrates that contained 18 tracts of 5 base pair homologies (i.e., 90 base pairs of total homology). Here, we show that Rad51, aided by Rad54, can indeed create stable D-loops in vitro with 90 or 108 nt ssDNA substrates in which every 6th base is mismatched (i.e., 75 or 90 base pairs of total homology, Fig 4A and 4D, respectively). Indeed, for templates containing only evenly-distributed mismatches, there is a very strong correlation (Pearson R2 = 0.99) between in vivo and in vitro results for Rad51-mediated strand exchange (Fig 4C). Thus, a key finding of this work is that stable strand pairing can take place both in vitro and in vivo with substrates containing multiple tracts with fewer than 8 consecutive bases. We note that one caveat in comparing the results presented here to those from previous in vitro studies is that Rad54 was included in our gel-based D-loop assays but was not present in the prior DNA curtain studies [33]. The formation of D-loops in our gel-based assay is dependent on the presence of Rad54, hence Rad54 is required to detect stable reaction products in these assays. In contrast, the prior DNA curtain study was intended to detect both transient and stable reaction intermediates on the path towards D-loop formation [33].

Our data lend some support to the hypothesis that the success of strand pairing depends on the total number of base pairs that can be formed, or–more precisely–to the total energy of base pairing that is achieved. Thus, among the set of 6 donors with different clustering of mismatches, those with a higher Tm tended to have higher BIR efficiencies. The relationship between template Tm is the same for the six unevenly-distributed donors compared to the evenly-distributed controls, but the set with clustered mismatches is repaired less efficiently. This downward shift is a feature of the in vivo process, as the In vitro analysis of these same templates shows a similar relationship between pairing efficiency and Tm but does not show a reduction of D-loop formation by unevenly-mismatched substrates relative to the evenly-matched controls (Fig 3C). A comparison of the data gathered in vitro and in vivo for the 6 unevenly-distributed substrates revealed that the two data sets are statistically significantly different. These results suggest that there are impediments to in vivo recombination compared to in vitro D-loop formation. It is, however, not yet evident why there is such a large range of outcomes for these different arrangements. It is possible that there is some sequence-specific secondary structure of the single-strand oligonucleotide but we have not been able to deduce such a motif. It is also unclear what enforces the reduced success of these templates in vivo, but it is independent of the Msh2 mismatch repair system that might promote heteroduplex rejection. It is possible that there is some specific mismatch or set of mismatches that either create some novel secondary structure or are recognized by a specific DNA binding protein.

Role of DNA polymerase δ in the incorporation of donor sequences into the BIR product

The second finding we draw from these experiments concerns the action of DNA polymerase δ and its 3’ to 5’ proofreading activity. The pattern of mismatch incorporation into the BIR product was the same at interior positions whether or not they were preceded by mismatches nearer the 3’ end; that is, DNA Pol δ still “backs up” with 3’→ 5’ exonuclease activity to incorporate mismatches even when the first 26 positions are completely homologous. Thus, proofreading at these interior positions is not dependent on any prior mismatch cues and suggests that Pol δ intrinsically backs up on DNA templates even when they are fully homologous. This activity is far more extensive than its action in removing a single mismatched base during DNA replication and is more comparable to the ability of Pol δ to excise a 3’-ended nonhomologous tail at the end of a DSB being repaired by gene conversion [54]; however, the pattern of mismatch assimilation is not compatible with an intermediate in which an entire unpaired mismatched end would be excised as a 3’ flap, such that the incorporation of mismatches would be the same at each position. Deletion of MSH2 or MLH1 had no significant effect on the repair outcome, nor did removal of the 3’ flap endonuclease, Rad1-Rad10.

It is not necessary that Pol δ removes 27 bases in a single encounter. It is possible that Pol δ removes only one or a few bases but does so in repeated encounters with the 3’ end before it initiates new DNA synthesis. Such a reiterative process could explain the surprising finding that pol3-01 does not impair the removal of the first base at the 3’ end of the invading strand while blocking the removal of mismatches further along. Although pol3-01 appears in vitro to be unable to excise a single mismatched base from a paired primer before new DNA synthesis is initiated [37], we entertain the idea that a small amount of residual 3’ to 5’ excision activity might remain and that multiple cycles of binding of Pol δ to the 3’ end might result in the removal of the most terminal mismatch. Alternatively, there may be another exo- or endonuclease activity that can accomplish this end-removal.

Methods

Yeast strains

yRA strains used in these experiments have the haploid S288c background (ho matΔ::hisG hmlΔ::hisG hmrΔ::ADE3 ura3Δ-851 trp1Δ-63 leu2Δ::KAN ade3::GAL10::HO), in which the site-specific HO endonuclease is under control of a galactose-inducible promoter [36]. Strain yRA111 contains the recipient sequences composed of the 5’ sequences of URA3 gene (UR), an artificially inserted split-intron with the splice donor site (5’ SD) and the HO recognition site (HOcs), located at the CAN1 locus in a non-essential terminal region of chromosome V [17]. Divergent donor sequences containing uneven distribution of mismatches were designed and ordered as synthetic gBlock gene fragments from IDT and assembled into pRS314-based (CEN4, TRP1) plasmid bRA29 containing the 3’ splice-acceptor (3’ SA) of the intron, the 3’ sequence from the URA3 gene (A3) and the TRP1 marker using in vivo recombination and plasmid rescue from a yeast host strain as described in Anand et al. [17]. The donor cassettes were PCR-amplified from plasmid bRA29 and integrated at the FAU1 locus, about 30 kb from the right end of on chromosome V. Further information for strains, recipients (donors) and plasmids are found in S1, S2, S3 and S4 Tables.

BIR assay

Selected strains were grown on YEPD (1% yeast extract, 2% bactopeptone, 2% dextrose) + ClonNAT (100uL/mL final concentration) at 30°C. Individual colonies from strains were picked and serially diluted 1000-fold in double-distilled H2O. Serial dilutions were plated on YEPD to obtain the total number of cells and on YEP-galactose (YEP-Gal) to measure the recombination-dependent survivors after inducing HO endonuclease expression [36]. Cells were incubated at 30°C for 2–3 days. Cells on YEP-Gal were then replica plated to plates lacking uracil, to count colonies that survived the break via BIR, and to Nourseothricin (NAT) plates, to count colonies which survived the break via nonhomologous end-joining (NHEJ) that alters the HO cleavage site but retains the distal part of the left arm of chromosome V [3]. Ura- NAT+ colonies, arising by nonhomologous end-joining, arose at a frequency of approximately 0.5% of the total number of colonies and are not reported for each assay.

DNA sequence analyses of the break repair junctions

Representative Ura+ colonies that had repaired by BIR were confirmed by PCR, using primers amplifying the region at the start and end of the URA3 gene using primers DG31 (GGAACGTGCTGCTACTCATC) and DG32 (TTGCTGGCCGCATCTTCTCA). PCR products were initially checked by gel electrophoresis and sent to GENEWIZ for Sanger sequencing. Individual PCR sequences were aligned with corresponding 108-bp donor templates and analyzed by DNA analyses software Serial Cloner 2.6.1 and Geneious Prime software.

Statistical analysis

GraphPad Prism 9 software was used to calculate statistical significance of data, based on Dunnett’s comparison of multiple samples versus a single control. Thermal stability, as reflected in melting temperature Tm (°C). of the base-pairing between the DSB 3’ and a complementary single strand of the donor template was determined using the method of Markham and Zuker (http://www.unafold.org/Dinamelt/applications/two-state-melting-hybridization.php) [37]. Statistical differences between in vivo and in vitro results for the six arrangements of mismatched bases (A though F) were determined by a Mann-Whitney test arbitrarily pairing each of 4 independent measurements of the in vivo set with the results of the in vitro set. By using Geneious Prime’s DNA secondary structure fold viewer (https://assets.geneious.com/manual/2021.1/static/GeneiousManualse36.html), we monitored possible secondary structures of the donor templates. ΔG of all donor templates were calculated to determine the energy required to break the secondary structure.

D-loop assays

D-loop assays using supercoiled plasmid and purified proteins were performed as previously described [58]. Recombinant yeast Rad51, Rad54, and RPA were expressed and purified as before [59]. 5’ fluorescently-labeled 90-nt or 108-nt ssDNA probes were ordered from IDT and gel-purified prior to use. Assays were started by first incubating 10 nM ssDNA with stoichiometric amount of Rad51 at 30°C for 15 min in reaction buffer containing 30 mM Tris-Acetate pH 7.5, 20 mM Mg-Acetate, 50 mM KCl, 0.1 mg/mL BSA, 1 mM DTT, and 5 mM ATP. The pre-formed Rad51 filaments were then mixed with 9.25 nM supercoiled (CURMID- Curtains Plasmid) plasmid [59] or pUC19_108 for 90mer or 108mer reactions, respectively), 750 nM RPA, and 95 nM Rad54 to initiate strand-exchange. Reactions were incubated at 30°C, stopped after 5 minutes by adding equal volumes of buffer containing 20% glycerol, 1% SDS, and 25 mM EDTA, and deproteinized with 1/10 volume of Proteinase K (NEB P8107S) at 37°C for 30 min. Reaction products were resolved on 0.9% TAE-agarose gel and scanned with a Typhoon FLA 9000 (GE Healthcare).

Rad51-mediated Break-Induced Replication.

A. Mechanism of Rad51-dependent BIR B. Mismatch incorporation of heteroduplex DNA formation during BIR. Once a DSB is created, a broken end of DSB will be resected by 5’→3’ exonuclease to generate 3’ single-stranded DNA (ssDNA) which interacts with Rad51 and other recombination proteins to carry out homology search and strand invasion. The resected end of recipient sequence (indicated in red) will synapse with the donor (indicated in blue). Mismatches in the heteroduplex region during strand invasion are apparently not corrected by the Msh2/Mlh1 mismatch repair complex; rather DNA polymerase δ is recruited to the 3’ end and performs its proofreading 3’→5’ exonuclease activity prior to initiating new DNA synthesis from the 3’ invading end. DNA Polymerase δ “can apparently “back up” into the heteroduplex region as far as 40–50 nt and resynthesizes the region, copying the donor template sequences into the recovered BIR product.

(TIFF)

Click here for additional data file.

The effect of MSH2 mutants on the repair efficiency.

Wild type and msh2Δ derivatives of each donor template were measured as described in Fig 1. Statistical significance of the differences for each donor/msh2Δ pair was determined using an unpaired t-test with Welch’s correction. Error bars refer to standard deviation. Each measurement is based on a minimum of three experiments.

(TIFF)

Click here for additional data file.

The mismatch assimilation of msh2Δ derivatives of donor templates with uneven mismatch distribution also does not proceed through Msh2-dependent mismatch repair.

The effect of deleting mismatch repair gene MSH2 on mismatch incorporation pattern and BIR efficiency for donor templates with uneven mismatch distribution. For all % mismatch incorporation data, a minimum of 40 samples were DNA sequenced.

(TIFF)

Click here for additional data file.

Differences in BIR efficiency for wild-type donor templates in relation to each other.

Donor template were compared among them to assess the statistical significance of different arrangements of clustered mismatches for BIR efficiency. Significance determined using a Tukey’s multiple comparison tests (GraphPad Prism 9). Error bars refer to standard deviation. ** p<0.001, ns = not significant. % BIR graph only indicated statistical significance and not included ns.

(TIFF)

Click here for additional data file.

Differences in BIR efficiency for msh2Δ derivatives of donor templates in relation to each other.

Each msh2Δ derivative of donor templates was compared between them to assess the statistical significance of different arrangements of clustered mismatches for BIR efficiency. Significance determined using a Tukey’s multiple comparison tests (GraphPad Prism 9). Error bars refer to standard deviation. ** p<0.001, ns = not significant. All data on % BIR graph for msh2Δ derivatives of donor templates were not significant when compared between them.

(TIFF)

Click here for additional data file.

BIR efficiency for pol3-01 mutants of donor templates with uneven mismatch distribution.

Percent BIR efficiency of donor templates A, B, D, and E with proofreading-defective DNA Polymerase δ mutant (pol3-01). Unpaired t-test with Welch’s correction was used to determine the p-value. Error bars indicate standard deviation.

(TIFF)

Click here for additional data file.

BIR efficiency for srs2Δ mutants.

Percent BIR efficiency of yRA280 and donor templates B and E with srs2Δ. Unpaired t-test with Welch’s correction was used to determine the p-value. Error bars indicate standard deviation.

(TIFF)

Click here for additional data file.

All of the data concerning the efficiency of BIR and the percent of mismatch incorporation in various mutant backgrounds are presented in the dataset.

(XLSX)

Click here for additional data file.

Yeast strains used in this study.

(DOCX)

Click here for additional data file.

Recipient and donor sequences.

(DOCX)

Click here for additional data file.

Primers used in this study.

(DOCX)

Click here for additional data file.

Plasmids used in this study.

(DOCX)

Click here for additional data file.

Sequences of 90-nt ssDNA containing evenly-distributed mismatches.

(DOCX)

Click here for additional data file.

28 Feb 2022

Dear Dr Haber,

Thank you very much for submitting your Research Article entitled 'Repair of Mismatched Templates during Rad51-dependent Break-Induced Replication' to PLOS Genetics.

The manuscript was fully evaluated at the editorial level and by three independent peer reviewers who are experts in the field. The reviewers appreciated the attention to an important problem, but raised some substantial concerns about the current manuscript. Based on the reviews, we will not be able to accept this version of the manuscript, but we would be willing to review a much-revised version. We cannot, of course, promise publication at that time.

Reviewer #1 is the most critical but all three reviewers point to lack of precision in the writing, an over-use of generalizations and a failure to consider alternative models.

Should you decide to revise the manuscript for further consideration here, your revisions should address the specific points made by each reviewer. We will also require a detailed list of your responses to the review comments and a description of the changes you have made in the manuscript.

If you decide to revise the manuscript for further consideration at PLOS Genetics, please aim to resubmit within the next 60 days, unless it will take extra time to address the concerns of the reviewers, in which case we would appreciate an expected resubmission date by email to plosgenetics@plos.org.

If present, accompanying reviewer attachments are included with this email; please notify the journal office if any appear to be missing. They will also be available for download from the link below. You can use this link to log into the system when you are ready to submit a revised version, having first consulted our Submission Checklist.

To enhance the reproducibility of your results, we recommend that you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. Additionally, PLOS ONE offers an option to publish peer-reviewed clinical study protocols. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols

Please be aware that our data availability policy requires that all numerical data underlying graphs or summary statistics are included with the submission, and you will need to provide this upon resubmission if not already present. In addition, we do not permit the inclusion of phrases such as "data not shown" or "unpublished results" in manuscripts. All points should be backed up by data provided with the submission.

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool.  PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org.

PLOS has incorporated Similarity Check, powered by iThenticate, into its journal-wide submission system in order to screen submitted content for originality before publication. Each PLOS journal undertakes screening on a proportion of submitted articles. You will be contacted if needed following the screening process.

To resubmit, use the link below and 'Revise Submission' in the 'Submissions Needing Revision' folder.

[LINK]

We are sorry that we cannot be more positive about your manuscript at this stage. Please do not hesitate to contact us if you have any concerns or questions.

Yours sincerely,

Gregory P. Copenhaver

Editor-in-Chief

PLOS Genetics

Gregory Barsh

Editor-in-Chief

PLOS Genetics

Reviewer's Responses to Questions

Comments to the Authors:

Please note here if the review is uploaded as an attachment.

Reviewer #1: This manuscript will be of interest for researchers in the area of genome stability and mechanisms of homology-directed DNA repair. The study follows an earlier high-profile paper (Anand et al. 2017 Nature), where the Haber laboratory identified an astounding mismatch tolerance of Rad51-mediated break-induced replication. Here, the authors conduct careful analysis of additional mismatched constructs that test hypotheses that length and position of uninterrupted homology affect mismatch tolerance. The analyses are conducted in wild type and mismatch repair-deficient strains disabling mismatch recognition (msh2) and mismatch processing (mlh1). Sequence analysis of individual recombinants is used to assess the correction of the mispairs formed during strand invasion. The experiments are well designed and executed, but the results limit potential conclusions, and the work does not generate novel insights. A number of the conclusions appear overly generalized and do not consider the unusual properties of the system used here. In particular, the main conclusion that the exonuclease activity of DNA polymerase delta can chew back for 26 nt without mismatch cues is overstated and an alternative model of reiterative invasion and chew-back should be considered and experimentally tested.

Major comments:

1) In the introduction (line 77 ff), the authors discuss the properties of their assay system and correctly point out that it is above the minimal homology requirement for recombination in yeast. However, the authors should also discuss the differences to system with longer homology and infinite homology, as it would be the case for allelic HR between sisters/homologs. In other words, the authors should acknowledge the limitations of the system sharing only 108 bp homology. Moreover, the authors assume that the D-loops in their study are uniform in structure and length, all invading with their 3’-end, although it is currently not possible to analyze these D-loop properties in vivo. Furthermore, the authors neglect to discuss discrepancies between their findings and other published studies. Guo et al. 2017 Mol Cell conducted a similar study with dramatically different conclusions as to the role of Pol delta in 3’ mismatch correction. A discussion of this study and other similar studies should be included to contextualize the findings presented in Choi et al. in the broader HR field.

2) Figure 2 and lines 82, 83, and throughout: “approximately 14% of cells successfully repaired a DSB when the homologous region is 108 bp”, this value differs from what is shown in Figure 2B, which shows ~8-9% of cells repairing by BIR. The text should be corrected to reflect the data reported in the figure.

3) Figure 2 and lines 87-90, 129, 130: “Repair efficiency was significantly reduced but still significant when every 6th base was mismatched”; the authors should reference Figure 2B. Furthermore, it is debatable whether a repair event observed in only 1-2% of the population is “significant.” The authors should give the actual percent of cells completing repair. Considering repair is almost negligible in this system when every 6th bp is mismatched, it is misleading to claim that their in vivo results differ from results obtained by in vitro studies.

4) Figure 2 and Line 101: “but exhibit significant differences that depend on the precise location of the mismatches”; not all the differences are significant, and the authors fail to interpret their findings in a way that makes a convincing argument that the position of the mismatches influences the outcome in a predictable or logical manner. The results simply do not lend themselves to making significant conclusions about position of uninterrupted homology.

5) Figure 3 and lines 157-161: msh2 clearly effects the efficiency of BIR in a substrate-dependent manner according to Figures 3 and S2. The perfectly matched donor (yRA253) shows decreased BIR in the msh2 background. However, the donor with every 6th bp mismatched (yRA321) shows somewhat increased BIR in the msh2 background. Furthermore, the substrates with 3’ mismatches (‘B’), with mismatches in the middle of the donor (‘E’), and with mismatches at the 5’ end and in the middle of the donor (‘F’) also have slightly increased BIR in the msh2 background. In addition, the slope of the line in Figure 3B flattens relative to Figure 3A. This indicates that while msh2 does not fully suppress the differences between the evenly-spaced mismatches and the unevenly-spaces mismatches, at least some of the differences are partially suppressed. The authors need to revise these lines to better fit their findings.

6) Figures 4, 5 and Lines 108-111, 166-168, 232, 233: The authors could have made this point more convincingly by using the pol3-5DV mutant, as in Anand et al. 2017 and Guo et al. 2017 Mol Cell. Moreover, though the authors’ results on Pol delta’s proofreading activity differ significantly from the findings in Guo et al., the authors do not cite or discuss this paper in the text.

The effects of msh2 and mhl1 demonstrated in Figure 5 are neither acknowledged nor discussed. Lines 189, 190 should be repharsed and expanded.

7) The major conclusion of the manuscript is that DNA polymerase delta exonuclease can chew back 26 nt with mismatch clues. This conclusion is not well supported by the analysis. Can the authors exclude alternative mechanisms or models? Is it possible that 3’-flappases like Rad1-Rad10 or Mus810-Mms4 play a role? Is it possible that he results are a reflection of reiterative cycles of invasion, chew-back and D-loop dissolution? This would be consistent with the expected instability of the short D-loop, the evidence for reiterative invasion cycles and the known proofreading window for Pol delta exo, which is significantly smaller than 26 nt. Moreover, this would be more consistent with the previous analysis by Guo et al. This possibility should be explored using mutants that limit D-loop dissolution (srs2, mph1, sgs1), and the results may drastically change the major conclusion.

Additional comments:

8) Figure 1, Table 1: Is pairing possible between the UR of the assay system and ura-3D851, also present in these strains? This could significantly influence the interpretation of the results. Even if there is no homology, the authors may want to state this clearly.

9) Lines 54-57: NHEJ and alt-EJ are generally considered distinct pathways for DNA damage repair/tolerance.

10) Lines 59, 60: Single-strand annealing (SSA) is a homology-directed repair pathway but not typically considered an HR sub-pathway. The discussion of DNA damage repair/tolerance pathways and HR sub-pathways could be re-written and expanded to include more relevant details.

11) Lines 64-72: The description of BIR includes certain very specific details while glossing over other key steps (e.g. Rad51 mediators and accessory factors, Pol32 requirement). The description of BIR could be revised to include only the steps that are relevant to understanding the findings presented in this paper, and should be congruent with the diagram in Figure S1 (e.g. Rad52 is shown in the Figure but not discussed in the text).

12) Lines 78, 79: Both ends of the break do not necessarily interact with the donor during SDSA,

13) Line 111: “There was little effect when Msh2/Mlh1-dependent mismatch repair was ablated”; the results presented in Figure 3 indicate that there is an effect of msh2.

14) Lines 130, 131: “BIR…still occurred about 9% in yRA321”, this makes it sound as though 9% of the population completes repair by BIR with the yRA321 substrate, when in fact BIR is reduced to 9% of the level observed in yRA280. 9% repair by BIR would be a significant level of repair, but 1-2% repair is not necessarily significant. The authors need to clarify their results so as not to mislead the reader.

15) Lines 168,169: The authors should cite Guo et al. 2017 Mol Cell.

16) Lines 225-228: “Indeed, deleting Msh2 led to an overall reduction in repair efficiency for both the evenly- and unevenly-spaced templates,” this statement is not quite correct based on their own results in Figures 3B and S2. BIR efficiency increased in the msh2 background for some of the mismatched donors, whether the donors had evenly spaced mismatches (yRA321) or unevenly spaced mismatches (‘A’, ‘E’, and ‘F’).

17) Figures 2, 3: Why is the color indicating construct ‘A’ different between figures? The color representing ‘A’ should be consistent.

18) Table 1: Generally, ‘::’ denotes that a gene has been deleted and replaced with another marker. Thus, while I infer that “can1DEL::UR intron_SD::HOcs::NAT” is the site of the DSB in their assay system, it might be more appropriate to write this as “can1::UR intron-SD-HOcs-NAT”. This is especially confusing considering another maker present in these strains is HOcs::hisG. In this case, I infer that the HOcs at its native locus has been deleted, but given the annotation of the assay system HOcs, it is unclear whether this is the case.

Reviewer #2: Please see the attachment

Reviewer #3: In the reviewed manuscript entitled “Repair of Mismatched Templates during Rad51-dependent Break-Induced Replication” the authors presented the results of their studies on the efficiency of break-induced replication (BIR), the homologous recombination subpathway. In their study they explored the influence of mismatches distribution in a donor template on the final repair product. By examining different templates containing the same number of mismatches but distributed unevenly, they were able to show the polar effect of insertion of the donor sequence into the final repair product. The mismatches located at the 3’ end of the invading strand were commonly replaced by the template sequence, but this tendency was gradually limited, and about 40 bp from the 3’ end, incorporation of the template sequence was rare. According to the authors, this effect was linked to the 3’-5’ exonucleolytic (proofreading) activity of polymerase δ, synthesizing DNA during repair; however, it had nothing to do with the proofreading activity per se, since 3’-5’ exonucleolytic activity was observed independently of mismatches presence or absence in the sequence. Authors call this activity “chewing back” the 3’ end of invading strand and claim that this step precedes the initiation of DNA synthesis using the donor template. Thus, the additional step during the initiation of BIR was recognized. The finding that donor strand undergoes resection is important; however, an indication of which enzyme is responsible for its processing is still open. The authors did not prove that, so they should moderate their statement and include alternative scenarios in the text or make a similar set of experiments as they described, using a set of strains with a polymerase variant impaired in proofreading activity. In the previous works, the researchers from the same laboratory showed that it is possibly not Exo1 activity; however, yeast Saccharomyces cerevisiae possesses broader resources of 3’-5’ exonucleases that should be considered.

Interestingly, one of the findings is that the Msh2-dependent mismatch repair system seems not to contribute to BIR even when mismatches are present in the duplex created by the acceptor and donor strand. Presented data contribute to our understanding of the recombination process. However, the results of this study also underlined the differences between results obtained in the in vitro ad in vivo studies and showed that the model used to reveal the mechanism of recombination could influence the results by the length and sequence of the homologous region used in the attempt.

The data obtained by the authors brought us closer to solving the complicated puzzle of the homologous recombination process, whose final effect is enzyme- and template-dependent.

**********

Have all data underlying the figures and results presented in the manuscript been provided?

Large-scale datasets should be made available via a public repository as described in the PLOS Genetics data availability policy, and numerical data that underlies graphs or summary statistics should be provided in spreadsheet form as supporting information.

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: Yes

**********

PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: No

Reviewer #3: No

Submitted filename: review_Choi_et_al.pdf

Click here for additional data file.

6 Jul 2022

Submitted filename: Response to Reviewers Comments_JC_BIR_2022_final_submit.docx

Click here for additional data file.

27 Jul 2022

Dear Jim,

Thank you very much for submitting your Research Article entitled 'Repair of Mismatched Templates during Rad51-dependent Break-Induced Replication' to PLOS Genetics.

The manuscript was fully evaluated at the editorial level and all 3 of the original independent peer reviewers. Reviewers #1 and #3 are now satisfied, but Reviewer #2 has a list of minor concerns that should be addressed.  Once I receive your revised manuscript I will be able to render and editorial decision without further external review.

We therefore ask you to modify the manuscript according to the review recommendations. Your revisions should address the specific points made by each reviewer.

In addition we ask that you:

1) Provide a detailed list of your responses to the review comments and a description of the changes you have made in the manuscript.

2) Upload a Striking Image with a corresponding caption to accompany your manuscript if one is available (either a new image or an existing one from within your manuscript). If this image is judged to be suitable, it may be featured on our website. Images should ideally be high resolution, eye-catching, single panel square images. For examples, please browse our archive. If your image is from someone other than yourself, please ensure that the artist has read and agreed to the terms and conditions of the Creative Commons Attribution License. Note: we cannot publish copyrighted images.

We hope to receive your revised manuscript within the next 30 days. If you anticipate any delay in its return, we would ask you to let us know the expected resubmission date by email to plosgenetics@plos.org.

If present, accompanying reviewer attachments should be included with this email; please notify the journal office if any appear to be missing. They will also be available for download from the link below. You can use this link to log into the system when you are ready to submit a revised version, having first consulted our Submission Checklist.

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org.

Please be aware that our data availability policy requires that all numerical data underlying graphs or summary statistics are included with the submission, and you will need to provide this upon resubmission if not already present. In addition, we do not permit the inclusion of phrases such as "data not shown" or "unpublished results" in manuscripts. All points should be backed up by data provided with the submission.

To enhance the reproducibility of your results, we recommend that you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. Additionally, PLOS ONE offers an option to publish peer-reviewed clinical study protocols. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols

Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article’s retracted status in the References list and also include a citation and full reference for the retraction notice.

PLOS has incorporated Similarity Check, powered by iThenticate, into its journal-wide submission system in order to screen submitted content for originality before publication. Each PLOS journal undertakes screening on a proportion of submitted articles. You will be contacted if needed following the screening process.

To resubmit, you will need to go to the link below and 'Revise Submission' in the 'Submissions Needing Revision' folder.

[LINK]

Please let us know if you have any questions while making these revisions.

Yours sincerely,

Gregory P. Copenhaver

Editor-in-Chief

PLOS Genetics

Gregory Barsh

Editor-in-Chief

PLOS Genetics

Reviewer's Responses to Questions

Comments to the Authors:

Please note here if the review is uploaded as an attachment.

Reviewer #1: Manuscript Title: Repair of Mismatched Templates during Rad51-dependent Break-Induced Replication revised

Authors:

Jihyun Choi; …… James E. Haber

The revised manuscript is significantly improved and addresses the concerns of the review. Moreover, the authors included data from Eric Greene’s laboratory to largely resolve the conflict between in vivo and in vitro data regarding mismatch tolerance.

Reviewer #2: Presented revised manuscript contains two sets of new results:

• analysis of pol3-01 mutant demonstrating that it is indeed the exonuclease activity of DNA polymerase delta that is responsible for extensive substrate degradation even when no mismatches are present

• in vitro D-loop assays with evenly and unevenly mismatched templates that complement presented data on the effect of mismatches on BIR in vivo

These are very valuable inclusions that greatly enhance the value of this manuscript.

However, some general conclusions are made based only on the subset of presented data and discussion of unexpected findings is very brief.

Comment 1. Generalized conclusions, understatements based on a subset of presented data. These can be very misleading to the reader.

line 23 These different arrangements of uneven mismatch distributions were in general less efficient in recombination than templates with evenly distributed mismatches.

2 (B, C) out of 6 were not less efficient, they were as efficient as evenly-spaced control.

The Authors acknowledge that

line 29 mismatch position-specific effects are also important

but continue to generalize without making reservations about B and C (also lines 235, 345, maybe others), and such imprecise statement will remain as take home message from this paper.

line 25 A donor with all 10 mismatches clustered at the 3’ invading end of the DSB was not impaired compared to arrangements where mismatches were clustered at the 5’ end.

Understatement, donor B was not impaired not only when compared to donor D (which was one of 4 impaired as compared to the evenly-spaced control), but also when compared to the evenly-spaced control itself.

line 214 (also line 347) But unlike the results in vivo, there was no general reduction in product formation compared to the evenly-distributed controls in the in vitro assays.

Understatement, in fact BIR efficiency was increased for 4 out of 6 substrates, same for C and lower for E. No statistical significance shown for in vitro data (such as seen for in vivo BIR in Fig2C).

line 228 In general, the efficiency of BIR was lower in the absence of Msh2 and line 235 We conclude that there is some other factor beyond the mismatch repair machinery that causes the unevenly distributed mismatches to be less successful in BIR than the evenly-distributed controls

Both relate to the Authors previous response to Rev 1 comment 16.

I agree WT and delmsh2 sets may be different, but if so why the conclusion is that the difference is mediated by other factors than Msh2?

I am not convinced it is appropriate to describe data presented in Fig. S2 (as well as other data in this manuscript, as mentioned above) in terms of “data as a whole” or „in general”.

This obscures a fact that some donors with unevenly-spaced mismatches do appear to behave in a different, difficult to explain but, in my opinion, potentially very interesting way.

Comment 2.

line 282 ...cells lacking MLH1 or MSH2 still can extend and correct mismatches >30 bp from the 3’ invading end of the DSB...

Is the drop to 60% for incorporation of first mismatch for template A in delmsh2 meaningful?

Comment 3.

line 293 Deleting Rad1 did not affect the BIR efficiency or mismatch incorporation of mismatches on both evenly- and unevenly-mismatched donor templates.

Generalisation based on one unevenly-mismatched donor. Why yRA275 and not yRA280 was used as evenly spaced control? Why E was chosen? It would be interesting to see if first mismatch is affected in donor A (as examined for MSH2) or B (as examined for MPH1).

Same representative subset of substrates should be examined for all mutants tested and their choice explained.

Comment 4.

line 293 This observation agrees with a previous study that Srs2 is required for bubble migration during BIR and deleting Srs2 promotes formation of toxic joint molecules from uncontrolled Rad51 binding to the intact donor, interfering with BIR completion.

Presented data do not relate to the mechanism of Srs2 activity. They show that in delsrs2 the frequency of BIR is too low to assess the effect of this helicase on BIR with mismatched templates.

Comment 5.

line 322 These results support in vitro studies that have suggested that Rad51-mediated pairing does not have to begin at the 3’ end (9, 11, 12, 55, 56), but it is not clear why substrates with a well matched 3’ end should be less efficient.

Perhaps it is not that well matched 3' end is less efficient but that less matched further regions (that arise if mismatches are clustered away from 3'end) are important in vivo. This would be an important phenomenon that failed to be captured by in vitro assays.

Comment 6.

line 326 Previous in vitro studies had suggested that Rad51 was incapable of stably binding substrates in which there were fewer than 8 consecutive homologous base pairs....

and line 334 Here, we show that Rad51, aided by Rad54, can indeed create stable D-loops in vitro with 90 or 108 nt ssDNA substrates in which every 6th base is mismatched.....

Was Rad54 included in earlier cited in vitro studies? If not this would be another difference between previous and current work that should be discussed.

Comment 7.

line 178 The differences among these templates cannot be attributed to a difference in thermal stability of base-pairing in the 108-bp region as measured by the calculated melting temperature (Tm) between complementary 108-nt DNA strands.... Interestingly, the slopes of the linear regression lines were nearly identical for the evenly- distributed controls .... as for the 6 unevenly spaced cases .... but the unevenly-distributed series lie below the controls.

Description of data presented in Fig.3 is very brief and it is not apparent how the Authors reach and what they mean (with respect to mismatched templates that are examined in this work) by the general conclusion presented in the Discussion :

line 341 Our data lend some support to the hypothesis that the success of strand pairing depends on the total number of base pairs that can be formed, or – more precisely – to the total energy of base pairing that is achieved.

Comment 8.

line 341 It is also unclear what enforces the reduced success of these templates in vivo...

This is a very interesting finding that perhaps warrants further discussion. Other helicases, chromatin factors that could play a role and be examined in the future?

Comment 9.

Discussion of another very interesting result is also brief.

line 380 ... we entertain the idea that a small amount of residual 3’ to 5’ excision activity might remain...

On what basis?

line 383 ....there may be another activity that can accomplish this end-removal.

Such as what?

Comment 10.

line 132 ....but, unexpectedly, donor templates with majority of mismatches towards the 5’ end were statistically significantly lower than the evenly-distributed control.

Unclear, needs rephrasing.

Reviewer #3: In the revised version of the article, the Authors addressed all my comments and suggestions, therefore the manuscript is now suitable for publication.

**********

Have all data underlying the figures and results presented in the manuscript been provided?

Large-scale datasets should be made available via a public repository as described in the PLOS Genetics data availability policy, and numerical data that underlies graphs or summary statistics should be provided in spreadsheet form as supporting information.

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: Yes

**********

PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: No

Reviewer #3: Yes: Adrianna Skoneczna

2 Aug 2022

Submitted filename: Responses to Reviewers_JC_BIR_2022.docx

Click here for additional data file.

10 Aug 2022

Dear Dr Haber,

We are pleased to inform you that your manuscript entitled "Repair of Mismatched Templates during Rad51-dependent Break-Induced Replication" has been editorially accepted for publication in PLOS Genetics. Congratulations!

Before your submission can be formally accepted and sent to production you will need to complete our formatting changes, which you will receive in a follow up email. Please be aware that it may take several days for you to receive this email; during this time no action is required by you. Please note: the accept date on your published article will reflect the date of this provisional acceptance, but your manuscript will not be scheduled for publication until the required changes have been made.

Once your paper is formally accepted, an uncorrected proof of your manuscript will be published online ahead of the final version, unless you’ve already opted out via the online submission form. If, for any reason, you do not want an earlier version of your manuscript published online or are unsure if you have already indicated as such, please let the journal staff know immediately at plosgenetics@plos.org.

In the meantime, please log into Editorial Manager at https://www.editorialmanager.com/pgenetics/, click the "Update My Information" link at the top of the page, and update your user information to ensure an efficient production and billing process. Note that PLOS requires an ORCID iD for all corresponding authors. Therefore, please ensure that you have an ORCID iD and that it is validated in Editorial Manager. To do this, go to ‘Update my Information’ (in the upper left-hand corner of the main menu), and click on the Fetch/Validate link next to the ORCID field.  This will take you to the ORCID site and allow you to create a new iD or authenticate a pre-existing iD in Editorial Manager.

If you have a press-related query, or would like to know about making your underlying data available (as you will be aware, this is required for publication), please see the end of this email. If your institution or institutions have a press office, please notify them about your upcoming article at this point, to enable them to help maximise its impact. Inform journal staff as soon as possible if you are preparing a press release for your article and need a publication date.

Thank you again for supporting open-access publishing; we are looking forward to publishing your work in PLOS Genetics!

Yours sincerely,

Gregory P. Copenhaver

Editor-in-Chief

PLOS Genetics

Gregory Barsh

Editor-in-Chief

PLOS Genetics

www.plosgenetics.org

Twitter: @PLOSGenetics

----------------------------------------------------

Comments from the reviewers (if applicable):

----------------------------------------------------

Data Deposition

If you have submitted a Research Article or Front Matter that has associated data that are not suitable for deposition in a subject-specific public repository (such as GenBank or ArrayExpress), one way to make that data available is to deposit it in the Dryad Digital Repository. As you may recall, we ask all authors to agree to make data available; this is one way to achieve that. A full list of recommended repositories can be found on our website.

The following link will take you to the Dryad record for your article, so you won't have to re‐enter its bibliographic information, and can upload your files directly:

http://datadryad.org/submit?journalID=pgenetics&manu=PGENETICS-D-22-00123R2

More information about depositing data in Dryad is available at http://www.datadryad.org/depositing. If you experience any difficulties in submitting your data, please contact help@datadryad.org for support.

Additionally, please be aware that our data availability policy requires that all numerical data underlying display items are included with the submission, and you will need to provide this before we can formally accept your manuscript, if not already present.

----------------------------------------------------

Press Queries

If you or your institution will be preparing press materials for this manuscript, or if you need to know your paper's publication date for media purposes, please inform the journal staff as soon as possible so that your submission can be scheduled accordingly. Your manuscript will remain under a strict press embargo until the publication date and time. This means an early version of your manuscript will not be published ahead of your final version. PLOS Genetics may also choose to issue a press release for your article. If there's anything the journal should know or you'd like more information, please get in touch via plosgenetics@plos.org.

27 Aug 2022

PGENETICS-D-22-00123R2

Repair of Mismatched Templates during Rad51-dependent Break-Induced Replication

Dear Dr Haber,

We are pleased to inform you that your manuscript entitled "Repair of Mismatched Templates during Rad51-dependent Break-Induced Replication" has been formally accepted for publication in PLOS Genetics! Your manuscript is now with our production department and you will be notified of the publication date in due course.

The corresponding author will soon be receiving a typeset proof for review, to ensure errors have not been introduced during production. Please review the PDF proof of your manuscript carefully, as this is the last chance to correct any errors. Please note that major changes, or those which affect the scientific understanding of the work, will likely cause delays to the publication date of your manuscript.

Soon after your final files are uploaded, unless you have opted out or your manuscript is a front-matter piece, the early version of your manuscript will be published online. The date of the early version will be your article's publication date. The final article will be published to the same URL, and all versions of the paper will be accessible to readers.

Thank you again for supporting PLOS Genetics and open-access publishing. We are looking forward to publishing your work!

With kind regards,

Agnes Pap

PLOS Genetics

On behalf of:

The PLOS Genetics Team

Carlyle House, Carlyle Road, Cambridge CB4 3DN | United Kingdom

plosgenetics@plos.org | +44 (0) 1223-442823

plosgenetics.org | Twitter: @PLOSGenetics