Literature DB >> 33170886

Calcium salts of long-chain fatty acids from linseed oil decrease methane production by altering the rumen microbiome in vitro.

Yoshiaki Sato1, Kento Tominaga2, Hirotatsu Aoki1, Masayuki Murayama3, Kazato Oishi1, Hiroyuki Hirooka1, Takashi Yoshida2, Hajime Kumagai1.   

Abstract

Calcium salts of long-chain fatty acids (CSFA) from linseed oil have the potential to reduce methane (CH4) production from ruminants; however, there is little information on the effect of supplementary CSFA on rumen microbiome as well as CH4 production. The aim of the present study was to evaluate the effects of supplementary CSFA on ruminal fermentation, digestibility, CH4 production, and rumen microbiome in vitro. We compared five treatments: three CSFA concentrations-0% (CON), 2.25% (FAL) and 4.50% (FAH) on a dry matter (DM) basis-15 mM of fumarate (FUM), and 20 mg/kg DM of monensin (MON). The results showed that the proportions of propionate in FAL, FAH, FUM, and MON were increased, compared with CON (P < 0.05). Although DM and neutral detergent fiber expressed exclusive of residual ash (NDFom) digestibility decreased in FAL and FAH compared to those in CON (P < 0.05), DM digestibility-adjusted CH4 production in FAL and FAH was reduced by 38.2% and 63.0%, respectively, compared with that in CON (P < 0.05). The genera Ruminobacter, Succinivibrio, Succiniclasticum, Streptococcus, Selenomonas.1, and Megasphaera, which are related to propionate production, were increased (P < 0.05), while Methanobrevibacter and protozoa counts, which are associated with CH4 production, were decreased in FAH, compared with CON (P < 0.05). The results suggested that the inclusion of CSFA significantly changed the rumen microbiome, leading to the acceleration of propionate production and the reduction of CH4 production. In conclusion, although further in vivo study is needed to evaluate the reduction effect on rumen CH4 production, CSFA may be a promising candidate for reduction of CH4 emission from ruminants.

Entities:  

Year:  2020        PMID: 33170886      PMCID: PMC7654805          DOI: 10.1371/journal.pone.0242158

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

Methane (CH4) is an important global greenhouse gas because it has a global warming potential 28 times as strong as that of carbon dioxide (CO2) over a 100 years timeframe [1]. Livestock are the largest emitter of anthropogenic CH4 and the global emission of CH4 from livestock production was estimated as 195 Tg/year in 2003–2012 [2]; CH4 released from enteric fermentation of ruminants accounts for 39% of CH4 from livestock sector [3]. Methane is the end product of anaerobic fermentation in the digestive process of ruminants, contributing an energetic loss of 2–12% of the gross energy [4]. Therefore, mitigating enteric CH4 emission from ruminants is required not only for reducing the environmental load but for improving the efficiency of animal production. Dietary supplementation of lipids or independent fatty acids (FA) is one of the feasible feeding strategies to mitigate enteric CH4 emission from ruminants [5-7]. Beauchemin et al. [5], through a meta-analysis, demonstrated that CH4 production from ruminants was decreased by 5.6% with each 1% addition of supplemental fat. Among fats, polyunsaturated fatty acids (PUFA) are especially able to depress ruminal methanogenesis. Martin et al. [8] demonstrated that a 5.7% supply of linseed oil that includes a high proportion of PUFA significantly reduced CH4 emitted from dairy cows by 64% in vivo. The reduction of enteric CH4 production from ruminants in response to dietary fats or FA is due to their toxic effects against a wide variety of rumen microorganisms, including bacteria, protozoa, archaea, and fungi [9-13]. However, dietary lipids or FA also cause the reduction of other traits such as dry matter (DM) intake and nutrient digestibility [6, 8, 10], as well as CH4 production. Calcium salts of long-chain fatty acids (CSFA) have been widely used in dairy and beef production as a rumen-protected fat in practical farm conditions [14, 15]. Although dietary unprotected lipids significantly inhibit rumen microorganism activity, CSFA prevents problems related to rumen microbial fermentation and digestion. [14]. As a result, dietary CSFA have generally no or little adverse effect on nutrient digestibility in ruminants [15-20]. Furthermore, CSFA partially escapes biohydrogeneration (BH) of fatty acids by rumen microbes. Wu et al. [21] reported that net BH of total unsaturated C18 in diets with added CSFA and animal-vegetable blend fat were 57.3% and 87.2%, respectively, in dairy cows. Therefore, dietary CSFA can effectively increase unsaturated fatty acids contents in cow’s lower digestive tract, increasing meat quality such as linoleic acid concentration [15], and milk yield and quality [19, 20, 22]. Recently, the effect of CSFA on CH4 production emitted from ruminants has attracted considerable interest. For example, Kliem et al. [23] reported that diets with the addition of 2.2 g oil/kg DM as CSFA from palm and linseed oil decreased CH4 production in dairy cows. This is probably because unsaturated fatty acids in CSFA were not completely protected from dissociation [24], and were slowly released as free fatty acids in the rumen, influencing rumen microorganisms involved in CH4 production. Nevertheless, the effects of CSFA on rumen microbiome have been little reported, and the impact of graded level of dietary CSFA on rumen CH4 production is unclear. Therefore, the objective of the present study was to evaluate the effects of supplementary CSFA on in vitro ruminal fermentation, digestibility, CH4 production and ruminal microbiome by comparing with those of fumarate and monensin that are major inhibitors of enteric CH4 emission from ruminants [25-28]. In the present study, we hypothesize that the FA may be gradually released from CSFA in the rumen and alter the microbiome, inhibiting CH4 production with little negative effect on rumen fermentation.

Materials and methods

The experiment was approved by the Kyoto University Animal Ethics Committee (Permit Number: 31–33) and performed at the Graduate school of Agriculture, Kyoto University from July to August 2019. The CSFA used in the present study was received from Taiyo Yushi Corp., a Japanese commercial chemical manufacturer. The product contained 56.7% linseed oil and 27.6% silica gel as the fatty acids absorbent. The molar ratio of FA to calcium in CSFA was adjusted to 2.8. The FA were constituted with 5.5% palmitic acid (C16:0), 0.1% palmitoleic acid (C16:1), 3.3% stearic acid (C18:0), 18.2% oleic acid (C18:1), 15.6% linoleic acid (C18:2), 56.8% α-linolenic acid (C18:3) and 0.5% other fatty acids. Rolled barley was used as a substrate in the study. The substrate was ground in a Wiley mill to pass a 1 mm screen before use.

Experimental design

The following five treatments (FAL, FAH, FUM, MOM, and CON) were used in the experiments. CSFA was supplemented at 2.25% DM and 4.50% DM of the substrate—namely FAL and FAH, respectively. Based on the linseed oil concentration of the CSFA used in this study, the linseed oil concentration in FAL and FAH were 1.5% and 3.0%, respectively. Fumarate was added to a final concentration of 15 mM (FUM). One treatment received monensin at 20 mg/kg DM of the substrate (MOM). The doses of fumarate and monensin were determined based on Shirohi et al. [29] and Joyner et al. [30]. The control treatment (CON) contained only substrate. Monensin was dissolved in ethanol before adding to test tubes in MON. Therefore, an equal volume of ethanol, 14.9 μL, was added into the other test tubes.

Animals, diets, and feeding

Two ruminal-cannulated Corridale wethers with initial body weight (BW) of 58.6 ± 6.2 kg (mean ± SD) were used. The animals fed on ryegrass straw and concentrate at a ratio of 30:70 on a DM basis for 23 days. The amount of total diets provided was 2% of BW on a fresh matter (FM) basis in two equal portions daily, at 08:30 and 17:00. The ingredient compositions of the concentrate were as follows: 35.2% rice bran, 54.0% rolled barley, 6.9% alfalfa meal, 3.4% soybean meal, and 0.6% vitamin-mineral premix on a DM basis calculated using Standard Tables of Feed Composition in Japan [31]. Mineral blocks and water were offered ad libitum.

Procedure of in vitro experiment

On day 24, about 200 mL ruminal fluid was collected through the rumen cannula from each wether before morning feeding and was transferred to the laboratory within 30 min. The sample was filtered through four layers of cheesecloth. Subsequently, the two strained liquids were mixed equally. The filtered sample were mixed with artificial saliva [32] in a ratio of 1:4 under anaerobic condition. The artificial saliva was sterilized by autoclaving and made anaerobic by a CO2 flushing before mixing. A 40 mL mixture was transferred to each test tube containing 0.5 g DM of rolled barley and respective feed additives. The test tube was closed with a silicone rubber stopper fitted with a plastic syringe [33] to collect fermentation gas and incubated at 39°C for 48 h. Each treatment was set up in three replicates. During incubation, the total cumulative gas production at 0, 3, 6, 9, 12, 18, 24, 30, 36, 42, and 48 h, and CH4 and CO2 production at 12 and 24 h were measured. After incubation, test tubes were placed in ice-cold water to stop fermentation and immediately analyzed for pH using a pH meter (Horiba Ltd., Kyoto, Japan). Next, 1.5 mL of culture was subsampled for microbiome analysis and stored at -80°C until further use. A 0.5 mL of the culture was mixed with 4.5 mL methyl green formalin sodium chlorate (MFS) solution for protozoa count [34]. All of the remaining culture was then centrifuged at 500 × g for 5 min to separate the residue and supernatant. The supernatant was mixed with 25% (w/v) meta-phosphoric acid at a 5:1 ratio and stored at -20°C until the analyses of volatile fatty acids (VFA) and ammonia nitrogen (NH3-N) concentrations. The residue was transferred to a nylon bag to determine the digestibility of DM and neutral detergent fiber expressed exclusive of residual ash (NDFom).

Chemical analyses

DM, crude protein (CP), ether extract (EE), and crude ash contents of the feeds and substrate were analyzed according to the standards of the Association of Official Analytical Chemists (AOAC 2000; 930.15, 976.05, 920.39, and 942.05, respectively). The NDFom and acid detergent fiber expressed exclusive of residual ash (ADFom) contents were determined according to Van Soest et al. [35]. The content of non-fibrous carbohydrate (NFC) was calculated using the following formula; NFC = 100 - (CP + EE + NDFom + crude ash). Chemical compositions of the feeds and substrate are shown in Table 1. The DM and NDFom digestibility were determined by the procedure described by Sato et al. [36]. The total CH4 and CO2 production were analyzed by gas chromatography (INORGA, LC Science, Nara, Japan) equipped with a thermal conductivity detector (TCD). For the analysis of VFA concentrations, collected samples were centrifuged at 15,000 × g at 4°C for 15 min. The concentrations of VFA in the supernatants were determined by gas chromatography (GC14-B, Shimadzu, Kyoto, Japan) equipped with a FID using a packed glass column (Thermon 3000–2% Shimalite TPA 60/80 3.2 mmφ × 2.1, Shimadzu Co., Ltd., Kyoto, Japan). The temperature of injection, column, and detector were 250, 115, and 250°C, respectively. The NH3-N concentration was determined by the steam distillation in a micro-Kjeldahl system (Kjeltec 2300, Foss Japan Ltd., Tokyo, Japan). Briefly, 3 mL of the supernatant after incubation was distilled with NaOH and the NH3-N was trapped in a boric acid solution. Then, the solution was titrated with 0.1 N H2SO4 to determine NH3-N concentration.
Table 1

Chemical compositions of feeds and substrate (% DM).

Item1ConcentrateRyegrass strawRolled barley
Dry matter (%)87.987.687.8
Organic matter97.095.797.5
Crude protein14.57.013.5
Ether extract3.42.42.5
NDFom33.464.532.1
ADFom9.039.610.3
Non-fibrous carbohydrate45.721.849.4
Crude ash3.04.32.5

1 NDFom, neutral detergent fiber expressed exclusive of residual ash; ADFom, acid detergent fiber expressed exclusive of residual ash.

1 NDFom, neutral detergent fiber expressed exclusive of residual ash; ADFom, acid detergent fiber expressed exclusive of residual ash.

Microbial DNA extraction, 16S rRNA gene amplicon preparation, and sequencing

Frozen culture samples were thawed on ice and centrifuged at 12,000 × g for 15 min. The supernatant was removed, and the pellet was used for DNA extraction by the method reported by Frias-Lopez et al. [37]. Extracted DNA was stored at −20°C until further analysis. For each sample, the V3-V4 hypervariable region of the 16S rRNA gene was amplified using the following primer set reported by Takahashi et al. [38]; 341F (5′-CCTACGGGRSGCAGCAG-3′) and 805R (5′-GACTACCAGGGTATCTAAT-3′) added the Illumina overhang adapter sequences (forward: TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG, reverse: GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG), according to the 16S sample preparation guide (https://support.illumina.com/content/dam/illumina-support/documents/documentation/chemistry_documentation/16s/16s-metagenomic-library-prep-guide-15044223-b.pdf). The amplicons were then sequenced on Illumina MiSeq platform (Illumina, San Diego, CA, USA), which generated paired 300-bp reads.

Sequence read processing and analysis

QIIME 2 (2019.4) package (http://qiime2.org) was used for sequence data analysis [39]. The adapter of the sequences was first trimmed using the cutadapt plugin [40]. The pair-end reads were then merged, quality filtered (Q20), and dereplicated using vsearch [41] and quality-filter plugin [42]. Subsequently, chimeras were identified and removed, and operational taxonomic units (OTUs) clustering using a similarity threshold of 97% were performed with the vsearch plugin [41]. Multiple sequence alignment of the sequences was performed using Multiple Alignment using Fast Fourier Transform (MAFFT) program [43] and masked [44] to remove highly variable regions using the qiime alignment command. A phylogenetic tree was then constructed with FastTree2 using the qiime phylogeny plugin [45]. The taxonomy of the sequence variants was assigned using the q2-feature-classifier plugin [46] against the Silva 132 OTUs sequences [47]. The OTUs were rarefied to a depth of 3,966, which was the lowest sample depth, for alpha and beta diversity analysis. For analysis of alpha diversity, richness (observed-OTUs and Chao1 [48]) and diversity (Shannon diversity index [49]) were estimated using the q2-diversity plugin. Non-metric multidimensional scaling (NMDS) ordination based on Bray–Curtis dissimilarities of OTUs was performed using R package ‘vegan’ [50] and visualized in R using ‘ggplots2’ [51]. Ward linkage hierarchical clustering using Spearman distance of OTUs was performed using the R function “hclust.” In order to identify differentially abundant microbial taxa at the phylum and genus levels, we normalized the count matrices of taxa with a negative binomial distribution using DESeq2 [52]. Relative abundance was calculated using the normalized data, and the minor phylum and genus (average relative abundance < 1% for all treatments) were excluded from statistical analysis.

Statistical analyses

Data, except for Bray–Curtis dissimilarities of OTUs and abundant bacterial taxa, were analyzed using GLM procedure of Statistical Analysis System (SAS, 2008). The mathematical model was: Where μ = the overall means, T = the effect of treatment, and e = residual error. Multiple comparisons among the least square means were performed using the Tukey-Kramer method. In order to evaluate differences Bray–Curtis dissimilarities among the treatments, permutational multivariate analysis of variance (PERMANOVA) test was conducted with 9999 permutations using R package ‘vegan’ [50]. Differentially abundant bacterial taxa were identified using a negative binomial Wald test in DESeq2 [52]. The obtained p-values were corrected according to Benjamini and Hochberg procedure [53]. Differences were considered statistically significant at P < 0.05.

Results

In vitro gas production, CH4 production, and nutrient digestibility

The effects of the feed additives on in vitro gas production, CH4 production, and digestibility are shown in Table 2. Among the treatments, FUM had the highest total gas production (P < 0.05) at the time points of incubation investigated. Compared to CON, the total gas production at 12 h after incubation in FAL was higher (P < 0.05) and that in FAH was similar (P > 0.05) but the total gas productions at 48 h after incubation in FAL and FAH were lower (P < 0.05). The total gas production in MON was lower (P < 0.05) than that in CON in the time points of incubation investigated. The total CH4 production after 12 h and 48 h incubation and digestibility-adjusted CH4 in FAL, FAH, and MON were significantly lower than those in CON (P < 0.05), and the lowest CH4 production was produced in FAH. No significant differences were observed for all parameters related to CH4 production between CON and FUM (P > 0.05). The DM and NDFom digestibility in FAL and FAH were lower (P < 0.05) than those of the other treatments.
Table 2

Effects of feed additives on in vitro gas production, CH4 production and digestibility of concentrate as substrate.

Item1Treatment2SEM3
CONFALFAHFUMMON
Gas production (mL/0.5gDM)
    12 h88.9c97.0b92.7bc103.8a82.0d1.23
    24 h124.1b117.4c106.9d140.6a112.8d1.21
    48 h134.9b124.1c111.3d154.5a120.9c1.47
CH4 production
    Total CH4 after 12 h incubation (mL/0.5gDM)6.3a4.7bc3.0d5.3ab4.1c0.23
    Total CH4 after 48 h incubation (mL/0.5gDM)13.3a7.9b4.4c12.4a8.6b0.46
    Adjusted CH4 after 48h incubation (mL/g IVDMD)32.4a20.0b12.0c30.3a21.1b1.15
    Adjusted CH4 after 48h incubation (mL/g IVNDFD)123.7a80.6b46.6c115.5a80.7b5.10
    CO2 production after 48h incubation (mL/0.5gDM)90.4b87.2bc80.7bc107.5a77.5c2.49
Digestibility (%)
    IVDMD82.3a79.1b74.2c81.8a81.9a0.42
    IVNDFD67.3a61.4b59.7b67.0a66.9a0.97

abcd LSMeans in a row with different superscripts significantly differ (P < 0.05).

1 DM, dry matter; IVDMD, in vitro dry matter digestibility; IVNDFD, in vitro neutral detergent fiber digestibility.

2 CON, non-supplementation; FAL, 2.25% DM calcium salt of long-chain fatty acid supplementation; FAH, 4.50% DM calcium salt of long-chain fatty acid supplementation; FUM, fumarate supplementation; MON, monensin supplementation.

3 SEM, standard error of means.

abcd LSMeans in a row with different superscripts significantly differ (P < 0.05). 1 DM, dry matter; IVDMD, in vitro dry matter digestibility; IVNDFD, in vitro neutral detergent fiber digestibility. 2 CON, non-supplementation; FAL, 2.25% DM calcium salt of long-chain fatty acid supplementation; FAH, 4.50% DM calcium salt of long-chain fatty acid supplementation; FUM, fumarate supplementation; MON, monensin supplementation. 3 SEM, standard error of means.

Characteristics of rumen fermentation and protozoa population

The results of rumen fermentation and the protozoa population are presented in Table 3. The pH in FAL and FAH were similar to those in CON and MON (P > 0.05), and higher than that in FUM (P < 0.05). No differences were observed among the treatments for total VFA concentration, the proportion of iso-butyrate, n-butyrate, and iso-valerate. The percentages of acetate in FAL, FAH, and MON were lower (P < 0.05) than that in CON. In contrast, higher proportions of propionate were observed in FAL, FAH, FUM, and MON than in CON (P < 0.05). Lower ratios of acetate to propionate were observed in all additive treatments, compared to CON. NH3-N concentration in FAL and FAH were lower than those in CON, FUM, and MON (P < 0.05). Compared with CON and FUM, smaller number of protozoa was observed in FAL (P < 0.05) and even fewer in FAH and MON (P < 0.05).
Table 3

Effects of feed additives on pH, NH3-N, protozoa population and VFA after 48 h incubation.

Item1Treatment2SEM3
CONFALFAHFUMMON
pH6.48a6.49a6.46a6.32b6.40ab0.02
NH3-N (mgN/dL)26.7a20.8c19.4c26.5a24.6b0.35
Protozoa (×105/mL)4.3a3.1b2.0c4.4a1.9c0.19
VFA
    Total VFA (mmol/L)130.6127.1124.8132.1121.84.88
    Acetate (%)49.6a44.0b42.4b45.6ab44.9b0.91
    Propionate (%)35.2c40.7ab43.4a39.1b41.8ab0.63
    iso-Butyrate (%)0.220.000.000.110.000.06
    n-Butyrate (%)10.19.47.610.08.11.09
    iso-Valerate (%)2.62.92.12.92.20.24
    n-Valerate (%)2.3c3.1b4.5a2.3c3.0b0.14
    Acetate:Propionate1.4a1.1bc1.0c1.2b1.1bc0.03

abcd LSMeans in a row with different superscripts significantly differ (P < 0.05).

1 NH3-N, ammonia nitrogen; VFA, volatile fatty acids.

2 CON, non-supplementation; FAL, 2.25% DM calcium salt of long-chain fatty acid supplementation; FAH, 4.50% DM calcium salt of long-chain fatty acid supplementation; FUM, fumarate supplementation; MON, monensin supplementation.

3 SEM, standard error of means.

abcd LSMeans in a row with different superscripts significantly differ (P < 0.05). 1 NH3-N, ammonia nitrogen; VFA, volatile fatty acids. 2 CON, non-supplementation; FAL, 2.25% DM calcium salt of long-chain fatty acid supplementation; FAH, 4.50% DM calcium salt of long-chain fatty acid supplementation; FUM, fumarate supplementation; MON, monensin supplementation. 3 SEM, standard error of means.

Diversity and structure of rumen microbiome

The number of observed OTUs and Chao1 index in FAH and MON were lower (P < 0.05) than those in CON, while no differences were observed among CON, FAL, and FUM (Fig 1). For the Shannon diversity index, CON has the highest, followed by FAL and FUM, and FAH and MON showed the lowest values (P < 0.05) (Fig 1). PERMANOVA analysis confirmed that there were significant differences of rumen microbial communities among the treatments (P < 0.001), and NMDS using the Bray-Curtis dissimilarity metric (Fig 2) and hierarchical clustering of the microbiota community (Fig 3) revealed distinct clustering patterns that separated the microbiota in FAL, FAH and MON from that in CON and FUM.
Fig 1

Effects of feed additives on alpha diversity.

Data are presented as mean ± SE (n = 3 per treatment). (A) Observed OTUs, (B) Chao1, and (C) Shannon index in microbiomes after incubation. Different superscripts (abc) indicate significant differences (P < 0.05). CON = non-supplementation; FAL = 2.25% DM calcium salt of long-chain fatty acid supplementation; FAH = 4.50% DM calcium salt of long-chain fatty acid supplementation; FUM = fumarate supplementation; MON = monensin supplementation.

Fig 2

Non-metric multidimensional scaling (NMDS) plots of the Bray-Curtis dissimilarities of microbiota.

CON = non-supplementation; FAL = 2.25% DM calcium salt of long-chain fatty acid supplementation; FAH = 4.50% DM calcium salt of long-chain fatty acid supplementation; FUM = fumarate supplementation; MON = monensin supplementation.

Fig 3

Ward linkage hierarchical clustering of microbiota based on Spearman distance.

CON = non-supplementation; FAL = 2.25% DM calcium salt of long-chain fatty acid supplementation; FAH = 4.50% DM calcium salt of long-chain fatty acid supplementation; FUM = fumarate supplementation; MON = monensin supplementation; 1–3, sample number.

Effects of feed additives on alpha diversity.

Data are presented as mean ± SE (n = 3 per treatment). (A) Observed OTUs, (B) Chao1, and (C) Shannon index in microbiomes after incubation. Different superscripts (abc) indicate significant differences (P < 0.05). CON = non-supplementation; FAL = 2.25% DM calcium salt of long-chain fatty acid supplementation; FAH = 4.50% DM calcium salt of long-chain fatty acid supplementation; FUM = fumarate supplementation; MON = monensin supplementation.

Non-metric multidimensional scaling (NMDS) plots of the Bray-Curtis dissimilarities of microbiota.

CON = non-supplementation; FAL = 2.25% DM calcium salt of long-chain fatty acid supplementation; FAH = 4.50% DM calcium salt of long-chain fatty acid supplementation; FUM = fumarate supplementation; MON = monensin supplementation.

Ward linkage hierarchical clustering of microbiota based on Spearman distance.

CON = non-supplementation; FAL = 2.25% DM calcium salt of long-chain fatty acid supplementation; FAH = 4.50% DM calcium salt of long-chain fatty acid supplementation; FUM = fumarate supplementation; MON = monensin supplementation; 1–3, sample number.

Bacterial abundance

Fig 4 shows the relative abundance of microbiota at the phylum level, and different abundant taxa is presented in S1 Table and Fig 5. At the phylum level, the microbiota in all treatments was dominated by Firmicutes, Bacteroidetes, and Proteobacteria. The abundant of the phyla Bacteroidetes in MON was lower than that in CON (P < 0.05). The abundant of the phyla Firmicutes in FAH, FUM and MON was increased compared with CON and FAL (P < 0.05), and that of Proteobacteria in FAL, FAH and MON was higher than that in CON (P < 0.05).
Fig 4

Relative abundance (%) of rumen microbiome at phylum level.

All phyla comprising less than 1% of the total abundance in all treatments were combined into the “Others” category. CON = non-supplementation; FAL = 2.25% DM calcium salt of long-chain fatty acid supplementation; FAH = 4.50% DM calcium salt of long-chain fatty acid supplementation; FUM = fumarate supplementation; MON = monensin supplementation.

Fig 5

Significantly differentially abundant microbial taxa at the genus level.

Genera with significant differences (adjusted P < 0.05) identified using DESeq2 between (A) CON and FAL, (B) CON and FAH, (C) CON and FUM, and (D) CON and MON. Only taxa ≥ 1% relative abundance for at least one treatment are shown. CON = non-supplementation; FAL = 2.25% DM calcium salt of long-chain fatty acid supplementation; FAH = 4.50% DM calcium salt of long-chain fatty acid supplementation; FUM = fumarate supplementation; MON = monensin supplementation.

Relative abundance (%) of rumen microbiome at phylum level.

All phyla comprising less than 1% of the total abundance in all treatments were combined into the “Others” category. CON = non-supplementation; FAL = 2.25% DM calcium salt of long-chain fatty acid supplementation; FAH = 4.50% DM calcium salt of long-chain fatty acid supplementation; FUM = fumarate supplementation; MON = monensin supplementation.

Significantly differentially abundant microbial taxa at the genus level.

Genera with significant differences (adjusted P < 0.05) identified using DESeq2 between (A) CON and FAL, (B) CON and FAH, (C) CON and FUM, and (D) CON and MON. Only taxa ≥ 1% relative abundance for at least one treatment are shown. CON = non-supplementation; FAL = 2.25% DM calcium salt of long-chain fatty acid supplementation; FAH = 4.50% DM calcium salt of long-chain fatty acid supplementation; FUM = fumarate supplementation; MON = monensin supplementation. At the genus level, Methanobrevibacter, which accounted for over 99% of the phylum Euryarchaeota, in FAH was lower than that in CON (P < 0.05). Among the phylum Bacteroidetes, Bacteroidales BS11 gut group and Rikenellaceae RC9 gut group was higher in CON than FAL, FAH and MON (P < 0.05). There was significant difference of unclassified Bacteroidales between CON and the other treatments (P < 0.05). Regarding the phylum Firmicutes, many genera (Succiniclasticum Anaerovibrio, Megasphaera, Schwartzia, Selenomonas.1, Veillonellaceae UCG.001, uncultured Veillonellaceae, and unclassified Veillonellaceae) were higher in MON than CON (P < 0.05). Similarly, adding CSFA at high level (treatment FAH) increased Succiniclasticum, Selenomonas.1 and Megasphaera compared to those of CON (P < 0.05). Additionally, Streptococcus was higher in FAH than in the other treatments (P < 0.05) and Schwartzia was increased in FUM (P < 0.05). Ruminococcus.2 in all additive treatments, especially FAH and MON, were significantly decreased compared with that in CON (P < 0.05). Among the phylum Proteobacteria, Ruminobacter was lower in FUM than other treatments (P < 0.05), but higher in FAH and MON than in CON (P < 0.05). Succinivibrio was increased in FAL and FAH (P < 0.05) compared with that in CON and MON. Pyramidobacter (the phylum Synergistetes) was higher in MON than that in other treatments (P < 0.05).

Discussion

We evaluated the effect of CSFA on in vitro rumen fermentation, CH4 production, digestibility, and rumen microbiota. Many studies showed that supplementary linseed decreases ruminal CH4. A meta-analysis by Martin et al. [7] demonstrated that for each 1% addition of supplemental linseed, CH4 production decreased by 4.8%. In the present study, compared with control (no additive), low and high amounts of CSFA supplementation (FAL and FAH) reduced CH4 production (mL/g IVDMD) by 38.2% and 63.0%, respectively. We found that addition of CSFA led to 21.0–25.5% decreases per 1% of linseed oil addition. Thus, in this study, the percentage of CH4 reduction due to CSFA supplementation was higher than that reported by Szumacher-Strabel et al. (10.1% reduction per 1% of linseed oil addition in in vitro) [54], indicating that the CSFA used in the present study has a substantially high reduction effect on CH4 production. We presumed that silica might be a key factor to increasing the CH4 reduction effect of CSFA. Shinkai et al. [55] reported that cashew nut shell liquid pellet with 40% silica powder has a larger reduction effect on CH4 production than that with 11.3% silica powder and several ingredients. They hypothesized that the cashew nut shell liquid pellet with 40% silica powder easily diffuses in the rumen, leading to a remarkable decrease in CH4 production [55]. Similarly, unsaturated fatty acids might diffuse from CSFA with 27.6% silica gel, and efficiently suppressed microbial activity related to CH4 production. Furthermore, adding CSFA at a high dose level more clearly reduced CH4 production when compared with adding supplementary fumarate and monensin. Monensin and fumarate are feed additives that can reduce CH4 production from ruminants. Odongo et al. [26] reported that monensin reduced CH4 production from dairy cows without the negative effect on DM intake and milk yield. Asanuma et al. [25] demonstrated that the use of fumarate as a feed additive could reduce methanogenesis and increase propionate production in the rumen, leading to the reduction of CH4 production. Therefore, the results in the present study indicate that CSFA is one of the potent inhibitors of methanogenesis. In the present study, supplementary fumarate did not reduce CH4 production probably because rolled barley was used as the substrate. García-Martínez et al. [56] reported that adding fumarate to batch culture under a low-forage substrate condition have less CH4 reduction effect compared with a high-forage substrate condition. Methane production in the rumen is due to methanogenesis of methanogens, and rumen methanogens use mainly H2 to reduce CO2 to CH4 [57]. Protozoa, which produce H2 in the hydrogenosomes [58], are also involved in methanogenesis because some of the methanogens attach to the cell surface of protozoa [59]. Guyader et al. [60] demonstrated by a meta-analysis that there was a positive linear correlation between protozoal numbers and CH4 emissions. Fatty acids, especially PUFA, have adverse effects on methanogens and protozoa [61, 62]. In the present study, the genus Methanobrevibacter, which is the dominant methanogen in the rumen [63-65], and the count of protozoa were decreased with the levels of CSFA, suggesting that FA released from CSFA might influence these microorganisms. Increasing propionate production decreases available H2 for methanogenesis since propionate formation is a competing alternative to H2 formation [66]. Therefore, the increase of propionate in the rumen is associated with reduction in CH4 production. In the present study, the percentage of propionate was increased by CSFA supplementation, corresponding with the result of fumarate and monensin inclusion. These results are consistent with previous studies related to the supplementation of linseed oil in dairy cows and steers diets [67-69]. In the rumen, there are two pathways for propionate production; succinate pathway (the main pathway) and acrylate pathway [70]. In the succinate pathway, fumarate is reduced to succinate, and succinate is converted to propionate by some bacteria. The genera Ruminobacter [71] and Succinivibrio [72] are involved in succinate production, while Succiniclasticum [73], Selenomonas [74], and Schwartzia [74] ferment succinate and produce propionate via the succinate pathway in rumen. In the present study, the genera Ruminobacter Succinivibrio, and Selenomonas.1, Succiniclasticum were increased by supplementation of CSFA at a high level or monensin compared to control, indicating that Ruminobacter and Succinivibrio might produce succinate used by Selenomonas and Succiniclasticum for propionate production in CSFA or monensin supplementation. However, the inclusion of fumarate increased the genus Schwartzia. Thus, the main bacteria related to propionate production via succinate pathway were different between the treatments (FAH and MON) and fumarate although all feed additives increased the proportion of propionate. Furthermore, the genera Streptococcus and Megasphaera were also increased by the inclusion of CSFA at a high level. Streptococcus bovis produces lactate [75, 76], while Megasphaera elsdenii is a utilizer of lactate for the production of butyrate and propionate [75-77]. Thus, our results indicate that supplementary CSFA may also promote propionate production via acrylate pathway as well as succinate pathway. Rumen protected fats such as CSFA prevent ruminal fermentation and digestion problems caused by fat feeding [14]. Therefore, we expected that no or little negative effects of supplementary CSFA on rumen fermentation and digestibility would be observed as with the results of other studies [15-20]. In the present study, however, supplementary CSFA decreased DM and NDFom digestibility, resulting in the inhibition of total gas production after 48 h incubation. Decreased ruminal ammonia was also observed with CSFA inclusion. The results indicate that FA released from CSFA might be sufficiently detrimental to the activity of ruminal microorganisms. Yang et al. [11] reported that dietary soybean oil and linseed oil to dairy cows decreased the counts of cellulolytic bacteria. We observed a strong decrease in the genus Ruminococcus.2 (the family Ruminococcaceae), Rikenellaceae RC9 gut group (the family Rikenellaceae), unclassified Bacteroidales (the order Bacteroidales), and Bacteroidales BS11 gut group (the family Bacteroidaceae) with the addition of CSFA. Ruminococcus is one of the main cellulolytic bacteria in the rumen, accounting for about 106 cells/mL of rumen content [78]. Dai et al. [79] demonstrated that Ruminococcus primarily synthesized putative cellulases and hemicellulases. It is well known that long chain fatty acids inhibit the growth of gram-positive bacteria [80], and supplementary linseed oil reduces Ruminococcaceae [11, 81], which agrees with the results in the present study. Rikenellaceae may be associated with either primary or secondary degradation of structural carbohydrates [82]. Various studies have reported that supplementary oil such as sunflower oil [83], linseed oil [66], and tucumã oil [84] reduced the relative abundance of Rikenellaceae RC9, consistent with our findings. Some Bacteroidales are associated with fiber degradation. Bacteroidales BS11 is specialized in fermenting many different hemicellulosic monomers, producing acetate and butyrate for the host [85]. Hence, the reduced abundance of these bacterial taxa might be a reason for the decreased digestibility observed after CSFA supplementation. The inclusion of monensin also decreased these taxa because monensin preferentially inhibits gram-positive bacteria [86] as linseed oil. In contrast to CSFA, no reduction in fiber digestibility by monensin was observed. This may be probably due to higher abundance of some taxa which belong to the phylum Firmicutes in MON than in FAH. Bensoussan et al. [87] found that cellulosome components, which are an extracellular multi-enzyme complex considered to be one of the most efficient plant cell wall-degrading strategies, were prevalent in Firmicutes. Among the phylum Firmicutes, Selenomonas.1, which was significantly increased with monensin compared to FAH, might have enhanced fiber digestion in the present study. Selenomonas ruminantium improves fiber digestion by cooperating with other cellulolytic bacteria [88, 89]. Interestingly, cumulative gas production after supplementing CSFA at a low level was higher than in control at 12 h after incubation in spite of decreased CH4 production. These results indicate that CSFA supplementation inhibits the activity of rumen microbes related to CH4 production in the initial stage of ruminal fermentation without toxic effect on other rumen bacteria. The characteristic of CSFA may be worthy of in vivo investigation, since rumen contents and liquid flow out of the rumen in vivo. Hartnell and Satter [90] reported that ruminal turnover rates of liquid, grain, and hay were 8.1, 4.4, and 3.9% per hour, respectively, in dairy cows. Considering these turnover rates and our results, dietary CSFA may be able to decrease CH4 production with little or no negative effect on rumen fermentation and digestibility in vivo. One of the limitations of the present study was that the low sample size (n = 3 per treatment) with only one in vitro trial. Moreover, we evaluated the effect of CSFA using only one substrate although the effect of fat on rumen fermentation can be influenced by the concentrate and roughage ratio of feeds [91]. Therefore, further studies with an increase in sample size and substrates will be needed to increase the reliability of the effect of CSFA on CH4 production. In conclusion, although in vitro digestibility was reduced with increasing concentration of CSFA, addition of CSFA significantly changed rumen microbiome, resulting in the acceleration of propionate production, and the reduction of CH4 production. These findings present CSFA as a promising candidate for reduction of CH4 emission from ruminants. However, some differences of the observation were reported between in vivo and vitro [92]. Therefore, future studies are needed to confirm the in vivo effect of dietary CSFA on CH4 production, productivity, rumen microbiome, and digestibility, and to determine the optimal amount of CSFA in a diet for ruminants.

Differential abundance in specific taxa at phylum and genus level.

1 CON, non-supplementation; FAL, 2.25%DM calcium salt of long-chain fatty acid supplementation; FAH, 4.50%DM calcium salt of long-chain fatty acid supplementation; FUM, fumarate supplementation; MON, monensin supplementation. 2 Phylum and genus exhibited significant differences (adjusted P < 0.05) identified using DESeq2 with ≥ 1% relative abundance in more than one treatment. 3 The p-value was adjusted using the Benjamini-Hochberg procedure. (DOCX) Click here for additional data file. 27 Aug 2020 PONE-D-20-14439 Calcium salts of long-chain fatty acids from linseed oil decrease methane production by altering rumen microbiome in vitro PLOS ONE Dear Dr. Kumagai, Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process. Both reviewers noted a number of issues that must be adequately addressed before further consideration can be made. Please submit your revised manuscript by Oct 11 2020 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file. Please include the following items when submitting your revised manuscript: A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'. A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'. An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'. If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter. If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols We look forward to receiving your revised manuscript. Kind regards, Brenda A Wilson, Ph.D. Academic Editor PLOS ONE Journal Requirements: When submitting your revision, we need you to address these additional requirements. 1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf 2. Thank you for stating the following in the Financial Disclosure section: 'This study was supported by a Grant-in-Aid for the Japan Society for the Promotion of Science (JSPS) Fellows (20J15021) and a Grant from GAP Fund Program of Kyoto University (2019). ' We note that one or more of the authors are employed by a commercial company: Taiyo Yushi Corp a. Please provide an amended Funding Statement declaring this commercial affiliation, as well as a statement regarding the Role of Funders in your study. If the funding organization did not play a role in the study design, data collection and analysis, decision to publish, or preparation of the manuscript and only provided financial support in the form of authors' salaries and/or research materials, please review your statements relating to the author contributions, and ensure you have specifically and accurately indicated the role(s) that these authors had in your study. You can update author roles in the Author Contributions section of the online submission form. Please also include the following statement within your amended Funding Statement. “The funder provided support in the form of salaries for authors [insert relevant initials], but did not have any additional role in the study design, data collection and analysis, decision to publish, or preparation of the manuscript. The specific roles of these authors are articulated in the ‘author contributions’ section.” If your commercial affiliation did play a role in your study, please state and explain this role within your updated Funding Statement. b. Please also provide an updated Competing Interests Statement declaring this commercial affiliation along with any other relevant declarations relating to employment, consultancy, patents, products in development, or marketed products, etc. Within your Competing Interests Statement, please confirm that this commercial affiliation does not alter your adherence to all PLOS ONE policies on sharing data and materials by including the following statement: "This does not alter our adherence to  PLOS ONE policies on sharing data and materials.” (as detailed online in our guide for authors http://journals.plos.org/plosone/s/competing-interests) . If this adherence statement is not accurate and  there are restrictions on sharing of data and/or materials, please state these. Please note that we cannot proceed with consideration of your article until this information has been declared. c. Please include both an updated Funding Statement and Competing Interests Statement in your cover letter. We will change the online submission form on your behalf. Please know it is PLOS ONE policy for corresponding authors to declare, on behalf of all authors, all potential competing interests for the purposes of transparency. PLOS defines a competing interest as anything that interferes with, or could reasonably be perceived as interfering with, the full and objective presentation, peer review, editorial decision-making, or publication of research or non-research articles submitted to one of the journals. Competing interests can be financial or non-financial, professional, or personal. Competing interests can arise in relationship to an organization or another person. Please follow this link to our website for more details on competing interests: http://journals.plos.org/plosone/s/competing-interests 3. Please include captions for your Supporting Information files at the end of your manuscript, and update any in-text citations to match accordingly. Please see our Supporting Information guidelines for more information: http://journals.plos.org/plosone/s/supporting-information [Note: HTML markup is below. Please do not edit.] Reviewers' comments: Reviewer's Responses to Questions Comments to the Author 1. Is the manuscript technically sound, and do the data support the conclusions? The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1: Partly Reviewer #2: Yes ********** 2. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1: I Don't Know Reviewer #2: Yes ********** 3. Have the authors made all data underlying the findings in their manuscript fully available? The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #1: Yes Reviewer #2: Yes ********** 4. Is the manuscript presented in an intelligible fashion and written in standard English? PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #1: Yes Reviewer #2: Yes ********** 5. Review Comments to the Author Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #1: The current study evaluated the impact of Ca-salts of FA from linseed oil on in vitro fermentation characteristics. Although the practical application of feeding Ca-salts as a strategy to limit CH4 emissions is questionable mostly because it would just be cheaper to feed linseed oil vs Ca-salts (typically, the cost of Ca-salts > oil > oilseeds), and that linseed oil is possibly more effective than CSFA. However, if a reduction in emissions occurs with CSFA in vivo, it would be a great thing. Major comments: 1. Although there was a dramatic decrease in CH4 production in the present study, it is questionable if similar observations would be made in vivo. This is related to the experimental approach. Besides being a function of the technology used (pH dependence for Ca-salts), the effectiveness of rumen-protection for products like CSFA is also influenced by factors including rumen residence time. Therefore, the in vitro system (batch culture for 48 h) is not ideal for testing the hypothesis. One could speculate that some of the observations made in the current study (e.g., greater reduction in CH4 production with FAL and FUM compared to previous in vivo studies with linseed oil, and decrease in DM and fiber digestion with FAL and FUM, which is not typically observed with CSFA in vivo) are all a result of the closed-system (no continuous addition of substrates or passage of digesta out; fixed residence time with incubation up to 48 h). It is highly likely that observations made in this study might not fully translate to in vivo conditions (continuous culture). Therefore, the comparison of observations made in this study to predominantly in vivo studies in the discussion, without accounting for the differences in approach (batch vs continuous culture), is problematic. The observations made should be interpreted with caution, and this should also be reflected in the wording of the concluding statement(s). 2. Given the day-to-day variation in both animal factors (e.g., nutrient intake and timing of meals, which can influence properties of the inoculum/rumen fluid) and human factors (e.g., possible errors when making reagents or purging of system to ensure anaerobic conditions, pipetting/measurement errors, etc), it is recommended that runs (days of incubation) are replicated. At least 2 incubation runs over 2 non-consecutive days are needed; in that case, the day effect is also tested in the statistical model, & is only removed if it is not significant. This potentially increases replicates (if there is no day effect), and thus experimental power, which was low in the present study, since only 3 replicates were used. The importance of replicating runs is highlighted by the observed increase in GP at 12 h of incubation when CH4 decreased. One would have greater confidence that this observation was of biological significance as discussed, rather than an error in measurement/anomaly, if the same observation is made across runs/different days of incubation. 3. There is no indication that a negative control (artificial saliva + rumen fluid + substrate) was included in the in vitro run. Even if it was just 1 run, a “blank correction” is important for some measures including GP as it provides more meaning data compared to just absolute values. 4. With statistical analysis it is not clear if data was tested for normality and homoscedacity prior to analysis. This is especially important with bacterial relative abundance data (proportions). Minor comments: L4: change to “altering the rumen” L37: change to “changed the rumen” L39 – L41: This is highly speculative given the approach used (batch culture) in the present study. L44: change to “because it has” L46: change to “Livestock are the” L49: delete “as a result” L62: change to “due to their toxic’ L70: change to “CSFA have generally” L91: change to “alter the microbiome” L91: delete “resulting in” L107 – L116: What was the actual experimental design? Was it a CRD? Information needs to be added L109: replace “named” with “namely” L110: change to “of the CSFA used in this study, the…” L123 – L125: The ingredient composition should be reported on a DM basis. L129: change to “through the rumen” L133 – L134: It is not clear what the “sample liquid” was, and for the ratio, what 4 is and what 1 is. Revise to increase clarity. L135: What was the substrate used? Be more specific. L134 – L137: Was a negative control (saliva + rumen fluid + substrate) added to the in vitro run? L137: Is there a reason why there was no replicate for run (repeating measurements on a different day)? Refer to major comments. L144: Need to add the actual volume of culture that was centrifuged. L152 – L155: change to “DM, crude protein, …… were analyzed according to AOAC…..) L162 – L163: replace “the liquids after incubation” with “collected samples” L168: Need more details and citation for the NH3-N procedure. L212: Was data, especially bacterial relative abundance, tested for normality and homoscedacity, & transformed when appropriate, prior to analysis? L258: delete “the” L261: concentration L349: change to “in vitro rumen fermentation” L350: delete “by in vitro trial” L350: replace “suggested” with “showed” L352 – L353: change to “that for each 1% addition of supplemental linseed, CH4 production decreases by 4.8%” L352: Marti et al (7) actually reported a 3.8 and not 4.8% decrease in CH4 after summarizing data from several studies L356 – L366: The way this is discussed is problematic because there is no equivalency between the present study (batch culture) and what is reported by Martin et al (7), which was a summary of in vivo studies (continuous culture). See major comments. The discussion has to take that into account, and it would be useful to do a comparison with other in vitro studies (for an apples-to-apples comparison). L372: change to “a feed additive could” L372: What could possibly explain why FUM did not result in a decrease in CH4 production in the present study? L396: replace “relate to” with “are involved in” L397 – L398: change to “via the succinate pathway.” L413 – L422: The decrease in digestibility in the present study vs minor impact if any of CSFA in other/cited studies [15-20], which are all in vivo, is most likely a reflection of the differences in fermentation system (batch vs continuous culture). Rumen protection is also a function of factors including rumen residence time. As rightfully stated (L453 – L456) observations will most likely be different in vivo. Use of a dual flow system (RUSITEC) would be better than batch culture, with the in vivo approach being the gold standard. L427: replace “accounted” with “accounting for about…” L439: replace “in” with “after” L44: change to “considered to be one “ L448: change to “with other cellulolytic” L449: delete “the” L449: replace “in” with “after” L451 – L453: This is highly speculative. Is it possible that this was an anomaly vs. an observation with biological significance? This is why replicating runs helps with providing a clearer picture. There are indications that diet (high forage vs grain diets) could influence fermentation responses (including CH4 production) following the addition of lipids. The discussion also needs to address those potential associative effects based on substrate used. Reviewer #2: I found nothing really critical to say about the manuscript. I agree with the statistical methods used. I agree that these results are interesting and require in-vivo experimental testing to validate the authors' findings. The use of 16s for the sequencing is probably the greatest weakness. Using shotgun metagenomic sequencing might have given better resolution than the V3-V4 amplicon method and have provided more data on the function of the microbes in the rumen microbiome. Metagemome Assembled Genome (MAG) approaches might also have added better depth to the microbial data. But using 16s still gave interesting results. The Shannon index suggested good diversity but the rarefaction carried out limited the sample depth to 3966 which makes me wonder whether this was too low and the supplementary data shows a bunch of stuff with LSMeans. It would be good to see the Shannon diversity graphed. Rarefaction may have reduced the accuracy and I am going to assume the authors tested it against DESeq etc. That aside, the methodology looked sound, the results and interpretation good. Use of V3-4 is recommended for rumen and Silva sequences also recommended. Statistically, the permutational multivariate analysis of variance (PERMANOVA) test was conducted on 999 permutations whereas our standard number we use is 10k. Because I cant find a reason to reject this manuscript I can only point out minor potential flaws that the authors may wish to remove by explaining or providing supplementary data. ********** 6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: No Reviewer #2: Yes: Jane Adair Mullaney [NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.] While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step. 8 Oct 2020 October 7, 2020 Dear Sir/Madam, We are pleased to have an opportunity to revise our manuscript entitled, “Calcium salts of long-chain fatty acids from linseed oil decrease methane production by altering the rumen microbiome in vitro”. The reviewer’s comments are very helpful overall, and we are appreciative of such constructive feedback on our original submission. After addressing the issues raised, we feel the quality of the paper is much improved. To facilitate your review of our revisions, the followings are point-by-point responses to the questions and comments delivered in your letter. Moreover, revised and added sentences or sections are highlighted in our revised manuscript. 【List of comments and answers】 【Reviewer 1】 The current study evaluated the impact of Ca-salts of FA from linseed oil on in vitro fermentation characteristics. Although the practical application of feeding Ca-salts as a strategy to limit CH4 emissions is questionable mostly because it would just be cheaper to feed linseed oil vs Ca-salts (typically, the cost of Ca-salts > oil > oilseeds), and that linseed oil is possibly more effective than CSFA. However, if a reduction in emissions occurs with CSFA in vivo, it would be a great thing. Reply: As you mentioned, CSFA is 1.5 times more expensive than linseed oil. However, the reduction effect of the CSFA used in the present study was higher than that reported in a previous study (Szumacher-Strabel et al., 2004, Journal of Animal and Feed Sciences, 13: 215-218) which evaluated the effect of linseed oil using in vitro trial. Therefore, we consider that the CSFA has a potential to be a promising candidate for reduction of CH4 emission from ruminants. In order to investigate the reduction effect of the CSFA on the rumen CH4 production, we are going to conduct an in vivo study using Japanese Black cattle. Major comments: 1. Although there was a dramatic decrease in CH4 production in the present study, it is questionable if similar observations would be made in vivo. This is related to the experimental approach. Besides being a function of the technology used (pH dependence for Ca-salts), the effectiveness of rumen-protection for products like CSFA is also influenced by factors including rumen residence time. Therefore, the in vitro system (batch culture for 48 h) is not ideal for testing the hypothesis. Reply: As you mentioned, the protection effect of CSFA in rumen is also influenced by rumen residence time. Therefore, the reduction effect of CSFA on CH4 evaluated in the present study may be overestimated, and it is possible not to inhibit in vivo CH4 production like in vitro. However, adding CSFA decreased CH4 after 12 h incubation, which is close to residence time of feed in rumen, indicating that CSFA is a promising candidate for reduction of CH4 emission from ruminants. We think that we need to conduct an in vivo study to evaluate the effect of CSFA in details. Therefore, we are going to perform a further in vivo study using Japanese Black cattle as mentioned above. One could speculate that some of the observations made in the current study (e.g., greater reduction in CH4 production with FAL and FUM compared to previous in vivo studies with linseed oil, and decrease in DM and fiber digestion with FAL and FUM, which is not typically observed with CSFA in vivo) are all a result of the closed-system (no continuous addition of substrates or passage of digesta out; fixed residence time with incubation up to 48 h). Reply: To our knowledge, there is only one study which evaluated the effect of dietary CSFA on methane production in vivo. Kliem et al. (2019, Animal, 13.2: 309-317.) reported that CSFA from linseed and palm oil decreased CH4 in dairy cows, consistent with our results. Therefore, we think the CSFA using in the present study can probably decrease CH4 production not only in vitro but also in vivo. With regard to a digestibility, the meanings of in vitro and in vivo digestibility are different. We can evaluate the digestibility of feed in the rumen using in vitro system (batch culture), while in vivo digestibility means the proportion of feeds digested in the total digestive tract. Therefore, we need to conduct in vivo trials to evaluate the effect of the CSFA on in vivo digestibility and we already described the necessity of further researches in Conclusion section (Line 463-465 in original manuscript). It is highly likely that observations made in this study might not fully translate to in vivo conditions (continuous culture). Therefore, the comparison of observations made in this study to predominantly in vivo studies in the discussion, without accounting for the differences in approach (batch vs continuous culture), is problematic. Reply: We agree with your comment. It is not reasonable to compare our results with in vivo studies. Therefore, we compared our results to a published paper (Szumacher-Strabel et al., 2004) which evaluated the effect of supplementary linseed oil on in vitro CH4 production, instead of Martin et al. (2010), and revised the sentence as follows: “Thus, in this study, the percentage of CH4 reduction due to CSFA supplementation was higher than that reported by Szumacher-Strabel et al. (10.1% reduction per 1% of linseed oil addition in in vitro) [54], indicating that the CSFA used in the present study has a substantially high reduction effect on CH4 production.” (Line 363-367) “54. Szumacher-Strabel M, Martin SA, Potkański A, Cieślak A, Kowalczyk J. Changes in fermentation processes as the effect of vegetable oil supplementation in in vitro studies. J Anim Feed Sci. 2004;13: 215–218.https://doi.org/10.22358/jafs/73843/2004” (Line 657-660) The observations made should be interpreted with caution, and this should also be reflected in the wording of the concluding statement(s). Reply: As you mentioned, the sentence may be an exaggerated expression because we evaluated the effect of the CSFA only in batch culture system. Therefore, we changed the sentence as follows: “In conclusion, although further in vivo study is needed to evaluate the reduction effect on rumen CH4 production, CSFA may be a promising candidate for reduction of CH4 emission from ruminants.” (Line 38-41) 2. Given the day-to-day variation in both animal factors (e.g., nutrient intake and timing of meals, which can influence properties of the inoculum/rumen fluid) and human factors (e.g., possible errors when making reagents or purging of system to ensure anaerobic conditions, pipetting/measurement errors, etc), it is recommended that runs (days of incubation) are replicated. At least 2 incubation runs over 2 non-consecutive days are needed; in that case, the day effect is also tested in the statistical model, & is only removed if it is not significant. This potentially increases replicates (if there is no day effect), and thus experimental power, which was low in the present study, since only 3 replicates were used. Reply: We think that only one trial for the in vitro experiment might be acceptable, since only one time in vitro fermentation was conducted to investigate the effect of feed or feed additives in many published papers such as Benchaar et al. (2007, Canadian Journal of Animal Science, 87.3: 413-419), Patra et al. (2014, Applied Microbiology and Biotechnology, 98.2: 897-905), Shen et al. (2017, Frontiers in Microbiology, 8: 1111), and Iqbal et al. (2018, Animal Nutrition, 4.1: 100-108). However, as you criticized, the low sample size and only one experiment was one of the weak points of our study. Therefore, we discussed about the point as one of the limitations of the present study in Discussion section as follows: “One of the limitations of the present study was that the low sample size (n = 3 per treatment) with only one in vitro trial. Moreover, we evaluated the effect of CSFA using only one substrate although the effect of fat on rumen fermentation can be influenced by the concentrate and roughage ratio of feeds [91]. Therefore, further studies with an increase in sample size and substrates will be needed to increase the reliability of the effect of CSFA on CH4 production.” (Line 470-475) The importance of replicating runs is highlighted by the observed increase in GP at 12 h of incubation when CH4 decreased. One would have greater confidence that this observation was of biological significance as discussed, rather than an error in measurement/anomaly, if the same observation is made across runs/different days of incubation. Reply: We obtained similar results with the findings in our another trial; 20.9% increase of gas production and 40.5% decrease by adding CSFA at initial stage of ruminal incubation in batch culture system was observed (not published yet). Therefore, although we need to perform further researches in vivo or continuous culture system to increase reliability of the effect of CSFA, we consider that the results observed in the present study were not from erroneous measurements. 3. There is no indication that a negative control (artificial saliva + rumen fluid + substrate) was included in the in vitro run. Even if it was just 1 run, a “blank correction” is important for some measures including GP as it provides more meaning data compared to just absolute values. Reply: We prepared control (artificial saliva + rumen fluid + substrate) described as CON in the manuscript (Line 114). Because the sentence was not clear, we revised it as follows: “The control treatment (CON) contained only substrate.” (Line 114) We did not prepare a treatment (artificial saliva + rumen fluid) for a blank correction because we tested the effect of CSFA using only one experiment. Blank correlation has little effect on gas production in experimental treatments. In our previous studies (Sato et al., 2019; Animal Science Journal, 90(1), 90-97.; Sato et al., 2020; Livestock Science, 104217), we have prepared the control, but the value of gas production showed zero. 4. With statistical analysis it is not clear if data was tested for normality and homoscedacity prior to analysis. This is especially important with bacterial relative abundance data (proportions). Reply: We did not test for normality and homogeneity of variance due to the lack of power of these tests for small sample size like the present study (n = 3 per treatment). Because Tukey-Kramer method may not be appropriate for analysis of bacterial relative abundance in the present study, we reanalyzed differentially abundant microbial taxa using DESeq2, which is recommended for increasing sensitivity on smaller dataset compared to traditional non-parametric tests based on Kruskal–Wallis and Wilcoxon rank-sum approaches (Weiss et al., 2015, PeerJ. 3, e1408). Based on the reanalyzed results, we revised some sentences, Tables and Figures as follows: “The genera Ruminobacter, Succinivibrio, Succiniclasticum, Streptococcus, Selenomonas.1, and Megasphaera, which are related to propionate production, were increased (P < 0.05), while Methanobrevibacter and protozoa counts, which are associated with CH4 production, were decreased in FAH, compared with CON (P < 0.05)” (Line 32-36) “The OTUs were rarefied to a depth of 3,966, which was the lowest sample depth, for alpha and beta diversity analysis.” (Line 207-208) “In order to identify differentially abundant microbial taxa at the phylum and genus levels, we normalized the count matrices of taxa with a negative binomial distribution using DESeq2 [52]. Relative abundance was calculated using the normalized data, and the minor phylum and genus (average relative abundance < 1% for all treatments) were excluded from statistical analysis.” (Line 214-218) “Data, except for Bray–Curtis dissimilarities of OTUs and abundant bacterial taxa, were analyzed using GLM procedure of Statistical Analysis System (SAS, 2008).” (Line 221-222) “Differentially abundant bacterial taxa were identified using a negative binomial Wald test in DESeq2 [52]. The obtained p-values were corrected according to Benjamini and Hochberg procedure [53].” (Line 229-232) We changed a subtitle in Result section to “Bacterial abundance”. (Line 313) We revised sentences in “Bacterial abundance” section following the new results. (Line 314-330, 334-337) We redrew Fig 4 following the new results. (Fig 4) We revised Fig 5 and the legend and footnotes. (Line 347-354) We revised sentences in Discussion section according to the new results. (Line 407-419, 452-458) We changed S1 Table and added Supporting information. (Line 800-807) We added the reference as follows: “52. Love MI, Huber W, Anders S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 2014;15: 550. https://doi.org/10.1186/s13059-014-0550-8; 53. Benjamini Y, Hochberg Y. Controlling the false discovery rate: a practical and powerful approach to multiple testing. J R Stat Soc Ser B. 1995;57: 289–300. https://doi.org/10.1111/j.2517-6161.1995.tb02031.x” (Line 651-656) Minor comments: L4: change to “altering the rumen” Reply: We changed the wording following your comment. (Line 4) L37: change to “changed the rumen” Reply: We revised the wording accordingly. (Line 37) L39 – L41: This is highly speculative given the approach used (batch culture) in the present study. Reply: As stated above, we revised the sentence. (Line 38-41) L44: change to “because it has” Reply: We changed the wording following your comment. (Line 44) L46: change to “Livestock are the” Reply: We revised the wording accordingly. (Line 46) L49: delete “as a result” Reply: We deleted the words following your comment. L62: change to “due to their toxic’ Reply: We changed the wording following your comment. (Line 62) L70: change to “CSFA have generally” Reply: We changed the wording as you suggested. (Line 70) L91: change to “alter the microbiome” Reply: We changed the wording following your comment. (Line 91) L91: delete “resulting in” Reply: We deleted the words following your comment. L107 – L116: What was the actual experimental design? Was it a CRD? Information needs to be added Reply: As we described in our manuscript, we collected rumen liquid from two wethers, and the liquids was mixed before using the in vitro experiment. We prepared the five treatments (CON, FAL, FAH, FUM and MON) for the experiment. L109: replace “named” with “namely” Reply: We replaced the word accordingly. (Line 109) L110: change to “of the CSFA used in this study, the…” Reply: We changed the phrase following your comment. (Line 110) L123 – L125: The ingredient composition should be reported on a DM basis. Reply: We calculated the ingredient composition on a DM basis using the Standard Tables of Feed Composition in Japan (NARO 2009). Therefore, we changed the sentence as follow: “The ingredient compositions of the concentrate were as follows: 35.2% rice bran, 54.0% rolled barley, 6.9% alfalfa meal, 3.4% soybean meal, and 0.6% vitamin-mineral premix on a DM basis calculated using the Standard Tables of Feed Composition in Japan [31].” (Line 123-126) “31. Japan Livestock Industry Association. Standard Tables of Feed Composition in Japan. NARO, Livestock Industry Association, Tokyo. 2009.” (Line 588-589) L129: change to “through the rumen” Reply: We changed the word as you suggested. (Line 129) L133 – L134: It is not clear what the “sample liquid” was, and for the ratio, what 4 is and what 1 is. Revise to increase clarity. Reply: As you mentioned, our explanation was not clear. We changed the sentences as follows: “The filtered sample were mixed with artificial saliva [32] in a ratio of 1:4 under anaerobic condition. The artificial saliva was sterilized by autoclaving and made anaerobic by a CO2 flushing before mixing.” (Line 132-135) L135: What was the substrate used? Be more specific. Reply: We replaced “substrate” with “rolled barley”. (Line 136) L134 – L137: Was a negative control (saliva + rumen fluid + substrate) added to the in vitro run? Reply: As stated above, we prepared the control (saliva + rumen fluid + substrate) in the present study. L137: Is there a reason why there was no replicate for run (repeating measurements on a different day)? Refer to major comments. Reply: As mentioned above, we could not conduct further researches because there were no cannulated wethers available for our experiment. L144: Need to add the actual volume of culture that was centrifuged. Reply: We centrifuged all of the remaining culture. Therefore, we replaced “Culture” with “All of the remaining culture”. (Line 145) L152 – L155: change to “DM, crude protein, …… were analyzed according to AOAC…..) Reply: We changed it as you suggested. (Line 154-156) L162 – L163: replace “the liquids after incubation” with “collected samples” Reply: We revised the phrase following your comment. (Line 164) L168: Need more details and citation for the NH3-N procedure. Reply: We explained the procedure more detail as follows: “The NH3-N concentration was determined by the steam distillation in a micro-Kjeldahl system (Kjeltec 2300, Foss Japan Ltd., Tokyo, Japan). Briefly, 3 mL of the supernatant after incubation was distilled with NaOH and the NH3-N was trapped in a boric acid solution. Then, the solution was titrated with 0.1 N H2SO4 to determine NH3-N concentration.” (Line 169-173) L212: Was data, especially bacterial relative abundance, tested for normality and homoscedacity, & transformed when appropriate, prior to analysis? Reply: As stated above, we did not test for normality and homogeneity of variance. We normalized our data with a negative binomial distribution using DESeq2 and reanalyzed. L258: delete “the” Reply: We deleted the word following your comment. L261: concentration Reply: We revised it accordingly. (Line 269) L349: change to “in vitro rumen fermentation” Reply: We changed the word as you suggested. (Line 356) L350: delete “by in vitro trial” Reply: We deleted the word following your comment. L350: replace “suggested” with “showed” Reply: We replaced the word accordingly. (Line 357) L352 – L353: change to “that for each 1% addition of supplemental linseed, CH4 production decreases by 4.8%” Reply: We changed the phrase following your comment. (Line 359-360) L352: Martin et al. (7) actually reported a 3.8 and not 4.8% decrease in CH4 after summarizing data from several studies. Reply: As you mentioned, Martin et al. (2010) reported that 3.8% CH4 was decreased with 1% addition of supplemental fat decreased. However, they also described that CH4 was decreased by 4.8% with supplementary 1% linseed. L356 – L366: The way this is discussed is problematic because there is no equivalency between the present study (batch culture) and what is reported by Martin et al (7), which was a summary of in vivo studies (continuous culture). See major comments. The discussion has to take that into account, and it would be useful to do a comparison with other in vitro studies (for an apples-to-apples comparison). Reply: As stated above, instead of Martin et al. (2010), we compared our results to a published paper (Szumacher-Strabel et al., 2004), which evaluated the effect of supplementary linseed oil on in vitro CH4 production and revised the sentences. L372: change to “a feed additive could” Reply: We changed the wording following your comment. (Line 380) L372: What could possibly explain why FUM did not result in a decrease in CH4 production in the present study? Reply: We consider that CH4 reduction effect of FUM was low (only 6.7% reduction) because rolled barley was used as the substrate in the present study. García-Martínez et al. (2005) reported that adding fumarate to batch culture under a low-forage substrate condition have less CH4 reduction effect compared with a high-forage substrate condition. Considering their study, we added the explanation for the reason why fumarate had little CH4 reduction effect as follows: “In the present study, supplementary fumarate did not reduce CH4 production probably because rolled barley was used as the substrate. García-Martínez et al. [56] reported that adding fumarate to batch culture under a low-forage substrate condition have less CH4 reduction effect compared with a high-forage substrate condition.” (L 383-387) “56. García-Martínez R, Ranilla MJ, Tejido ML, Carro MD. Effects of disodium fumarate on in vitro rumen microbial growth, methane production and fermentation of diets differing in their forage: concentrate ratio. Br J Nutr. 2005;94: 71–77. https://doi.org/10.1079/BJN20051455” (Line 664-667) L396: replace “relate to” with “are involved in” Reply: We replaced the words as you suggested (Line 408) L397 – L398: change to “via the succinate pathway.” Reply: We changed the words accordingly (Line 409-410) L413 – L422: The decrease in digestibility in the present study vs minor impact if any of CSFA in other/cited studies [15-20], which are all in vivo, is most likely a reflection of the differences in fermentation system (batch vs continuous culture). Rumen protection is also a function of factors including rumen residence time. As rightfully stated (L453 – L456) observations will most likely be different in vivo. Use of a dual flow system (RUSITEC) would be better than batch culture, with the in vivo approach being the gold standard. Reply: We agree with your comment. As you mentioned, the results may differ between in vivo and vitro. In our previous study, we observed the difference of the results between in vivo and vitro (Sato et al., 2020, Livestock Science, 104217). Therefore, we consider that we need to conduct further researches using in vivo trial. Although we already described the necessity of further researches in Conclusion section, we changed the sentences as follows: “These findings present CSFA as a promising candidate for reduction of CH4 emission from ruminants. However, some differences of the observation were reported between in vivo and vitro [92]. Therefore, future studies are needed to confirm the in vivo effect of dietary CSFA on CH4 production, productivity, rumen microbiome, and digestibility, and to determine the optimal amount of CSFA in a diet for ruminants.” (Line 479-483) “92. Sato Y, Nakanishi T, Wang L, Oishi K, Hirooka H, Kumagai H. In vitro and in vivo evaluations of wine lees as feeds for ruminants: Effects on ruminal fermentation characteristics, nutrient digestibility, blood metabolites and antioxidant status. Livest Sci. 2020; 104217. https://doi.org/10.1016/j.livsci.2020.104217” (Line 791-795) L427: replace “accounted” with “accounting for about…” Reply: We replaced it following your comment. (Line 437-438) L439: replace “in” with “after” Reply: We changed the word accordingly. (Line 449) L44: change to “considered to be one “ Reply: We changed it as you suggested. (Line 455) L448: change to “with other cellulolytic” Reply: We changed the wording following your comment. (Line 459) L449: delete “the” Reply: We deleted it. L449: replace “in” with “after” Reply: We revised the word as you suggested. (Line 460) L451 – L453: This is highly speculative. Is it possible that this was an anomaly vs. an observation with biological significance? This is why replicating runs helps with providing a clearer picture. Reply: As stated above, we obtained similar results with our findings in an another trial (data not published). Therefore, although we need to perform further researches in vivo or continuous culture system to increase reliability of the effect of CSFA, we consider that the results observed in the present study were not anomaly. There are indications that diet (high forage vs grain diets) could influence fermentation responses (including CH4 production) following the addition of lipids. The discussion also needs to address those potential associative effects based on substrate used. Reply: As you mentioned, the effect of fat on rumen fermentation is influenced by a kind of substrates. So, we added the sentence in Discussion section as follows: “One of the limitations of the present study was that the low sample size (n = 3 per treatment) with only one in vitro trial. Moreover, we evaluated the effect of CSFA using only one substrate although the effect of fat on rumen fermentation can be influenced by the concentrate and roughage ratio of feeds [91]. Therefore, further studies with an increase in sample size and substrates will be needed to increase the reliability of the effect of CSFA on CH4 production” (Line 470-475) “91. Bayat AR, Ventto L, Kairenius P, Stefanski T, Leskinen H, Tapio I, et al. Dietary forage to concentrate ratio and sunflower oil supplement alter rumen fermentation, ruminal methane emissions, and nutrient utilization in lactating cows. Transl Anim Sci. 2017;1: 277–286. https://doi.org/10.2527/tas2017.0032” (Line 787-790) 【Reviewer 2】 I found nothing really critical to say about the manuscript. I agree with the statistical methods used. I agree that these results are interesting and require in-vivo experimental testing to validate the authors' findings. The use of 16s for the sequencing is probably the greatest weakness. Using shotgun metagenomic sequencing might have given better resolution than the V3-V4 amplicon method and have provided more data on the function of the microbes in the rumen microbiome. Metagemome Assembled Genome (MAG) approaches might also have added better depth to the microbial data. But using 16s still gave interesting results. Reply: Thank you for your helpful suggestion. We fully understand that shotgun sequence is better to clarify the function of the microbes in the rumen. We plan to conduct in vivo experiment to investigate the effect of dietary CSFA on methane production and the rumen microbiome in Japanese Black cattle. We are going to use shotgun sequence in the experiment according to your suggestion. The Shannon index suggested good diversity but the rarefaction carried out limited the sample depth to 3966 which makes me wonder whether this was too low and the supplementary data shows a bunch of stuff with LSMeans. Reply: As you mentioned, the sample depth in our study was small. However, there have been many reports using less sampling depth than 3966. For example, Lourenco et al. (2019; Frontiers in Microbiology, 10: 1131), Acosta et al. (2019; PloS ONE, 15.2: e0228560) and Rubanov et al. (2019; Scientific Reports, 9.1: 1-8) used 3484, 3664, and 2500 as the sampling depth, respectively. It would be good to see the Shannon diversity graphed. Reply: Visualization of alpha diversity is an effective method to express the result clearly. So, we added the figure (Fig 1) and the legend and footnotes (Line 293-299), and deleted Table 4. Additionally, we renumbered all figures (Fig 1-5). Rarefaction may have reduced the accuracy and I am going to assume the authors tested it against DESeq etc. Reply: As you mentioned, rarefaction might reduce the accuracy. Therefore, according to your suggestion, we normalized the count matrices of taxa with a negative binomial distribution using DESeq2 and tested Shannon diversity. The value (mean ± SE) in CON, FAL, FAH, FUM and MON were 6.23±0.04, 5.71±0.07, 4.95±0.09, 5.61±0.07 and 5.12±0.05, respectively. The results were almost equivalent to those normalized using rarefaction (CON, 6.25±0.07; FAL, 5.73±0.08; FAH, 4.96±0.11; FUM, 5.62±0.07; MON, 5.22±0.07). The result indicates that the rarefaction had no effect on the accuracy in the present study. That aside, the methodology looked sound, the results and interpretation good. Use of V3-4 is recommended for rumen and Silva sequences also recommended. Statistically, the permutational multivariate analysis of variance (PERMANOVA) test was conducted on 999 permutations whereas our standard number we use is 10k. Reply: We agree with your comment. Using V3-V4 variable region and Silva sequences is reasonable to determine the rumen microbiota. As you mentioned, 9999 permutation is better to estimate p-value accurately. So, we conducted PERMANOVA using 9999 permutations, and the p-value was less than 0.05 like the result of PERMANOVA using 999 permutations. We changed the words “999 permutations” to “9999 permutations” in Materials and Methods section. (Line 229) Because I can’t find a reason to reject this manuscript I can only point out minor potential flaws that the authors may wish to remove by explaining or providing supplementary data. Reply: Thank you for giving us the insightful feedbacks to strengthen our manuscript. Submitted filename: Response to Reviewers PONE-D-20-14439.docx Click here for additional data file. 28 Oct 2020 Calcium salts of long-chain fatty acids from linseed oil decrease methane production by altering the rumen microbiome in vitro PONE-D-20-14439R1 Dear Dr. Kumagai, We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements. Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication. An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org. If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org. Kind regards, Brenda A Wilson, Ph.D. Academic Editor PLOS ONE Additional Editor Comments (optional): Reviewers' comments: Reviewer's Responses to Questions Comments to the Author 1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation. Reviewer #1: All comments have been addressed Reviewer #2: All comments have been addressed ********** 2. Is the manuscript technically sound, and do the data support the conclusions? The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1: (No Response) Reviewer #2: Yes ********** 3. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1: (No Response) Reviewer #2: Yes ********** 4. Have the authors made all data underlying the findings in their manuscript fully available? The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #1: (No Response) Reviewer #2: Yes ********** 5. Is the manuscript presented in an intelligible fashion and written in standard English? PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #1: (No Response) Reviewer #2: Yes ********** 6. Review Comments to the Author Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #1: (No Response) Reviewer #2: (No Response) ********** 7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: No Reviewer #2: Yes: Jane Adair Mullaney 30 Oct 2020 PONE-D-20-14439R1 Calcium salts of long-chain fatty acids from linseed oil decrease methane production by altering the rumen microbiome in vitro Dear Dr. Kumagai: I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department. If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org. If we can help with anything else, please email us at plosone@plos.org. Thank you for submitting your work to PLOS ONE and supporting open access. Kind regards, PLOS ONE Editorial Office Staff on behalf of Dr. Brenda A Wilson Academic Editor PLOS ONE
  65 in total

1.  Effects of long-chain Fatty acids on growth of rumen bacteria.

Authors:  A E Maczulak; B A Dehority; D L Palmquist
Journal:  Appl Environ Microbiol       Date:  1981-11       Impact factor: 4.792

2.  Determination of rumen fill, retention time and ruminal turnover rates of ingesta at different stages of lactation in dairy cows.

Authors:  G F Hartnell; L D Satter
Journal:  J Anim Sci       Date:  1979-02       Impact factor: 3.159

3.  Microbial ecology of the rumen evaluated by 454 GS FLX pyrosequencing is affected by starch and oil supplementation of diets.

Authors:  Asma Zened; Sylvie Combes; Laurent Cauquil; Jérôme Mariette; Christophe Klopp; Olivier Bouchez; Annabelle Troegeler-Meynadier; Francis Enjalbert
Journal:  FEMS Microbiol Ecol       Date:  2012-10-08       Impact factor: 4.194

4.  Reproducible, interactive, scalable and extensible microbiome data science using QIIME 2.

Authors:  Evan Bolyen; Jai Ram Rideout; Matthew R Dillon; Nicholas A Bokulich; Christian C Abnet; Gabriel A Al-Ghalith; Harriet Alexander; Eric J Alm; Manimozhiyan Arumugam; Francesco Asnicar; Yang Bai; Jordan E Bisanz; Kyle Bittinger; Asker Brejnrod; Colin J Brislawn; C Titus Brown; Benjamin J Callahan; Andrés Mauricio Caraballo-Rodríguez; John Chase; Emily K Cope; Ricardo Da Silva; Christian Diener; Pieter C Dorrestein; Gavin M Douglas; Daniel M Durall; Claire Duvallet; Christian F Edwardson; Madeleine Ernst; Mehrbod Estaki; Jennifer Fouquier; Julia M Gauglitz; Sean M Gibbons; Deanna L Gibson; Antonio Gonzalez; Kestrel Gorlick; Jiarong Guo; Benjamin Hillmann; Susan Holmes; Hannes Holste; Curtis Huttenhower; Gavin A Huttley; Stefan Janssen; Alan K Jarmusch; Lingjing Jiang; Benjamin D Kaehler; Kyo Bin Kang; Christopher R Keefe; Paul Keim; Scott T Kelley; Dan Knights; Irina Koester; Tomasz Kosciolek; Jorden Kreps; Morgan G I Langille; Joslynn Lee; Ruth Ley; Yong-Xin Liu; Erikka Loftfield; Catherine Lozupone; Massoud Maher; Clarisse Marotz; Bryan D Martin; Daniel McDonald; Lauren J McIver; Alexey V Melnik; Jessica L Metcalf; Sydney C Morgan; Jamie T Morton; Ahmad Turan Naimey; Jose A Navas-Molina; Louis Felix Nothias; Stephanie B Orchanian; Talima Pearson; Samuel L Peoples; Daniel Petras; Mary Lai Preuss; Elmar Pruesse; Lasse Buur Rasmussen; Adam Rivers; Michael S Robeson; Patrick Rosenthal; Nicola Segata; Michael Shaffer; Arron Shiffer; Rashmi Sinha; Se Jin Song; John R Spear; Austin D Swafford; Luke R Thompson; Pedro J Torres; Pauline Trinh; Anupriya Tripathi; Peter J Turnbaugh; Sabah Ul-Hasan; Justin J J van der Hooft; Fernando Vargas; Yoshiki Vázquez-Baeza; Emily Vogtmann; Max von Hippel; William Walters; Yunhu Wan; Mingxun Wang; Jonathan Warren; Kyle C Weber; Charles H D Williamson; Amy D Willis; Zhenjiang Zech Xu; Jesse R Zaneveld; Yilong Zhang; Qiyun Zhu; Rob Knight; J Gregory Caporaso
Journal:  Nat Biotechnol       Date:  2019-08       Impact factor: 54.908

5.  Evidence for the possible involvement of Selenomonas ruminantium in rumen fiber digestion.

Authors:  Suriya Sawanon; Satoshi Koike; Yasuo Kobayashi
Journal:  FEMS Microbiol Lett       Date:  2011-10-21       Impact factor: 2.742

6.  Presence of lactate dehydrogenase and lactate racemase in Megasphaera elsdenii grown on glucose or lactate.

Authors:  T Hino; S Kuroda
Journal:  Appl Environ Microbiol       Date:  1993-01       Impact factor: 4.792

7.  Long-term effects of feeding monensin on methane production in lactating dairy cows.

Authors:  N E Odongo; R Bagg; G Vessie; P Dick; M M Or-Rashid; S E Hook; J T Gray; E Kebreab; J France; B W McBride
Journal:  J Dairy Sci       Date:  2007-04       Impact factor: 4.034

8.  Development of a prokaryotic universal primer for simultaneous analysis of Bacteria and Archaea using next-generation sequencing.

Authors:  Shunsuke Takahashi; Junko Tomita; Kaori Nishioka; Takayoshi Hisada; Miyuki Nishijima
Journal:  PLoS One       Date:  2014-08-21       Impact factor: 3.240

9.  Response of fumaric Acid addition on methanogenesis, rumen fermentation, and dry matter degradability in diets containing wheat straw and sorghum or berseem as roughage source.

Authors:  S K Sirohi; Poonam Pandey; Navneet Goel
Journal:  ISRN Vet Sci       Date:  2012-04-17

10.  New roles in hemicellulosic sugar fermentation for the uncultivated Bacteroidetes family BS11.

Authors:  Lindsey M Solden; David W Hoyt; William B Collins; Johanna E Plank; Rebecca A Daly; Erik Hildebrand; Timothy J Beavers; Richard Wolfe; Carrie D Nicora; Sam O Purvine; Michelle Carstensen; Mary S Lipton; Donald E Spalinger; Jeffrey L Firkins; Barbara A Wolfe; Kelly C Wrighton
Journal:  ISME J       Date:  2016-12-13       Impact factor: 10.302

View more
  2 in total

1.  Aspergillus oryzae and Aspergillus niger Co-Cultivation Extract Affects In Vitro Degradation, Fermentation Characteristics, and Bacterial Composition in a Diet-Specific Manner.

Authors:  Fanlin Kong; Na Lu; Yanfang Liu; Shu Zhang; Hongqin Jiang; Haomin Wang; Wei Wang; Shengli Li
Journal:  Animals (Basel)       Date:  2021-04-26       Impact factor: 2.752

2.  Oregano Essential Oils Mediated Intestinal Microbiota and Metabolites and Improved Growth Performance and Intestinal Barrier Function in Sheep.

Authors:  Li Jia; Jianping Wu; Yu Lei; Fanyun Kong; Rui Zhang; Jianxiang Sun; Liao Wang; Zemin Li; Jinping Shi; Ying Wang; Yubing Wei; Ke Zhang; Zhaomin Lei
Journal:  Front Immunol       Date:  2022-07-12       Impact factor: 8.786

  2 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.