OTUB2 Promotes Homologous Recombination Repair Through Stimulating Rad51 Expression in Endometrial Cancer.

Genetic instability, raised from dysregulation of DNA repair, is involved in tumor development. OTUB2 (ovarian tumor domain protease domain-containing ubiquitin aldehyde-binding protein 2), which is responsible for DNA double-strand break (DSB), is implicated in carcinogenesis of various tumors. The effect of OTUB2 on endometrial cancer progression was then investigated. First, OTUB2 was found to be upregulated in endometrial cancer tissues and cell lines, and was closely associated with overall survival of endometrial cancer patients. Cell Counting Kit-8 and flow cytometry assay results revealed that overexpression of OTUB2 enhanced cell viability of endometrial cancer cells, while knockdown of OTUB2 inhibited cell viability. Moreover, as demonstrated by promoting cell viability and suppression of cell apoptosis, cisplatin-induced cell damage was reversed by OTUB2. Mechanistically, OTUB2 could activate Yes-associated protein/transcriptional co-activator with PDZ-binding motif (TAZ) to promote homologous recombination repair via depletion of γH2AX (phosphorylation of histone H2AX) and accumulation of Rad51. In vivo xenograft model also showed that silence of OTUB2 suppressed the growth of endometrial cancer and increased tumor sensitivity to antitumor drugs. In conclusion, OTUB2 promoted homologous recombination repair in endometrial cancer via YAP/TAZ-mediated Rad51 expression, providing a potential therapeutic target for endometrial cancer.

Introduction

Endometrial cancer is one of the most common gynecological malignancies in the world[1], which is caused by various risk factors, including obesity, diabetes, and nonantagonizing estrogen[2]. The incidence increases each year; however, endometrial cancer still lacks efficient therapeutic strategies[3,4]. Therefore, it is of great importance to identify molecular targets and new signaling pathways involved in endometrial cancer development.

Posttranslational modifications of proteins control the activity, stability, and subcellular localization of target proteins, and thus participate in multiple biological processes[5]. Protein ubiquitination, as a common modification via conjugation of ubiquitin on lysine residues to regulate degradation of target proteins, is mediated by ubiquitin–proteasome system and deubiquitinating enzymes (DUBs)[6,7]. OTUs (ovarian tumor-like proteases) are one of the six DUBs family, and are widely known as critical regulators of the cell cycle, DNA repair, and signaling pathways involved in cancer[8]. OTUB2 (ovarian tumor domain protease domain-containing ubiquitin aldehyde-binding protein 2), which belongs to OTUs superfamily, was first discovered in ovarian tumor gene from Drosophila melanogaster[9]. Currently, OTUB2 is reported to have a wide range of biological roles, including preventing virus induction[10] and promoting islet cell survival in the human pancreas[11]. Moreover, the regulatory ability of OTUB2 on tumorigenesis has been the focus of functional research. OTUB2 can promote the Warburg effect and tumorigenesis in nonsmall-cell lung cancer[12]. OTUB2 also promotes breast cancer metastasis[13]. Inhibition of OTUB2 suppresses the growth, proliferation, and invasion of papillary thyroid cancer cells[14]. However, the role of OTUB2 in endometrial cancer has not been reported.

DNA double-strand break (DSB) response (DDR) signaling is initiated by γH2AX, and then recruits E3 ubiquitin ligases, suggesting that DDR is regulated by ubiquitination[15]. Improper DSB repair may lead to gene mutations and chromosomal translocations[16], thus contributing to cancer development[17]. Therefore, the regulation of DSB repair is considered as an important strategy for tumor suppression. Rad51 can bind to single-strand DNA during error-free homologous recombination (HR) DSB repair pathways for annealing of DNA[18]. Overexpression of Rad51 in various tumors results in improper DSB repair and contributes to tumor progression and metastasis[19]. Polymorphism of Rad51 gene is associated with the occurrence of endometrial cancer[20]. Considering that OTUB2 depletion suppresses HR during DSB repair[21], OTUB2 may regulate endometrial cancer progression via Rad51-mediated HR repair. The present study aimed to evaluate the impact of OTUB2/Rad51 on endometrial cancer progression, and uncover its underlying mechanism, which might be beneficial for the development of novel endometrial cancer therapy.

Materials and Methods

Tissue Collection and Immunohistochemistry

Fifty-three endometrial cancer and endometrial cancer tissues were collected at the Second Affiliated Hospital of Xi’an Jiaotong University from the patients via surgery. The study was approved by the Biomedical Ethics Committee of Medical College of Xi’an Jiaotong University (Approval no. 2019-097), and all the patients signed written informed consent. Paraffin-embedded tissues with 4 µm thickness were dewaxed and rehydrated. After blocking in 2% goat serum, the sections were incubated overnight with primary rabbit antibodies against OTUB2, Ki67, Yes-associated protein (YAP), transcriptional co-activator with PDZ-binding motif (TAZ), and Rad51 (Abcam, Cambridge, MA, USA). After incubation with HRP (horseradish peroxidase)-conjugated goat anti-rabbit IgG secondary antibody (Abcam), the slides of tissues were counterstained with hematoxylin and examined under a light microscope (Olympus, Tokyo, Japan).

Cell Culture

Human endometrial cancer cell lines (Ishikawa, HEC-1-B, HEC-1-A, KLE, AN3-CA) and normal human endometrial epithelial cells (hEECs) were cultured in Dulbecco’s modified Eagle medium (DMEM) (Gibco; Thermo Fisher, Waltham, MA, USA) supplemented with 10% fetal bovine serum at 37°C constant temperature incubator with 5% CO2.

Cell Transfection and Treatment

Full length of OTUB2, YAP, YAP (S127A), TAZ, and TAZ (S89A) were cloned into pcDNA3.1 (AxyBio, Changsha, China). shRNAs (1# and 2#) targeting OTUB2 and the negative control (shNC) were synthesized by GenePharma (Shanghai, China). HEC-1-A or Ishikawa cells (1 × 106 cells/well ) were transfected with pcDNA3.1-OTUB2, YAP, YAP (S127A), TAZ, TAZ (S89A) or pcDNA3.1-NC, shOTUB2 1#, 2# or shNC using Lipofectamine® 3000 (Thermo Fisher). Two days after transfection, cells were collected for the following experiments.

To determine cisplatin-induced DNA damage, cells with different transfection were subsequently treated with 10 μM cisplatin for 24 h, and 2 d later, cells were also collected for functional assays.

Cell Counting Kit-8 Assay and Cell Survival Assay

HEC-1-A or Ishikawa cells (5 × 103 cells/well) with different transfection or cisplatin treatment were seeded, and incubated with 20 µl Cell Counting Kit-8 (CCK8) solution (Dojindo, Tokyo, Japan) at 6, 12, 24, 48, and 72 h point-in-time for 3 h. Optical density at 450 nm was measured by microplate Autoreader (BioTek, Winooski, VT, USA). For determination of half-maximal inhibitory concentration (IC50), HEC-1-A or Ishikawa cells transfected with pcDNA3.1-OTUB2, shOTUB2 1#/2#, or the corresponding negative control were cultured in medium containing 500, 200, 80, 32, 12.8, 5.12, 2.048, 0.8192, 0.32768, or 0.131072 μM cisplatin for 24 h. Two days later, cells were also incubated with CCK8 solution for 3 h, and then measured the optical density.

Flow Cytometry Analysis

HEC-1-A or Ishikawa cells transfected with pcDNA3.1-OTUB2, shOTUB2 1#/2#, or the corresponding negative control were subsequently treated with 10 μM cisplatin for 24 h. Two days later, cells (1 × 106) were collected after trypsin digestion, and then resuspended with 100 µl binding buffer (KeyGEN, Jiangning, Nanjing, China) containing 5 µl propidium iodide (100 µg/ml)with 1 U/mL ribonuclease in dark for 30 min. After incubation with 5 µl of fluorescein isothiocyanate-conjugated annexin V, cells were analyzed by fluorescence-activated cell sorting flow cytometer (Attune, Life Technologies, Darmstadt, Germany).

Immunofluorescence

HEC-1-A or Ishikawa cells transfected with pcDNA3.1-OTUB2, shOTUB2 1#/2#, or the corresponding negative control were subsequently treated with 10 μM cisplatin for 24 h. Two days later, cells were fixed in 4% formaldehyde, dehydrated with ethanol, and permeabilized in Triton X100. After blocking with goat serum, cells were incubated overnight with the anti-γH2AX and anti-Rad51 antibodies (Abcam) at 4°C. After incubation with rhodamine-conjugated secondary antibody, the cells were visualized via a fluorescence microscope (DMI4000B, Leica, Heidelberg, Germany) after nuclear staining with DAPI (4′,6-diamidino-2-phenylindole).

Luciferase Reporter Assay

Promoter of Rad51 was subcloned into pmirGLO (Promega, Madison, WI, USA) to construct Rad51 promoter luciferase vector. HEC-1-A or Ishikawa cells were co-transfected with Rad51 promoter luciferase vector with pcDNA3.1-OTUB2, shOTUB2 2#, shOTUB2 2# with pcDNA3.1-TAZ, shOTUB2 2# with pcDNA3.1-TAZ (S127A), shOTUB2 2# with pcDNA3.1-YAP, and shOTUB2 2# with pcDNA3.1-YAP (S89A). Two days later, the Rad51 luciferase activity in each group was assessed via Lucifer Reporter Assay System (Promega) with the average ratio of firefly to Renilla luciferase.

qRT-PCR (Quantitative Real-Time Reverse Transcription Polymerase Chain Reaction)

Trizol (Invitrogen, Carlsbad, CA, USA) was used to isolate RNAs. cDNAs were synthesized, and qRT-PCR analysis was conducted via SYBR green (Roche, Mannheim, Germany) under 95°C pre-denaturation for 10 min, 40 cycles with at 95 °C for 10 s, and at 60 °C for 60 s. Glyceraldehyde 3-phosphate dehydrogenase was used as an endogenous control. The relative expression level of target genes was calculated by the 2−△△Ct method. Primer sequences are listed in Table 1.

Table 1.

Primer sequences.

ID	Sequence(5′–3′)
GAPDH F	ACCACAGTCCATGCCATCAC
GAPDH R	TCCACCACCCTGTTGCTGTA
OTUB2 F	ACACTTGGAACCGGCTTGAC
OTUB2 R	AGCACACGGACTGTCCTGA
Rad51 F	AGCGTTCAACACAGACCACCAG
Rad51 R	ATCAGCGAGTCGCAGAAGCATC

GAPDH: glyceraldehyde 3-phosphate dehydrogenase.

Western Blot

Tissue or cell lysates were prepared using RIPA buffer (Sigma-Aldrich), and 30 µg total proteins in each sample were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. After transferred onto polyvinylidene fluoride membranes, the membranes were blocked with 5% bovine serum albumin, and then incubated overnight with primary anti-OTUB2, Rad51 (1:1,500, Abcam), anti-YAP, YAP (S127A) (1:2,000, Abcam), anti-TAZ, TAZ (S89A) (1:2,500, Abcam), and β-actin (1:3,000, Abcam) antibodies at 4°C. Finally, the immunoreactivities were detected by enhanced chemiluminescence (KeyGen) after incubating with an HRP-labeled secondary antibody (1:5,000; Abcam).

Mouse Xenograft Assay

All animal experiments were approved by the Biomedical Ethics Committee of Medical College of Xi’an Jiaotong University (Approval no. 2019-097) for the use of animals and conducted in accordance with the National Institutes of Health Laboratory Animal Care and Use Guidelines. Twenty-four female BALB/c nude mice (5 to 6 wk old, 18 to 20 g weight) were separated into four groups: shNC; shOTUB2; shNC with cisplatin; and shOTUB2 with cisplatin. Ishikawa (1 × 107 cells) transfected with shNC or shOTUB2 2# were suspended in serum-free DMEM, and then injected into the flank regions of nude mice. For shNC with cisplatin and shOTUB2 with cisplatin groups, mice were intraperitoneally injected with 2 mg/kg cisplatin every day for 6 d. Six days later, mice were anesthetized with 65 mg/kg sodium pentobarbital, and the tumor tissues were collected for analysis.

Statistical Analysis

Data were shown as mean ± standard deviation, and the statistical analysis was performed by the SPSS 19.0 (SPSS, Chicago, IL, USA). Student’s t-test was used to compare the difference between two groups, and one-way analysis of variance with Turkey’s test was used to compare the difference among multiple groups. P <0.05 was considered as statistically significant.

Results

OTUB2 Was Elevated in Endometrial Cancer Tissues and Cell Lines

The expression level of OTUB2 in endometrial cancer was first analyzed, and the result showed an elevated expression of OTUB2 in endometrial cancer tissues compared to adjacent noncancer tissues via qRT-PCR (Fig. 1A), immunohistochemistry (Fig. 1B), and western blot (Fig. 1C) analyses. In addition, Kaplan–Meier survival analysis (Fig. 1D) showed that high expression of OTUB2 was negatively correlated with the overall survival ratio of patients with endometrial cancer. Moreover, further refinement analysis of OTUB2 and clinicopathological parameters of endometrial cancer patients indicated that high expression of OTUB2 was significantly related to FIGO (International Federation of Gynecology and Obstetrics) stage (P = 0.008) and histological stage (P = 0.023) (Table 2), while it showed no significant correlation with other clinicopathological parameters including age (P = 0.497), pathological type (P = 0.140), and so on. The expression level of OTUB2 was also elevated in endometrial cancer cell lines (Ishikawa, HEC-1-B, HEC-1-A, KLE, AN3-CA) compared to hEEC (Fig. 1E).

Fig. 1.

OTUB2 was elevated in endometrial cancer tissues and cell lines. (A) Expression of OTUB2 in endometrial cancer tissues and adjacent noncancer tissues detected by qRT-PCR (N = 67). **represents cancer vs. noncancer tissues, P < 0.01. (B) Immunohistochemistry analysis of OTUB2 in endometrial cancer tissues and adjacent noncancer tissues. Scale bar: 100 μm. (C) Expression of OTUB2 in endometrial cancer tissues and adjacent noncancer tissues detected by western blot. (D) Kaplan–Meier survival analysis of endometrial cancer patients with high or low expression of OTUB2. (E) Expression of OTUB2 in endometrial cancer cell lines (Ishikawa, HEC-1-B, HEC-1-A, KLE, AN3-CA) and hEEC detected by qRT-PCR. *, **represent endometrial cancer cell lines vs. hEEC, P < 0.05, P < 0.01.

hEEC: human endometrial epithelial cells; OTUB2: ovarian tumor domain protease domain-containing ubiquitin aldehyde-binding protein 2; qRT-PCR: quantitative real-time reverse transcription polymerase chain reaction.

Table 2.

Relationship Between OTUB2 and Clinicopathological Parameters of Patients with Endometrial Cancer.

Parameters	Number of patients	OTUB2 expression		P-value
		Low (<median)	High (≥median)
Number	53	26	27
Age (years)
≥Mean (55)	35	16	19	0.497
<Mean (55)	18	10	8
FIGO stage
I–II	38	23	15	0.008*
III–IV	15	3	12
Pathological type
Endometrioid	45	24	21	0.140
Nonendometrioid	8	2	6
Histological grade
Grade 1	31	20	11	0.023*
Grade 2	16	5	11
Grade 3	6	1	5
LNM
Positive	11	3	8	0.104
Negative	42	23	19
LVS
Positive	18	6	12	0.101
Negative	35	20	15
Depth of myometrial invasion
≤1/2	38	21	17	0.150
>1/2	15	5	10
ER expression
Positive	11	3	8	0.104
Negative	42	23	19
PR expression
Positive	12	4	8	0.215
Negative	41	22	19

FIGO: International Federation of Gynecology and Obstetrics; ER: estrogen receptor; PR: progesterone receptor; LNM: lymph node metastases; LVS: lymph node metastases; OTUB2: ovarian tumor domain protease domain-containing ubiquitin aldehyde-binding protein 2.

OTUB2 Promoted Cell Proliferation and Inhibited Cisplatin Sensitivity

The effects of OTUB2 on tumor cell viability and apoptosis were analyzed via gain-of-function assays in HEC-1-A cells and loss-of-function assays in Ishikawa cells. Overexpression of OTUB2 and knockdown of OTUB2 were confirmed by qRT-PCR (Fig. 2A). Overexpression of OTUB2 in HEC-1-A cells promoted the cell viability, while OTUB2 knockdown in Ishikawa cells reduced the cell viability (Fig. 2B). To assess the effects of OTUB2 on the sensitivity of endometrial cancer cell lines to cisplatin treatment, HEC-1-A cells with OTUB2 overexpression and Ishikawa cells with OTUB2 knockdown were treated with different concentrations of cisplatin for 24 h, and then the cell viability was evaluated. OTUB2 overexpression inhibited the sensitivity of Ishikawa cells to cisplatin, as demonstrated by higher IC50 level than cells without cisplatin treatment (Fig. 2C). However, OTUB2 knockdown enhanced the sensitivity to cisplatin with lower IC50 level than cells without cisplatin treatment (Fig. 2C). Moreover, flow cytometry analysis showed that cisplatin promoted cell apoptosis in HEC-1-A and Ishikawa cells (Fig. 2D), while overexpression of OTUB2 inhibited the cell apoptosis and knockdown of OTUB2 aggravated the cell apoptosis (Fig. 2D). These findings suggested that OTUB2 promoted the survival of endometrial cancer cells exposed to DNA-damaging agent, cisplatin.

Fig. 2.

OTUB2 promoted cell proliferation and inhibited cisplatin sensitivity. (A) Transfection efficiency of pcDNA3.1-OTUB2 in HEC-1-A cells or shOTUB2 s in Ishikawa cells detected by qRT-PCR. **represents OTUB2 vs. Vector or shOTUB2 vs. shNC, P < 0.01. (B) Effect of OTUB2 on cell viability of HEC-1-A and Ishikawa cells detected by CCK8. **represents OTUB2 vs. Vector or shOTUB2 vs. shNC, P < 0.01. (C) Effect of OTUB2 on sensitivity of HEC-1-A or Ishikawa cells to cisplatin detected by CCK8 and the IC50 value was calculated. (D) Effect of OTUB2 on cell apoptosis of HEC-1-A or Ishikawa cells to cisplatin detected by flow cytometry. **represents cisplatin vs. control or cisplatin + OTUB2 vs. cisplatin + Vector or cisplatin + shOTUB2 2# vs. cisplatin + shNC, P < 0.01.

CCK8: Cell Counting Kit-8; OTUB2: ovarian tumor domain protease domain-containing ubiquitin aldehyde-binding protein 2; qRT-PCR: quantitative real-time reverse transcription polymerase chain reaction.

OTUB2 Promoted HR of DNA-Damaging Endometrial Cancer Cells

The role of OTUB2 in protection of endometrial cancer cells from DNA damage was determined by assessing protein expression involved in DSB repair pathways. Immunofluorescence staining (Fig. 3) showed that overexpression of OTUB2 decreased DNA damage compared to cisplatin-treated control cells, as deciphered by decrease in γH2AX. Knockdown of OTUB2 increased γH2AX (Fig. 3), indicating enhanced DNA damage. Moreover, OTUB2 overexpression resulted in increased Rad51 abundance (Fig. 3), while OTUB2 knockdown demonstrated the opposite effect on Rad51 (Fig. 3), suggesting that OTUB2 promoted HR of DNA damage in endometrial cancer cells.

Fig. 3.

OTUB2 promoted homologous recombination of DNA-damaging endometrial cancer cells. Effect of OTUB2 on γH2AX and Rad51 foci of HEC-1-A or Ishikawa cells to cisplatin detected by immunofluorescence. **represents cisplatin vs. control or cisplatin + OTUB2 vs. cisplatin + Vector or cisplatin + shOTUB2 2# vs. cisplatin + shNC, P < 0.01.

DAPI: 4′,6-diamidino-2-phenylindole; OTUB2: ovarian tumor domain protease domain-containing ubiquitin aldehyde-binding protein 2.

YAP/TAZ Was Involved in Protection of OTUB2 Against Cisplatin-Induced DNA Damage in Endometrial Cancer Cells

Signaling pathways involved in the regulatory role of OTUB2 on DNA damage of endometrial cancer cells were then evaluated. First, overexpression of OTUB2 increased the expression of YAP and TAZ in HEC-1-A cells (Fig. 4A), while knockdown of OTUB2 decreased the expression of YAP and TAZ in Ishikawa cells (Fig. 4A), suggesting the regulatory role of OTUB2 on YAP/TAZ. Ishikawa cells were then transfected with vectors for the overexpression of YAP, YAP mutant (S127A), and TAZ and TAZ mutant (S89A) (Fig. 4B). CCK8 assay results showed that overexpression of YAP or TAZ promoted OTUB2 interference-inhibited cell viability (Fig. 4C), while the mutants (S127A or S89A), which were resistant to inhibitory phosphorylation at the sites, diminished the increased cell viability induced by YAP or TAZ overexpression (Fig. 4C). At last, DNA damage induced by cisplatin in Ishikawa cells was then assessed. Overexpression of YAP or TAZ reversed OTUB2 interference-induced increase of γH2AX and decrease of Rad51 (Fig. 4D), while the mutants (S127A or S89A) attenuated the decreased γH2AX and increased Rad51 observed upon YAP or TAZ overexpression (Fig. 4D). Together, these results provided evidence that OTUB2 protected endometrial cancer cells from cisplatin-induced DNA damage via YAP/TAZ pathway.

Fig. 4.

YAP/TAZ was involved in protection of OTUB2 against cisplatin-induced DNA damage in endometrial cancer cells. (A) Effect of OTUB2 on protein expression of YAP and TAZ detected by western blot. **represents OTUB2 vs. Vector or shOTUB2 vs. shNC, P < 0.01. (B) Transfection efficiency of pcDNA3.1-YAP, YAP (S127A), TAZ, TAZ (S89A) in Ishikawa cells detected by western blot. *, **represent YAP, YAP (S127A), TAZ, TAZ (S89A) vs. Vector, P < 0.05, P < 0.01. (C) Effect of OTUB2 and YAP, YAP (S127A), TAZ, TAZ (S89A) on cell viability of Ishikawa cells to cisplatin detected by CCK8. **represents cisplatin + shOTUB2 + Control vs. cisplatin + shOTUB2 + YAP, cisplatin + shOTUB2 + TAZ or cisplatin + shNC + Control, P < 0.01. (D) Effect of OTUB2 and YAP, YAP (S127A), and TAZ, TAZ (S89A) on cell apoptosis of Ishikawa cells to cisplatin detected by flow cytometry. **represents cisplatin + shOTUB2 + Control vs. cisplatin + shOTUB2 + YAP, cisplatin + shOTUB2 + TAZ or cisplatin + shNC + Control, P < 0.01.

CCK8: Cell Counting Kit-8; OTUB2: ovarian tumor domain protease domain-containing ubiquitin aldehyde-binding protein 2; TAZ: transcriptional co-activator with PDZ-binding motif; YAP: Yes-associated protein.

OTUB2 Contributed to Rad51 Expression via YAP/TAZ

As YAP/TAZ was involved in OTUB2-mediated cell viability and DNA damage repair in endometrial cancer cells, the potential contribution of YAP/TAZ to HR was then evaluated. Rad51 mRNA (Fig. 5A) and protein (Fig. 5B) expressions were increased in HEC-1-A cells with OTUB2 overexpression after exposed to cisplatin, while the expression of Rad51 was decreased in Ishikawa cells with OTUB2 knockdown after exposed to cisplatin. Luciferase reporter assay showed that OTUB2 increased luciferase activity of Rad51-promoter-luciferase reporter construct, while OTUB2 knockdown decreased the luciferase activity (Fig. 5C). Moreover, overexpression of YAP or TAZ reversed OTUB2 interference-induced decrease in Rad51 (Fig. 5D, E), while the mutants (S127A or S89A) attenuated the increased Rad51 observed upon YAP or TAZ overexpression (Fig. 5D, E). OTUB2 knockdown-induced decrease of luciferase activity of Rad51 promoter was reversed by overexpression of YAP or TAZ (Fig. 5F), while the mutants (S127A or S89A) attenuated the increased luciferase activity induced by YAP or TAZ overexpression (Fig. 5F). In conclusion, OTUB2 facilitated YAP/TAZ-mediated Rad51 expression in endometrial cancer.

Fig. 5.

OTUB2 contributed to Rad51 expression via YAP/TAZ. (A) Effect of OTUB2 on mRNA expression of Rad51 detected by qRT-PCR. **represents OTUB2 vs. Vector or shOTUB2 vs. shNC, P < 0.01. (B) Effect of OTUB2 on protein expression of Rad51 detected by western blot. **represents OTUB2 vs. Vector or shOTUB2 vs. shNC, P < 0.01. (C) Effect of OTUB2 on mRNA expression luciferase activity of Rad51 promoter detected by luciferase reporter assay. **represents OTUB2 vs. Vector or shOTUB2 vs. shNC, P < 0.01. (D) Effect of OTUB2 and YAP, YAP (S127A), and qTAZ, TAZ (S89A) on mRNA expression of Rad51 detected by qRT-PCR. **represents shOTUB2 + Control vs. shOTUB2 + YAP, shOTUB2 + TAZ or shNC + Control, P < 0.01. (E) Effect of OTUB2 and YAP, YAP (S127A), and TAZ, TAZ (S89A) on protein expression of Rad51 detected by western blot. **represents shOTUB2 + Control vs. shOTUB2 + YAP, shOTUB2 + TAZ or shNC + Control, P < 0.01. (F) Effect of OTUB2 and YAP, YAP (S127A), and TAZ, TAZ (S89A) on luciferase activity of Rad51 promoter detected by luciferase reporter assay. **represents shOTUB2 + Control vs. shOTUB2 + YAP, shOTUB2 + TAZ or shNC + Control, P < 0.01.

CCK8: Cell Counting Kit-8; OTUB2: ovarian tumor domain protease domain-containing ubiquitin aldehyde-binding protein 2; TAZ: transcriptional co-activator with PDZ-binding motif; YAP: Yes-associated protein.

OTUB2 Knockdown Inhibited In Vivo Endometrial Cancer Growth and Promoted Cisplatin Sensitivity

In vivo xenograft model was established to investigate the role of OTUB2 in endometrial cancer. Mice injected with Ishikawa cells transfected with shOTUB2 2# (shOTUB2) demonstrated smaller tumor than shNC (Fig. 6A), as deciphered by decreased tumor volume and weight (Fig. 6A). Moreover, intraperitoneal injection of cisplatin aggravated the inhibitory effect of shOTUB2 on tumor growth (Fig. 6A), suggesting that OTUB2 knockdown promoted cisplatin sensitivity and inhibited in vivo endometrial cancer growth. Immunohistochemistry analysis showed that the expression of OTUB2 was decreased in mice injected with Ishikawa cells transfected with shOTUB2 (Fig. 6B). Ki67, YAP, TAZ, and Rad51 were decreased in mice injected with Ishikawa cells transfected with shOTUB2 compared to shNC (Fig. 6B). Intraperitoneal injection of cisplatin aggravated the decrease of Ki67, YAP, TAZ, and Rad51 induced by cisplatin treatment (Fig. 6B).

Fig. 6.

OTUB2 knockdown inhibited in vivo endometrial cancer growth and promoted cisplatin sensitivity. (A) Effect of OTUB2 and cisplatin on endometrial cancer tumor growth, volume, and weight. ** represents shOTUB2, shNC + cisplatin or shOTUB2 + cisplatin vs. shNC, P < 0.01. (B) Immunohistochemistry analysis of OTUB2, Ki67, YAP, TAZ, and Rad51 in tissues of mice injected with Ishikawa cells transfected with shOTUB2 or intraperitoneal injection with cisplatin.

OTUB2: ovarian tumor domain protease domain-containing ubiquitin aldehyde-binding protein 2; TAZ: transcriptional co-activator with PDZ-binding motif; YAP: Yes-associated protein.

Discussion

Depletion of adapter protein of E3 ubiquitin ligase promotes endometrial cancer cell growth[22]. Inhibition of ubiquitination leads to stabilization, increases prohibition, and facilitates endometrial cancer cell proliferation[23]. In addition, deubiquitination is implicated in sensitization of endometrial cancer cells to estrogen[24]. OTUB2, as a common DUB, can regulate deubiquitination of phosphoglycerate kinase 1 or phosphoglycerate mutase 1 to enhance aerobic glycolysis, leading to tumorigenesis of nonsmall-cell lung cancer[12]. This study was then conducted to evaluate the potential effect and mechanism of OTUB2 on endometrial cancer.

An upregulation of OTUB2 was first observed, and shown to be related with poor prognosis of endometrial cancer in this study, suggesting a potential role of OTUB2 as a prognostic biomarker for endometrial cancer. Moreover, consistent with the clinical results of OTUB2 in endometrial cancer, in vitro functional assays indicated that overexpression of OTUB2 promoted cell viability of endometrial cancer cells, while knockdown of OTUB2 inhibited cell viability. In vivo xenograft model also revealed that interference of OTUB2 suppressed tumorigenic ability of endometrial cancer. However, due to the lack of regulatory ability of OTUB2 on migration and invasion of endometrial cancer cells, whether OTUB2 promoted endometrial cancer progression will be explored in the further study.

Previous study has shown that DSB repair contributes to cancer development and provides an important avenue for cancer therapy[25]. Many genes involved in DNA repair are associated with endometrial cancer occurrence[26], and DNA mismatch repair is an important risk factor for endometrial cancer development[27]. Therefore, DNA damage repair is closely associated with endometrial cancer. Moreover, silence of OTU deubiquitinase 4 can inhibit DNA repair and contribute to radiotherapy of nonsmall-cell lung cancer[28]. OTUB2 can initiate DDR via deubiquitination of E3 ubiquitin ligase RING finger protein 8[29]. We hypothesized that OTUB2 may regulate endometrial cancer development via DDR. First, cisplatin, an anticancer agent via damaging DNA[30], was used in the present study to induce DSB in endometrial cancer cells. Secondly, CCK8 and flow cytometry results showed that OTUB2 overexpression inhibited sensitivity of Ishikawa cells to cisplatin, while OTUB2 knockdown enhanced the sensitivity of Ishikawa cells to cisplatin. Taken together, we demonstrated that DNA repair is involved in OTUB2-mediated endometrial cancer cell survival.

Generally, HR and nonhomologous end joining (NHEJ) repair are the two major repair mechanisms for DSB[31]. NHEJ directly ligates two broken ends of DSBs, while HR is operated by duplicating genetic information from the opposite sister chromatids[32]. Chromatin loading of Rad51 is the key event during HR[33]. Previous study has shown that OTUB2 can initiate HR during DDR[29], while HR is suppressed in OTUB2-depleted cells[21]. Overexpression of OTUB2 increased the mRNA and protein expression of Rad51, as well as Rad51 foci, while knockdown of OTUB2 decreased the mRNA and protein expression of Rad51, as well as Rad51 foci, suggesting that OTUB2 promoted HR of DNA-damaging endometrial cancer cells. However, the effect of OTUB2 knockdown on key proteins involved in NHEJ of endometrial cancer, including 53BP1 (tumor protein p53 binding protein 1) or RAP80 (receptor-associated protein 80)[34], should also be investigated in the further study.

YAP/TAZ, key downstream effectors of Hippo signaling pathway, is phosphorylated by Hippo activation and then leads to cytosolic sequestration and degradation during cancer suppression[35]. Moreover, YAP and TAZ function as oncogenes via translocation into nucleus during cancer metastasis[36]. OTUB2 deubiquitinates YAP/TAZ for cancer metastasis[37], and YAP/TAZ-mediated Rad51 expression facilitates for HR during resistance to platinum chemotherapy[38]. Therefore, YAP/TAZ signaling pathway might be involved in OTUB2-mediated HR in endometrial cancer. Our results showed that OTUB2 promoted the protein expression of YAP and TAZ. Recently, YAP/TAZ is found to be associated with endometrial cancer progression[39,40]. Inhibition of YAP/TAZ, which mimics activation of Hippo signaling pathway, suppresses in vivo endometrial cancer tumor growth[40]. Knockdown of OTUB2 decreased the protein expression of YAP and TAZ in the present study, thus indicating its inhibitory role on endometrial cancer tumor growth. Furthermore, overexpression of YAP or TAZ reversed OTUB2 knockdown-enhanced sensitivity to cisplatin, which was diminished by mutants (S127A or S89A) resistant to inhibitory phosphorylation. Moreover, overexpression of YAP or TAZ also reversed OTUB2 interference-induced increase of γH2AX and decrease of Rad51 in endometrial cancer cells exposed to cisplatin. Together, the results provided evidence that OTUB2 protected endometrial cancer cells from DNA damage caused by cisplatin via YAP/TAZ-mediated HR.

Conclusion

OTUB2 promoted HR repair through stimulating YAP/TAZ-mediated Rad51 expression in endometrial cancer, suggesting that OTUB2 might serve as a potential candidate for endometrial cancer therapy.

Click here for additional data file.

CLL931433_Supplementary_files for OTUB2 Promotes Homologous Recombination Repair Through Stimulating Rad51 Expression in Endometrial Cancer by Qiuyuan Wan, Qing Chen, Dongge Cai, Yan Zhao and Xiaoling Wu in Cell Transplantation