Portable and accurate diagnostics for COVID-19: Combined use of the miniPCR thermocycler and a well-plate reader for SARS-CoV-2 virus detection.

The coronavirus disease 2019 (COVID-19) pandemic has crudely demonstrated the need for massive and rapid diagnostics. By the first week of July, more than 10,000,000 positive cases of COVID-19 have been reported worldwide, although this number could be greatly underestimated. In the case of an epidemic emergency, the first line of response should be based on commercially available and validated resources. Here, we demonstrate the use of the miniPCR, a commercial compact and portable PCR device recently available on the market, in combination with a commercial well-plate reader as a diagnostic system for detecting genetic material of the severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), the causal agent of COVID-19. We used the miniPCR to detect and amplify SARS-CoV-2 DNA sequences using the sets of initiators recommended by the World Health Organization (WHO) for targeting three different regions that encode for the N protein. Prior to amplification, samples were combined with a DNA intercalating reagent (i.e., EvaGreen Dye). Sample fluorescence after amplification was then read using a commercial 96-well plate reader. This straightforward method allows the detection and amplification of SARS-CoV-2 nucleic acids in the range of ~625 to 2×105 DNA copies. The accuracy and simplicity of this diagnostics strategy may provide a cost-efficient and reliable alternative for COVID-19 pandemic testing, particularly in underdeveloped regions where RT-QPCR instrument availability may be limited. The portability, ease of use, and reproducibility of the miniPCR makes it a reliable alternative for deployment in point-of-care SARS-CoV-2 detection efforts during pandemics.

Introduction

Recent epidemic events (i.e., Zika in Southeast Asia and Latin-America in 2016 [1,2], Ebola in West Africa in 2013–2015 [3], and pandemic Influenza A/H1N1/2009 [4]) have clearly evidenced the urgent need for low-cost, portable, and easy-to-use diagnostic systems that can be effectively deployable to address epidemic episodes [5-8]. However, these portable diagnostic systems have been mainly viewed as solutions for underprivileged or remote places and/or for catastrophic scenarios. Nevertheless, the coronavirus disease 2019 (COVID-19) pandemic caused by the severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) [9] has broadsided most well developed and developing countries with only a few (i.e., South Korea [10], China, Singapore [11], and Taiwan [12]) showing an ability to deploy massive efforts for rapid and accurate detection of positive infection cases. The swift and massive testing of thousands of possibly infected subjects has been an important component of the strategy of these countries that has helped to effectively mitigate the spreading of COVID-19 among their populations [10,12-14]. And yet, most nations are still struggling to implement massive testing [15-17]. Current testing methods have exhibited important limitations in widespread reach, flexibility, cost-effectiveness, and scalability during this pandemic.

Through the last two pandemic events involving influenza A/H1N1/2009 and COVID-19 [18], the Centers for Disease Control (CDC) and the World Health Organization (WHO) recommended the reverse transcription quantitative polymerase chain reaction (RT-qPCR) as the gold standard for official detection of positive cases. Without any doubt, nucleic acid amplification, and particularly RT-qPCR, is the most reliable technique for the early and accurate detection of viral diseases [19,20]. Unfortunately, conducting RT-qPCR diagnostics often depends on access to centralized laboratory facilities for testing [21-23]. To resolve this limitation, several different versions of compact PCR platforms (some of them q-PCR systems) have been described recently in the scientific literature [24-27]. Unfortunately, most of these devices have not yet reached the market. During epidemic emergencies, resourcing of incompletely developed technologies is impractical, and the use of commercially available diagnostic platforms becomes the first and arguably the most cost-efficient line of defense.

Only recently, several miniaturized PCR machines become commercially available [28,29]. One of them, the miniPCR [30,31], reached the international market in 2015. The most recent version of this compact PCR machine has an approximate cost of ~$800 USD (www.minipcr.com) as compared to $3000 USD for a conventional PCR thermocycler [28]. Several papers have documented the value of the miniPCR® system as a portable and robust diagnostic tool [32-36]. We recently published a comparison of the performance of the miniPCR and a commercial thermal cycler for the identification of artificial Zika and Ebola genetic sequences. Our experiments using a wide variety of primers sets and template concentrations revealed no differences in performance between either thermal cycler type [37]. The commercial availability, low price (as compared to conventional thermocyclers), portability, and user friendliness of the miniPCR makes it an attractive and tangible solution that effectively brings PCR analysis to the POC. In the present study, we demonstrate the convenience of using the miniPCR for the detection and amplification of synthetic samples of SARS-CoV-2 [18], the causal viral agent of the current COVID-19 pandemic.

Materials and methods

Equipment specifications

We ran several sets of amplification experiments in a miniPCR from Amplyus (MA, USA). The unit has dimensions of 20 × 5 × 15 cm, weighs 0.7 kg, and requires 120V (AC) and 3.5 A to operate. The miniPCR can run 8–16 amplifications in parallel (depending on the model employed).

A commercial power supply (PowerPac from Bio-Rad, CA, USA) was used to operate the electrophoresis unit used to run the agarose gels to reveal the amplification products obtained by the miniPCR thermocycler. A Bio-Rad ChemiDoc XRS imaging system was used for end-point PCR detection. Alternatively, the miniPCR unit has its own blueGel electrophoresis unit (Fig 1A and 1B), a compact electrophoresis unit (23 × 10 × 7 cm) that weighs 350 g, that is powered by a built-in power supply (AC 100–240 V, 50–60 Hz).

Fig 1

Equipment and initiators for SARS-CoV-2 detection using a miniPCR.

A) The miniPCR® thermocycler. (B) The blueGel® electrophoresis chamber: blueGel® allows visualization of a 15 ml agarose gel using an integrated blue LED array. (C) Agarose gel electrophoresis of the SARS-CoV-2 amplification products. (D) Commercial 96-well plate with COVID-19 controls (artificial DNA samples). (E) Temperature cycling scheme used in our PCR protocol. (F) Three different sets of primers were used to target a gene sequence encoding the SARS-CoV-2 N protein.

We also used a Synergy HT microplate reader (BioTek Instruments, VT, USA) to detect the fluorescence induced by an intercalating reagent in positive samples from the PCR reactions.

Controls for validation

We used a plasmid containing the complete N gene from 2019-nCoV, SARS, and MERS as positive controls at a concentration of 200,000 copies/μL (Integrated DNA Technologies, IA, USA). Samples containing different concentrations of synthetic nucleic acids of SARS-CoV-2 were prepared by successive dilutions from stocks containing 200,000 copies mL-1 ng/L of viral nucleic acids. We used a plasmid containing the GP gene from Ebola Virus (EBOV) as a negative control. The production of this EBOV genetic material has been documented previously by our group [37].

Amplification mix

We used REDTaq Ready Mix from Sigma-Aldrich (USA), and followed the recommended protocol: 10 μL Readymix, 0.5 μM of forward primer, 0.5 μM of reverse primer,1μL of DNA template (~ 625 to 2x105 DNA copies), 1μl of EvaGreen Dye, and nuclease free water to final volume of reaction 20 μL.

Primers used

Three different sets of primers were used to target three different regions of the SARS-CoV-2 N gene sequence. These primer sets are identical to those recommended by the Center of Disease Control (CDC) for the standard diagnostics of COVID-19 (i.e., N1, N2, and N3 assays) using quantitative real time PCR. Sequences of all these primers and their corresponding amplicons are presented in Tables 1 and 2.

Table 1

Primer sequences used in PCR amplification experiments.

Name	Description	Primers Sequence (5’>3’)
2019-nCoV_N1-F	2019-nCoV_N1 Forward Primer	5’-GAC CCC AAA ATC AGC GAA AT-3’
2019-nCoV_N1-R	2019-nCoV_N1 Reverse Primer	5’-TCT GGT TAC TGC CAG TTG AAT CTG-3’
2019-nCoV_N2-F	2019-nCoV_N2 Forward Primer	5’-TTA CAA ACA TTG GCC GCA AA-3’
2019-nCoV_N2-R	2019-nCoV_N2 Reverse Primer	5’-GCG CGA CAT TCC GAA GAA-3’
2019-nCoV_N3-F	2019-nCoV_N3 Forward Primer	5’-GGG AGC CTT GAA TAC ACC AAA A-3’
2019-nCoV_N3-R	2019-nCoV_N3 Reverse Primer	5’-TGT AGC ACG ATT GCA TTG-3’

Table 2

Amplicon sequences generated (and their corresponding lengths) by each of the primer pairs used in the PCR amplification experiments.

Primer pair	Amplicon sequence	Amplicon Length (nt)
N1	GACCCCAAAATCAGCGAAATGCACCCCGCATTACGTTTGGTGGACCCTCAGATTCAACTGGCAGTAACCAGA	72
N2	TTACAAACATTGGCCGCAAATTGCACAATTTGCCCCCAGCGCTTCAGCGTTCTTCGGAATGTCGCGC	67
N3	GGGAGCCTTGAATACACCAAAAGATCACATTGGCACCCGCAATCCTGCTAACAATGCTGCAATCGTGCTACA	72

Amplification protocols

For all PCR experiments, we used the same three-stage protocol (see Fig 1D) consisting of a denaturation stage at 94°C for 5 min, followed by 25 cycles of 94°C for 20s, 60°C for 30s, and 72°C for 20s, and then a final stage at 72°C for 5 min, for a total duration of 60 minutes in the miniPCR® thermocycler.

Documentation of PCR products

We analyzed 10 μL of each PCR product using 2% agarose electrophoresis in Tris-acetic acid-EDTA (TAE) buffer (Sigma-Aldrich, MO, USA). Gels were dyed with GelGreen (Biotium, CA, USA) using a 1:10,000 dilution and a current of 110 V supplied by a Bio-Rad PowerPac HC power supply (Bio-Rad, CA, USA) for 40 min. We used the Quick-Load Purple 2-Log DNA ladder (NEB, MA, USA) as a molecular weight marker. We analyzed the gels by UV transillumination using a Bio-Rad ChemiDoc XRS imaging system. In some of our experiments, we also used the blueGel unit, a portable electrophoresis unit sold by MiniPCR from Amplyus (MA, USA). In these experiments, we analyzed 10 μL of PCR product using 2% agarose electrophoresis tris-borate-EDTA buffer (TBE). Gels were dyed with Gel- Green (CA, USA) using a 1:10,000 dilution, and a current of 48 V was supplied. Photo-documentation was done using a smartphone camera. As a third method of detection and to read the amplification product, we evaluated the amplification products by detecting the fluorescence emitted by a DNA intercalating agent, the EvaGreen® Dye, in the Synergy HT microplate reader (BioTek Instruments, VT, USA). Briefly, 20 μL of the PCR reaction mix was placed in distinct wells of a 96-well plate, after completion of the PCR program. Each well was made to a final volume of 150 μL by adding 130 μL of nuclease free water and the samples were well mixed by pipetting. These experiments were run in triplicate. The following conditions were used in the microplate reader: excitation of 485/20, emission of 528/20, gain of 75. Fluorescence readings were made from the above at room temperature.

Statistical analysis

Determination of mean values and standard deviations were conducted using Excel tools. All experiments were run by triplicate. Regression analysis was conducted in Excel.

Results and discussion

Time is the most limiting factor in epidemic emergencies. Therefore, the integration of well-developed and commercially available technologies [31,37,38] becomes an obvious, expedient, and cost-effective first line of defense in the context of COVID-19 pandemics. Here, we demonstrate that the combined use of a commercial and portable PCR unit (the miniPCR) and a 96-well plate reader is potentially adequate for the fast deployment of diagnostic efforts. We show the combined ability of both units to amplify and identify different synthetic genetic sequences of SARS-CoV-2 (see Materials and Methods).

Analysis of sensitivity

We conducted a series of experiments to assess the sensitivity of the PCR reactions conducted in the miniPCR thermocycler using the three sets of primers recommended by CDC to diagnose infection by SARS-CoV-2. Table 1 shows the sets of primers used to target genetic sequences that code for the expression of the SARS-CoV-2 N protein. Table 2 shows the sequence of the DNA products (amplicons) generated by successful targeting of these regions with the N1, N2, and N3 primer pairs.

Fig 2A–2C show the PCR products of the amplification reactions conducted using three different primer pairs. In all cases, different concentrations of SARS-CoV-2 genetic material, in the range of 2.0 × 105 to 625 DNA copies, were used as reaction templates. If we put this range in the proper clinical context, the actual viral load of COVID-19 in nasal swabs from patients has been estimated to fall within the range of 105 to 106 viral copies per mL [18]. The amplification proceeds with sufficient quality to allow proper visualization of the amplification products in electrophoresis gels, even at low nucleic acid concentrations. Fig 2A–2C shows agarose gels containing the amplification products of each one of three experiments, where the three different sets of primers (namely N1, N2, and N3) were used to amplify the same range of concentrations of template. The miniPCR® was able to generate a visible band of amplification products for all three primer sets and across the whole range of synthetic viral loads.

Fig 2

Evaluation of the sensitivity of the combined use of a miniPCR® thermal cycler (for amplification) and a plate reader (for determination of the amplification extent).

(A-C) Sensitivity trials using different concentrations of the template (positive control) and three different primers sets (A) N1, indicated in blue; (B) N2, indicated in red; and (C) N3, indicated in yellow. Images of agarose gel electrophoresis of the DNA amplification product generated by targeting three different regions of the sequence coding for SARS-CoV-2 N protein. PCR was performed using a miniPCR® thermocycler. Three different primer sets were used (N1, N2, and N3). The initial template amount was gradually increased from left to right: negative control (lane 1), 625 copies (lane 2), 2.5 × 103 (lane 3), 1.0 × 104 (lane 4), repetition of 1.0 × 104 (lane 5), 4.0 × 104 (lane 6), 2.0 × 105 DNA copies (lane 7), and molecular weight ladder (lane 8). (D-F) Determination of fluorescence, as measured in a commercial plate reader, for different dilutions of SARS-CoV-2 synthetic DNA templates. Results using three different primer sets are shown: (A) N1, indicated in blue; (B) N2, indicated in red; and (C) N3, indicated in yellow. (G) Summary and comparison of fluorescence readings form synthetic samples of SARS-CoV-2 in a wide span of dilutions. Results using three different primer sets are shown: (A) N1, indicated in blue; (B) N2, indicated in red; and (C) N3, indicated in yellow.

In general, the products of amplification in final point PCR are primarily detected on agarose gels using conventional electrophoresis techniques conducted with conventional lab equipment. The miniPCR® system is commercialized with its own electrophoretic unit (“blueGel®”; Fig 1B and 1C). The blueGel® has several important advantages and represents a valid and portable solution for detecting PCR amplification products. Nevertheless, running an experiment aimed at visualizing amplification products, as with any standard gel electrophoresis procedure requires time. A good separation of bands typically involves a processing time of 35 to 60 minutes from the loading of the amplification product to the final documentation through photography.

As an alternative, we show here that the amount of amplification product can be quantitatively evaluated using a commercial 96-well plate reader. To do this, we used an intercalating agent during amplification in the miniPCR apparatus. Fig 2D–2F shows the fluorescence readings associated with the analysis of the different dilutions of synthetic SARS-CoV-2 samples previously revealed by gel electrophoresis (S1 Fig, S2 Fig and S3 Fig). We ran triplicate reactions for each dilution and for each primer data set. The fluorescence readings were capable of clearly discriminating between positive and negative samples across the whole range of dilutions tested (from 2 × 105 to 625 copies). This observation holds true for each of the three primer sets tested. Note that the use of a plate reader, instead of a conventional gel electrophoresis unit, presupposes a significant savings in time. Up to 96 PCR reactions can be read in a matter of 5 to 10 minutes. This implies that an array of 12 miniPCR units and a plate reader could equal the throughput of a traditional RT-QPCR platform, but at one third of the capital cost. In addition, during emergencies and particularly in developing countries, attaining or buying regular thermal cyclers and plate readers is much easier than purchasing or accessing RT-qPCR systems.

In addition, our results suggest that fluorescence readings using a plate reader exhibit high reproducibility and robustness. Overall, we obtained small standard deviations (in the range of 6 to 40 arbitrary fluorescence units [a.f.u.]) and a small average variance coefficient (2.6%) in fluorescence readings across the whole range of values of viral copies tested. We observed similar variability indicators in experiments using different primer pairs. For instance, we observed variance coefficients of 2.31%, 2.15%, and 3.34% when using primer sets N1, N2, and N3, respectively. If we considered only fluorescence readings from positive samples, we observed variance coefficients of 2.23%, 2.34%, and 1.31% when using primer sets N1, N2, and N3, respectively.

Fig 2G consolidates the fluorescence readings obtained from miniPCR amplifications using synthetic SARS-CoV-2 samples and the primer sets N1 (blue bars), N2 (red bars), and N3 (yellow bars). Overall, this data set is consistent. These results suggest that any of the primer sets tested (N1, N2, or N3) may be used to amplify SARS-CoV-2 genetic material in the miniPCR. However, for the experimental conditions tested (i.e., the nature and concentration of the intercalating agent, the concentrations of primers, and the concentration of enzyme, among others), we observe differences in the performance of each primer pair. For example, primer sets N1 and N3 appear to promote amplifications in which the observed fluorescence is proportional to the initial concentration of DNA template (i.e., the viral load). By contrast, primer pair N2 appears to generate amplification product with high fluorescence emissions even at low values of the initial final copy numbers. Note that all fluorescence readings for positive samples shown in Fig 2E exhibit a fluorescence reading between 1300 and 1400 a.f.u.

Furthermore, measuring the fluorescence with the plate reader may add a quantitative element to the analysis of positive COVID-19 samples. In principle, samples with higher viral loads will exhibit higher fluorescence if processed through the same PCR program (i.e., exposed to the same number of cycles). For example, for amplifications using primer set N3, we observe a linear relationship between the natural logarithm of the number of viral copies and the natural logarithm of fluorescence signal for the range of 625 to 40,000 viral copies: where Fo is the fluorescence reading exhibited by a blank (i.e., a negative sample prepared and processed in the same way than the positive samples) and α = 8.897 (as determined by fitting of the data presented in Fig 3A). For instance, we believe we can adjust the concentration of intercalating reagent to assure linearity of the fluorescence signal with respect to the viral load for experiments with different primer sets. This simple strategy will result in a fully quantitative, reliable, and easily implemented quantitative version of a straightforward final-point PCR protocol.

Fig 3

Potential use of a plate reader for quantitation of the initial viral load in a sample and the extent of amplification.

(A) Linear relationship between the natural logarithm of the fluorescence reading and the natural logarithm of the viral load. (B) Results of the simulation of real time PCR in a microplate reader.

Using the primers and methods described here, we were able to consistently detect the presence of SARS-CoV-2 synthetic DNA using a miniPCR and a simple plate reader. In the current context of the COVID-19 pandemics, the importance of communicating this result does not reside in its novelty but in its practicality. In our experiments, we have used the three sets of primers designed and recommended by the CDC to identify the presence of SARS-CoV-2, the causal agent of COVID-19. These primer pairs, aimed at identifying three different regions encoding for the N protein of SARS-CoV-2, have been widely validated and used for diagnostic purposes in actual COVID-19 patients, Here we simply translated widely tested protocols from the framework of an RT-qPCR apparatus (the gold standard platform recommended for analyzing and confirming positive cases) to execution in a miniaturized and already commercial POC thermal cycler. While the cost of a commercial RT-qPCR apparatus falls in the range of $10,000 to $40,000 USD, the commercial value of the miniPCR is under $800 USD. This difference is significant, especially when considering the need for rational investment of resources during an epidemic crisis.

While the quantitative capabilities of testing in a RT-QPCR platform are undisputable, the capacity of many countries for rapid, effective, and massive establishment of diagnostic centers based on RT-qPCR is questionable. The current pandemic scenarios experienced in the USA, Italy, France, and Spain, among others, have crudely demonstrated that centralized labs are not an ideal solution during emergencies. Portable diagnostic systems may provide the required flexibility and speed of response that RT-qPCR platforms cannot deliver.

To further illustrate the deterministic and quantitative dependence between the concentration of amplification product and the fluorescence signal, as measured in a plate reader, we simulated some real-time amplification experiments. To that end, we conducted amplification reactions using initial amounts of 4 × 104 copies of synthetic SARS-CoV-2 in the miniPCR cycler. We added the intercalating agent, EvaGreen Dye, to the reaction mix at the initial time and extracted samples after 1, 5, 10, 15, 20, 25, and 30 PCR cycles. The fluorescence from these samples was then measured in a plate reader. We observed a linear increase in fluorescence as more PCR cycles were performed (Fig 3B); this highlights the quantitative nature of the intercalating reaction.

Our results suggest that using a commercial plate reader to determine the extent of advance of PCR amplifications is a practical, reliable, reproducible, and robust alternative to the use of gel electrophoresis. Moreover, fluorescence reading of PCR products may lead to precise quantification of viral loads.

Conclusions

The current COVID-19 pandemic has crudely demonstrated that our available methods of detection have severe limitations in terms of cost-efficiency, scalability, and amenability for rapid implementation. Developing and well-developed countries have experienced severe difficulties in intensifying diagnostics, a required condition to stop the pandemic advance in densely populated cities. Since time is the most limiting factor in emergencies, the integration of well-developed and commercially available technologies becomes an obvious, expedient, and cost-effective first line of defense during epidemic events. Our research extends the validation of the miniPCR technology to the as-yet-unexplored topic of detection of COVID-19. Furthermore, we suggest the combined use of the miniPCR and a conventional well-plate reader as a reliable strategy that can expand the testing capabilities of RT-qPCR.

We used the set of primers developed by the CDC and recommended by the WHO for conducting the standard PCR diagnostics of COVID-19. These primers target three different regions of the viral nucleic acids encoding for the N protein. In our experiments, we corroborate that the miniPCR apparatus is capable of amplifying small amounts of SARS-CoV-2 synthetic nucleic acids. We were able to detect and amplify 64 copies of genes encoding for the N protein of SARS-CoV-2. In the context of the COVID-19 pandemics, the use of the miniPCR thermocycler may be a valuable tool to intensify diagnostics by providing relevant advantages of higher portability, lower capital cost, and easier operation than can be achieved with other RT-qPCR platforms. We found the miniPCR® to be simple and intuitive to use; these are important attributes that would facilitate the widespread adoption of any diagnostic technology.

Moreover, the combined use of the miniPCR thermocycler and a 96-well plate reader enables the possibility of obtaining immediate readings of the amplification products, thereby providing faster (and potentially quantitative) diagnostic results in shorter times than when gel electrophoresis techniques are used. Therefore, the integration of these two already commercially available devices—a miniPCR thermocycler and a 96-well plate reader—has great potential for use during epidemic emergencies.

(XLSX)

Click here for additional data file.

Uncropped and unadjusted images of gels presented in Fig 2A: Images of agarose gel electrophoresis of the DNA amplification product generated by targeting a region of the sequence coding for SARS-CoV-2 N protein.

PCR was performed using a miniPCR® thermocycler. The primer set N1 was used. The initial template amount was gradually increased from left to right: negative control (lane 1), 625 copies (lane 2), 2.5 × 103 (lane 3), 1.0 × 104 (lane 4), repetition of 1.0 × 104 (lane 5), 4.0 × 104 (lane 6), 2.0 × 105 DNA copies (lane 7), and molecular weight ladder (lane 8).

(TIFF)

Click here for additional data file.

Uncropped and unadjusted images of gels presented in Fig 2B: Images of agarose gel electrophoresis of the DNA amplification product generated by targeting a region of the sequence coding for SARS-CoV-2 N protein.

PCR was performed using a miniPCR® thermocycler. The primer set N2 was used. The initial template amount was gradually increased from left to right: negative control (lane 1), 625 copies (lane 2), 2.5 × 103 (lane 3), 1.0 × 104 (lane 4), repetition of 1.0 × 104 (lane 5), 4.0 × 104 (lane 6), 2.0 × 105 DNA copies (lane 7), and molecular weight ladder (lane 8).

(TIFF)

Click here for additional data file.

Uncropped and unadjusted images of gels presented in Fig 2C: Images of agarose gel electrophoresis of the DNA amplification product generated by targeting a region of the sequence coding for SARS-CoV-2 N protein.

PCR was performed using a miniPCR® thermocycler. The primer set N3 was used. The initial template amount was gradually increased from left to right: negative control (lane 1), 625 copies (lane 2), 2.5 × 103 (lane 3), 1.0 × 104 (lane 4), repetition of 1.0 × 104 (lane 5), 4.0 × 104 (lane 6), 2.0 × 105 DNA copies (lane 7), and molecular weight ladder (lane 8).

(TIFF)

Click here for additional data file.

21 May 2020

PONE-D-20-10541

Portable and accurate diagnostics for COVID-19: Combined use of the miniPCR® thermocycler and a well-plate reader for SARS-CoV-2 virus detection

PLOS ONE

Dear Dr. Mario Moisés Alvarez,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

==============================

ACADEMIC EDITOR:

This manuscript describes a diagnostic method for COVID-19. It could be useful in developing countries. However, the authors should to address the issue of reduced specificity in the Discussion section as a limitation of the diagnostic system.

==============================

We would appreciate receiving your revised manuscript by Jul 05 2020 11:59PM. When you are ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter.

To enhance the reproducibility of your results, we recommend that if applicable you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). This letter should be uploaded as separate file and labeled 'Response to Reviewers'.

A marked-up copy of your manuscript that highlights changes made to the original version. This file should be uploaded as separate file and labeled 'Revised Manuscript with Track Changes'.

An unmarked version of your revised paper without tracked changes. This file should be uploaded as separate file and labeled 'Manuscript'.

Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out.

We look forward to receiving your revised manuscript.

Kind regards,

Shawky M. Aboelhadid, PhD

Academic Editor

PLOS ONE

Journal Requirements:

When submitting your revision, we need you to address these additional requirements.

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at

https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and

https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

2. We noticed minor instances of text overlap with the following previous publication, by some of your co-authors, which need to be addressed:

(1) https://journals.plos.org/plosone/article?id=10.1371%2Fjournal.pone.0215642

The text that needs to be addressed involves the Introduction and Discussion section.

In your revision please ensure you cite all your sources (including your own works), and quote or rephrase any duplicated text outside the methods section. Further consideration is dependent on these concerns being addressed."

3. To comply with PLOS ONE submission guidelines, in your Methods section, please provide additional information regarding your statistical analyses. For more information on PLOS ONE's expectations for statistical reporting, please see https://journals.plos.org/plosone/s/submission-guidelines.#loc-statistical-reporting.

4. PLOS ONE now requires that authors provide the original uncropped and unadjusted images underlying all blot or gel results reported in a submission’s figures or Supporting Information files. This policy and the journal’s other requirements for blot/gel reporting and figure preparation are described in detail at https://journals.plos.org/plosone/s/figures#loc-blot-and-gel-reporting-requirements and https://journals.plos.org/plosone/s/figures#loc-preparing-figures-from-image-files. When you submit your revised manuscript, please ensure that your figures adhere fully to these guidelines and provide the original underlying images for all blot or gel data reported in your submission. See the following link for instructions on providing the original image data: https://journals.plos.org/plosone/s/figures#loc-original-images-for-blots-and-gels.

In your cover letter, please note whether your blot/gel image data are in Supporting Information or posted at a public data repository, provide the repository URL if relevant, and provide specific details as to which raw blot/gel images, if any, are not available. Email us at plosone@plos.org if you have any questions.

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Partly

Reviewer #2: No

Reviewer #3: Yes

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: Yes

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: Yes

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: No

Reviewer #2: Yes

Reviewer #3: Yes

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: Comment 1:

Please write abbreviations in full-from when they first appear in the text (Eg: Line 51: COVID-19 should be defined as coronavirus 2019; Line 52: SARS-CoV-2 should be defined as severe acute respiratory syndrome coronavirus 2; etc.).

Comment 2:

As you mentioned (Line 62-65: For example, for the last two pandemic events involving influenza A/H1N1/2009 and COVID-19 [20], the Centers for Disease Control (CDC) and the World Health Organization (WHO) recommended RT-qPCR methods as the gold standard for official detection of positive cases) RT-qPCR is the gold method for the detection of virus and real-time PCR system with approximate size of 100 mm × 60 mm × 33 mm (smaller than the apparatus described in your article) has been described (https://dx.doi.org/10.1039%2Fc5lc01415h). Therefore, can you please specify the advantages of using the apparatus you describe as compared to this one?

Comment 3:

Although the PCR machine you describe is compact, additional machinery (power supply, gel tank and imaging system for first method; microplate reader for third method) is required for the confirmation of the presence of the virus. Considering that the additional equipment is required, would it not defeat the purpose of using a compact portable PCR machine?

Comment 4:

In the paper at line 188-190, you stated “The miniPCR® was able to generate a visible band of amplification products for all three primer sets and across the whole range of synthetic viral loads”, but lane 3 (625 copies) in figure 2A-C is not visible. Please clarify.

Comment 5:

Line 182-184: “actual viral load of COVID-19 in nasal swabs from patients has been estimated to fall within the range of 105 to 106 viral copies per mL”. Line 113: 1μL of DNA template was used. Therefore, the estimated DNA that will be used from the nasal swab is (1μL from 105 to 106/mL) 100-1000 copies. Is your proposed method reliable to detect the DNA in this range?

Comment 6:

Line 207-209: “Figure 2a shows the fluorescence readings associated with the analysis of the different dilutions of synthetic SARS-CoV-2 samples previously revealed by gel electrophoresis”. However, figure 2a is a gel image. Please rectify.

Comment 7:

Figure 3 is not mentioned in-text. Please rectify.

Reviewer #2: The study entitled” Portable and accurate diagnostics for COVID-19: Combined use of the miniPCR® thermocycler and a well-plate reader for SARS-CoV-2 virus detection” described the combined use of the miniPCR® and a commercial well-plate reader as a diagnostic system for SARS-CoV-2. They amplified three amplicons with the N gene of the SARS-CoV-2 and added

EvaGreen® Dye on DNA samples prior to amplification. The extent of positivity was measured after amplification using ELISA reader. Although considered a none sense modification in the developed countries where TaqMan real time qPCR is considered the gold standard protocol, it may be useful only in the developing countries to replace the SYBR green based realtime qPCR but it produces less specific results and one cannot depend on it on the virus diagnosis. It is known that the diagnostic RT-qPCR is mainly based on TaqMan protocol that confers more specificity than SYBR green based assay.

Reviewer #3: This paper describes a portable PCR machine but additional materials (power supply, gel tank and imaging system or microplate reader) is required. The MS is well written and describes an important study.

Few comments: the authors said that a visible band was seen for all concentrations while a band cannot be seen in the image for 625 copies

Line 207-209: “Figure 2a shows the fluorescence readings associated with the analysis of the different dilutions of synthetic SARS-CoV-2 samples previously revealed by gel electrophoresis”. However, figure 2a is a gel image.

Figure 3 is not mentioned in the ms.

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: No

Reviewer #3: No

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files to be viewed.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org. Please note that Supporting Information files do not need this step.

5 Jul 2020

Response to Reviewers

Reviewer #1:

Comment 1:

Please write abbreviations in full-from when they first appear in the text (Eg: Line 51: COVID-19 should be defined as coronavirus 2019; Line 52: SARS-CoV-2 should be defined as severe acute respiratory syndrome coronavirus 2; etc.).

We thank you for your accurate observation. In this revised version we have written in full all abbreviations the first time they are used. For example:

In line 54 we state: “Nevertheless, the coronavirus disease 2019 (COVID-19) pandemic caused by the severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) [9] has broadsided most well developed and developing countries…”

In line 66 we wrote: “the Centers for Disease Control (CDC) and the World Health Organization (WHO) recommended the reverse transcription quantitative polymerase chain reaction (RT-qPCR) as the gold standard for official detection of positive cases.”

Comment 2:

As you mentioned (Line 62-65: For example, for the last two pandemic events involving influenza A/H1N1/2009 and COVID-19 [20], the Centers for Disease Control (CDC) and the World Health Organization (WHO) recommended RT-qPCR methods as the gold standard for official detection of positive cases) RT-qPCR is the gold method for the detection of virus and real-time PCR system with approximate size of 100 mm × 60 mm × 33 mm (smaller than the apparatus described in your article) has been described (https://dx.doi.org/10.1039%2Fc5lc01415h). Therefore, can you please specify the advantages of using the apparatus you describe as compared to this one?

The reviewer is absolutely right. There are reports of PCR and RT-qPCR systems smaller than the miniPCR and their functioning has been demonstrated as prototypes. However, these systems are not commercially available. In the context of an emergency such as the current COVID-19 pandemic, we believe that the first line of defense in diagnostics has to be based on fully developed (preferably commercially available) equipment. Among the various compact PCR systems currently known, the miniPCR offers precisely the highly relevant advantage of being a fully tested commercial product. To address your comment, in the revised version of the manuscript, we now refer to the development that you have mentioned, among several other POC RT-qPCR versions:

Line 72: “Several different versions of compact PCR platforms (some of them q-PCR systems) have been described recently in the scientific literature [24-27]. Unfortunately, most of these devices have not yet reached the market. During epidemic emergencies, resourcing of incompletely developed technologies is impractical, and the use of commercially available diagnostic platforms becomes the first and arguably the most cost-efficient line of defense.”

Comment 3:

Although the PCR machine you describe is compact, additional machinery (power supply, gel tank and imaging system for first method; microplate reader for third method) is required for the confirmation of the presence of the virus. Considering that the additional equipment is required, would it not defeat the purpose of using a compact portable PCR machine?

Your point is well taken. As stated in the title and abstract of the original version of the manuscript, the strategy that we propose and demonstrate here is the combined used of the miniPCR and a conventional well-plate reader.

Line 27: “Here, we demonstrate the use of the miniPCR®, a commercial compact and portable PCR device recently available on the market, in combination with a commercial well-plate reader as a diagnostic system for detecting genetic material of the severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), the causal agent of COVID-19.”

The blueGel� and an alternative electrophoretic unit referred to in our manuscript were used only to demonstrate that the amplification products are properly generated in the miniPCR unit. In an actual scenario of use, only the miniPCR and the plate reader will be needed, instead of a RT-qPCR unit.

In this revised version of the manuscript, we also explain this:

In line 321: “Moreover, the combined use of the miniPCR thermocycler and a 96-well plate reader enables the possibility of obtaining immediate readings of the amplification products, thereby providing faster (and potentially quantitative) diagnostic results in shorter times than when gel electrophoresis techniques are used. Therefore, the integration of these two already commercially available devices—a miniPCR thermocycler and a 96-well plate reader—has great potential for use during epidemic emergencies.”

Moreover, the current situation that we are experiencing in different parts of the world is vivid evidence of the need for more portable, but also more flexible and cost-effective, PCR systems. As we explain in this manuscript, the combination of miniPCR and a reader plate is convenient due to their superior portability, but also to their flexibility, cost, and ease of use.

In attention to your comment, in this revised version of the manuscript, we wrote:

Line 315: “In the context of the COVID-19 pandemics, the use of the miniPCR thermocycler may be a valuable tool to intensify diagnostics by providing relevant advantages of higher portability, lower capital cost, and easier operation than can be achieved with other RT-qPCR platforms. We found the miniPCR® to be simple and intuitive to use; these are important attributes that would facilitate the widespread adoption of any diagnostic technology.”

The proposed strategy of combining miniPCR and a plate reader, as recently referred in a blog at nature.com (please see below), is related to the concept of simplicity that leads to effective solutions: “Think Simple”:

https://bioengineeringcommunity.nature.com/posts/think-simple

This blog mentions that our contribution aims to simplify and scale up diagnostic capacities. We will most probably acquire a miniPCR and a plate reader to equip a conventional biolab for testing rather than a quantitative PCR machine.

Comment 4:

In the paper at line 188-190, you stated “The miniPCR® was able to generate a visible band of amplification products for all three primer sets and across the whole range of synthetic viral loads”, but lane 3 (625 copies) in figure 2A-C is not visible. Please clarify.

We apologize. In this revised version of the manuscript, we show (Figure 2A-C) gels in which the product of amplification corresponding to 625 copies can be clearly observed.

Comment 5:

Line 182-184: “actual viral load of COVID-19 in nasal swabs from patients has been estimated to fall within the range of 105 to 106 viral copies per mL”. Line 113: 1μL of DNA template was used. Therefore, the estimated DNA that will be used from the nasal swab is (1μL from 105 to 106/mL) 100-1000 copies. Is your proposed method reliable to detect the DNA in this range?

Yes, our technique is a compact embodiment of conventional PCR that preserves the sensitivity of PCR. In this revised version, we were able to detect low copy numbers. We demonstrated this using gel electrophoresis experiments (Figure 2A-C) and results obtained using a plate reader (Figure 2D-F).

We believe that an additional note is pertinent. Indeed, a patient may have between 105 and 106 copies of viral RNA per mL of nasal swab sample. This would mean that RT-qPCR would be able to find per 105–106 copies of viral RNA in a volume of RNA extract (typically a few microliters) derived from 1 mL of actual nasal sample. Indeed, readings of 104 to 105 copies of SARS-CoV-2 RNA in the final volume placed in the thermocycler (typically 200–250 µL) are not uncommon in RT-qPCR testing.

Comment 6:

Line 207-209: “Figure 2a shows the fluorescence readings associated with the analysis of the different dilutions of synthetic SARS-CoV-2 samples previously revealed by gel electrophoresis”. However, figure 2a is a gel image. Please rectify.

We apologize. We have corrected this mistake. In this revised version have corrected this:

In line 205: “Figures 2D-F shows the fluorescence readings associated with the analysis of the different dilutions of synthetic SARS-CoV-2 samples previously revealed by gel electrophoresis.”

Comment 7:

Figure 3 is not mentioned in-text. Please rectify.

We apologize for this mistake; in this revised version we appropriately mentioned Figure 3.

In line 252:“where Fo is the fluorescence reading exhibited by a blank (i.e., a negative sample prepared and processed in the same way than the positive samples) and α = 8.897 (as determined by fitting of the data presented in Figure 3A).”

In line 290 we state: “We observed a linear increase in fluorescence as more PCR cycles were performed (Figure 3B); this highlights the quantitative nature of the intercalating reaction.”

Reviewer #2:

Comment 1:

The study entitled” Portable and accurate diagnostics for COVID-19: Combined use of the miniPCR® thermocycler and a well-plate reader for SARS-CoV-2 virus detection” described the combined use of the miniPCR® and a commercial well-plate reader as a diagnostic system for SARS-CoV-2. They amplified three amplicons with the N gene of the SARS-CoV-2 and added

EvaGreen® Dye on DNA samples prior to amplification. The extent of positivity was measured after amplification using ELISA reader. Although considered a none sense modification in the developed countries where TaqMan real time qPCR is considered the gold standard protocol, it may be useful only in the developing countries to replace the SYBR green based realtime qPCR but it produces less specific results and one cannot depend on it on the virus diagnosis. It is known that the diagnostic RT-qPCR is mainly based on TaqMan protocol that confers more specificity than SYBR green based assay.

Your point is well taken. We are not suggesting replacing standard RT-qPCR. We are suggesting an addition to the portfolio of options that we have now available to detect SARS-CoV-2. Six months after the onset of the COVID-19 pandemics, we have seen, in developing (México, Brazil, Chile, India) as well developed (USA, England, Italy, Spain) countries, that conventional RT-qPCR has been vastly insufficient. The problem is not accuracy or reliability, where RT-qPCR would be unsurpassed for sure; the problem is flexibility, portability, ease of use, and, ultimately, the scalability of the testing effort. The axis of our proposal is the combined use of two low-cost and simple pieces of equipment to conduct quantitative PCR, thereby enhancing the capacity of testing that has been insufficient worldwide so far.

In attention to your comment, in this revised version (line 299) we explain:

“The current COVID-19 pandemic has crudely demonstrated that our available methods of detection have severe limitations in terms of cost-efficiency, scalability, and amenability for rapid implementation. Developing and well-developed countries have experienced severe difficulties in intensifying diagnostics, a required condition to stop the pandemic advance in densely populated cities. Since time is the most limiting factor in emergencies, the integration of well-developed and commercially available technologies becomes an obvious, expedient, and cost-effective first line of defense during epidemic events. Our research extends the validation of the miniPCR technology to the as-yet-unexplored topic of detection of COVID-19. Furthermore, we suggest the combined use of the miniPCR and a conventional well-plate reader as a reliable strategy that can expand the testing capabilities of RT-qPCR.”

Reviewer #3:

This paper describes a portable PCR machine but additional materials (power supply, gel tank and imaging system or microplate reader) is required. The MS is well written and describes an important study.

We deeply thank you for your comment on the value of our contribution.

Few comments: the authors said that a visible band was seen for all concentrations while a band cannot be seen in the image for 625 copies

We apologize. In this revised version of the manuscript, we have replaced the gel images that were unsatisfactory. The new gels more clearly show the amplification products corresponding to 625 copies of viral RNA (Figure 2A-C).

Line 207-209: “Figure 2a shows the fluorescence readings associated with the analysis of the different dilutions of synthetic SARS-CoV-2 samples previously revealed by gel electrophoresis”. However, figure 2a is a gel image.

We apologize; we have gladly corrected this mistake and in this revised version (line 205) we state:

“Figures 2D-F shows the fluorescence readings associated with the analysis of the different dilutions of synthetic SARS-CoV-2 samples previously revealed by gel electrophoresis.”

Figure 3 is not mentioned in the ms.

We apologize for this mistake; in this revised version, we appropriately mentioned Figure 3.

In line 252: “where Fo is the fluorescence reading exhibited by a blank (i.e., a negative sample prepared and processed in the same way than the positive samples) and α = 8.897 (as determined by fitting of the data presented in Figure 3A).”

In line 290: “We observed a linear increase in fluorescence as more PCR cycles were performed (Figure 3B); this highlights the quantitative nature of the intercalating reaction.”

Submitted filename: Response to Reviewers 2020 0705.docx

Click here for additional data file.

28 Jul 2020

Portable and accurate diagnostics for COVID-19: Combined use of the miniPCR thermocycler and a well-plate reader for SARS-CoV-2 virus detection

PONE-D-20-10541R1

Dear Dr. Mario Moisés Alvarez,

We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.

Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.

An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

Kind regards,

Shawky M. Aboelhadid, PhD

Academic Editor

PLOS ONE

Additional Editor Comments (optional):

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.

Reviewer #3: All comments have been addressed

**********

2. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #3: Yes

**********

3. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #3: Yes

**********

4. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #3: Yes

**********

5. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #3: Yes

**********

6. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #3: All comments have been addressed. You may like to update the data regarding the number of cases in the intro/abstract.

**********

7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #3: No

3 Aug 2020

PONE-D-20-10541R1

Portable and accurate diagnostics for COVID-19: Combined use of the miniPCR thermocycler and a well-plate reader for SARS-CoV-2 virus detection

Dear Dr. Alvarez:

I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.

If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.

If we can help with anything else, please email us at plosone@plos.org.

Thank you for submitting your work to PLOS ONE and supporting open access.

Kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Professor Shawky M. Aboelhadid

Academic Editor

PLOS ONE