| Literature DB >> 33126180 |
Meral Yüce1, Elif Filiztekin2, Korin Gasia Özkaya2.
Abstract
A fast and accurate self-testing tool for COVID-19 diagnosis has becoEntities:
Keywords: COVID-19; Lateral flow assay; Loop-mediated isothermal amplification; Point of care devices; RT-PCR; SARS-CoV-2 detection; SARS-CoV-2 diagnosis
Mesh:
Substances:
Year: 2020 PMID: 33126180 PMCID: PMC7584564 DOI: 10.1016/j.bios.2020.112752
Source DB: PubMed Journal: Biosens Bioelectron ISSN: 0956-5663 Impact factor: 10.618
Fig. 1A visual artwork for whole SARS-CoV-2 virus (a), cryo-EM restructure of SARS-CoV-2 S trimer glycoprotein, which is responsible for host cell receptor binding (b), and the complete genome structure of SARS-CoV-2 virus (c).
a) The morphological structure of SARS-Cov-2 reproduced from ref (Rosales-Mendoza et al., 2020). “The envelope membrane is associated with the spike protein (S), which mediates binding to the host cell receptors and considered a critical target for the induction of antibodies capable of neutralizing the virus; hemagglutinin-esterase dimer (HE), which acts as a potent mediator of attachment and destruction of sialic acid receptors on the host cell surface; a membrane glycoprotein (M), which is important to generate the virus; and the envelope protein (E), which adheres to the M protein to form the viral envelope. The viral structure also comprises a nucleocapsid protein (N) that, along with the RNA genome, produces the nucleocapsid.” (Rosales-Mendoza et al., 2020).
b) The reconstruction of the closed SARS-CoV-2 S ectodomain trimer at 2.8Å resolution reproduced from ref (Walls et al., 2020). “(A) Closed SARS-CoV-2 S trimer unsharpened cryo-EM map. (B and C) Two orthogonal views from the side (B) and top (C) of the atomic model of the closed SARS- CoV-2” (Walls et al., 2020).
c) Complete genome structure of the SARS-CoV-2 virus, the data is redrawn based on the information and results of ref (Khailany et al., 2020).
Fig. 2The principle of RT-PCR based on commercial TaqMan probes (a) and the relative amplicon positions for SARS-Cov-2 on GenBank data of the previous SARS-CoV and SARS-CoV-2 (b).
a) TagMan Probe-based RT-PCR steps. The illustration was redrawn based on Ref (Roy et al., 2019). The probe is modified with a fluorescent dye (reporter dye) at one end, and one quencher dye on the other end. The quencher blocks the fluorescent signal of the reporter dye due to proximity. The probe does not fluoresce in its native condition. When the polymerase enzyme starts the amplification and encounters with the labeled probe, the probe gets hydrolyzed, releasing its components away from each other, which constitutes a fluorescent signal. Each successful amplification produces fluorescent that is proportional to the amount of the target gene in the sample.
b) Relative positions of amplicon targets on SARS-CoV and Wuhan-CoV genome. S: Spike glycoprotein, E: Envelope protein, M: Membrane protein, N: nucleocapsid; ORF: open reading frame; RdRp: RNA-dependent RNA polymerase. Numbers below amplicon are genome positions according to SARS-CoV, NC_004718”. Reproduced from ref (Corman et al., 2020).
A list of the target gene regions, primer and probe sequences used in different RT-PCR setups for SARS-CoV-2 detection.
| Reference | Genes | Forward Primer | Reverse Primer | Probe Sequence |
|---|---|---|---|---|
| RdRP | GTGARATGGTCATGTGTGGCGG | CARATGTTAAASACACTATTAGCATA | CAGGTGGAACCTCATCAGGAGATGC | |
| E | ACAGGTACGTTAATAGTTAATAGCGT | ATATTGCAGCAGTACGCACACA | ACACTAGCCATCCTTACTGCGCTTCG | |
| N | CACATTGGCACCCGCAATC | GAGGAACGAGAAGAGGCTTG | ACTTCCTCAAGGAACAACATTGCCA | |
| ORF1ab | CCCTGTGGGTTTTACACTTAA | ACGATTGTGCATCAGCTGA | CCGTCTGCG/ZEN/GTATGTGGAAAGGTTATGG | |
| N | GGGGAACTTCTCCTGCTAGAAT | CAGACATTTTGCTCTCAAGCTG | TTGCTGCTGCTTGACAGATT | |
| RdRP | AGATTTGGACCTGCGAGCG | GAGCGGCTGTCTCCACAAGT | TTCTGACCTGAAGGCTCTGCGCG | |
| N1 | GACCCCAAAATCAGCGAAAT | TCTGGTTACTGCCAGTTGAATCTG | ACCCCGCAT/ZEN/TACGTTTGGTGGACC | |
| N2 | TTACAAACATTGGCGCAAA | GCGCGACATTCCGAAGAA | ACAATTTGCCCCCAGCGCTTCAG | |
| N3 | GGGAGCCTTGAATACACCAAAA | TGTAGCACGATTGCAGCATTG | AYCACATTGGCACCCGCAATCCTG | |
| ORF1b | TGGGGYTTTACRGGTAACCT | AACRCGCTTAACAAAGCACTC | TAGTTGTGATGCWATCATGACTAG | |
| N | TAATCAGACAAGGAACTGATTA | CGAAGGTGTGACTTCCATG | GCAAATTGTGCAATTTGCGG | |
| N | AAATTTTGGGGACCAGGAAC | TGGCAGCTGTGTAGGTCAAC | ATGTCGCGCATTGGCATGGA | |
| RdRP | ATGAGCTTAGTCCTGTTG | CTCCCTTTGTTGTGTTGT | AGATGTCTTGTGCTGCCGGTA | |
| RdRP | GGTAACTGGTATGATTTCG | CTGGTCAAGGTTAATATAGG | TCATACAAACCACGCCAGG | |
| E | ACAGGTACGTTAATAGTTAATAGCGT | ATATTGCAGCAGTACGCACACA | ACACTAGCCATCCTTACTGCGCTTCG | |
| ORF1ab | CCCTGTGGGTTTTACACTTAA ACG | ACGATTGTGCATCAGCTGACCG | CCGTCTGCGGTATGTGGAAAGGTTATGG | |
| N | GGGGAACTTCTCCTGCTA GAA T | CAGACATTTTGCTCTCAA GCT G | TTGCTGCTGCTTGACAGATT | |
| N | CGTTTGGTGGACCCTCAGAT | CCCCACTGCGTTCTCCATT | CAACTGGCAGTAACCA |
All sequences are given in the direction of 5′ to 3’ (from left to right). Probe sequences are always labeled with a reporter dye at 5’ (usually FAM) and a quencher at the 3’ (usually BHQ).
LabCorp COVID-19 RT-PCR test interpretation-SINGLEPLEX. Reproduced from ref (LabCorp, 2020b).
| SARS-CoV-2 N1 (FAM) | SARS-CoV-2 N2 (FAM) | SARS-CoV-2 N3 (FAM) | RNAse P (FAM) | Interpretation | Report | Actions (Clinical Site Samples) | Actions (Pixel Home Collection Kit samples) |
|---|---|---|---|---|---|---|---|
| SARS-CoV-2 detected | DETECTED | Report results to sender and appropriate public health authorities | Report results to PWN Health, who will call the patient. Report the result to the Pixel portal. Report the result to the appropriate public health authorities | ||||
| If only one target is positive | SARS-CoV-2 | INDETERMINATE | The sample is repeated once. If results remain the same, it is reported to the sender as indeterminate and recommend recollection if the patient is still clinically indicated | The sample is repeated once. If results remain the same, it is reported to the sender as indeterminate to PWN Health, who will call the patient. Report the result to the Pixel Portal | |||
| SARS-CoV-2 Not Detected | NOT DETECTED | Report results to sender | Report results to PWN Health and the Pixel Portal | ||||
| Invalid Result | INVALID | The sample is repeated once. If a second failure occurs, it is reported to the sender as invalid and recommend recollection if the patient is still clinically indicated | The sample is repeated once. If a second failure occurs, it is reported to PWN Health. Pixel's customer service will contact the patient to discuss options. Report the result to the Pixel Portal | ||||
The kits cleared a EUA from FDA for SARS-CoV-2 antibody detection. The commercial kit list was retrieved from the FDA website in early May 2020 (U.SFDA, 2020a, USFDA, 2020l). Instruction for Use (IFU) and Fact Sheet for Healthcare Providers (HCP) documents were also retrieved from the same FDA website.
| Entity/Company | Targeted Molecules and Kit Name | Details |
|---|---|---|
| Abbott Laboratories Inc. | IgG only | The test can be used only in authorized laboratories on Abbott's Architect i1000SR and i2000SR instruments. This platform can run 100–200 tests/hour, being faster than RT-PCR. It is reported that the kit has a sensitivity of 100% and specificity of 99.5% (IFU). The company plans to develop an IgM test too, which would be the 4th product of the company in the market for the COVID-19 diagnosis ( |
| Autobio Diagnostics Co. Ltd. | IgM and IgG | This is a rapid LFA test based on a one-step capture protocol. The samples can be taken from serum or plasma. The membrane pads are decorated with anti-Spike, anti-IgM, and IgG antibodies lines, which serve as a control, IgG detection, and IgM detection lines, respectively. The spike protein-coated gold nanoparticles are employed to capture the antibodies and form a reddish color on the pads for fast, visual detection. The protocol implies that the tests are more accurate when used after around 15 days following the infection (IFU). Such a test can be used by individuals since they do not require trained personnel or sophisticated equipment. |
| DiaSorin Inc. | IgG only | This kit is a two-step automated immunoassay for the qualitative detection of anti-SARS-CoV-2 IgG antibodies in serum/plasma samples. The assay is based on chemiluminescent microparticle immunoassay technology (CMIA) in which the particles are functionalized with the SARS-CoV-2 antigens. Further addition of the Anti-human IgG acridinium-labeled conjugate into the incubation medium creates a chemiluminescent signal that is measured as relative light units. The positive percent agreement (PPA) was reported as 100% for 88 clinically validated positive samples that are measured after at least 14 days following the infection, whereas this value was ≤25% when tested in the first week (n = 12) (IFU). This test can only be performed at laboratories; however, the sensitivity of the test is high enough to make a decision without further confirmation. |
| Ortho-Clinical Diagnostics, Inc. | IgG only | This two-step kit is performed with Anti-SARS-CoV-2 IgG Reagent Pack, the Anti-SARS-CoV-2 IgG Calibrator on the ECi/ECiQ/3600 Immunodiagnostic Systems and the 5600/XT 7600 Integrated Systems, all available from Ortho-Clinical Diagnostics, Inc. In the first step, anti-SARS-CoV-2 antibodies bind to the wells that are decorated with the virus spike proteins. The wash step removes the unbound molecules from the sample environment, which is followed by the addition of the horseradish-peroxidase-linked anti IgG antibodies. If there is no spike protein-IgG complex in the sample, the second antibody will be cleared off the well with the second washing step. If positive, the addition of a final enzymatic substrate results in a color change that is measured and correlated with the virus presence. The test showed 100% negative agreement (n = 407) and 87.5% (n = 48) positive agreement (IFU). The positive agreement value of the test is relatively low that probably requires a second confirmatory test. |
| Mount Sinai Laboratory | IgG only | The ELISA-based test kit is only authorized for use at Mount Sinai Laboratory (New York, USA), certified CLIA (1988, 42 U.S.C. §263a), to perform high complexity tests (HCP). The ELISA kits cannot be performed out of laboratory; however, they are both reliable and high throughput and thus a very efficient alternative to the RT-PCR method. |
| Ortho Clinical Diagnostics, Inc. | Total Antibody | The SARS-CoV-2 Total Antibody kit by Ortho Clinical, Inc. is quite similar to the one other VITROS kit, listed earlier in this table except for the second step, which involves the use of horseradish peroxidase (HRP)-labeled recombinant SARS-CoV-2 antigen instead of horseradish-peroxidase-linked anti IgG antibodies. The clinical agreement of the kit was reported as 100% negative agreement (n = 400) and 83.3% positive agreement, which is less than the IgG antibody kit agreement values, provided by the same company (IFU). |
| Chembio Diagnostic System, Inc. | IgM and IgG | The DPP® COVID-19 IgM/IgG System is a single-use rapid test (a version of LFA performed on a device for readout) for qualitative IgG and IgM detection in blood, serum, or plasma samples. The platform includes the DPP COVID-19 IgM/IgG Test Devices and the DPP Micro Reader/DPP Micro Reader 2 for use with the kit. For this dual antibody detection platform, the positive agreement was reported as 100% (n = 13) for both IgG and IgM (for the samples tested after the first two weeks of the infection). The negative agreements were reported as 100% for IgM and 95.9% for IgG, 95.9% for IgG, and IgM dual test line (n = 49) (IFU). |
| Cellex Inc. | IgM and IgG qSARS-CoV-2 IgG/IgM Rapid Test | This test is an LFA that can detect antibodies produced against the new Coronavirus. The cassette includes colloidal gold conjugated- SARS-CoV-2 antigens and rabbit IgG-gold conjugates to be spiked with the actual sample. One of the test lines contains an anti-human IgG antibody for IgG testing; the other one contains anti-human IgM antibodies for IgM detection. The control line contains anti-rabbit IgG antibodies produced in goat and work regardless of the presence of anti-SARS-CoV-2 IgG/IgM antibodies in the sample. The overall clinical agreement values were reported as 93.8% for the positive percent (n = 128), and 96% for the negative percent (n = 250) (IFU). The clinical agreement values are higher than the previous kits. |
The antigen tests under development for SARS-CoV-2 detection.
| Companies | Target | Method and Possible Outcome | Ref. |
|---|---|---|---|
| QUIDEL | N protein | Sofia 2 SARS Antigen Test Kit is based on a sandwich-type immunofluorescence strip technology that is used with an instrument to detect N protein of both SARS-CoV and SARS-CoV-2. The clinical sensitivity of the kit was found as 80%, whereas the specificity was 100% out of 47 positive and 96 negative clinical samples. | ( |
| Avacta and Cytiva (formerly GE Healthcare Life Sciences) | SARS-CoV-2 viral antigens, S glycoproteins | The developer of Affimer® biotherapeutics and reagents, Avacta Group plc (AIM: AVCT), announced in late April (2020) a collaborative project to develop rapid diagnostic assays for SARS-CoV-2 antigen detection. Affimer binders® have been produced against S proteins of the SARS-COV-2. The developed affinity reagents are planned to be characterized by Avacta, which then be transferred to Cytiva for employment in strip assays, like those handy pregnancy tests. The affinity agents are reported to be highly specific to the new virus, not to the previous versions (SAR or MERS). The technology will be available as mass testing units as well as strip tests. | |
| OraSure Inc. | A panel of SARS-CoV-2 viral antigens-not specifically disclosed | OraSure Inc. was awarded around USD 700,000 from Biomedical Advanced Research and Development Authority (BARDA) to develop a rapid pan-home test for SARS-CoV-2 detection that could be issued a EUA from FDA as early as September. The test will not require any trained personnel, complex solutions, or instruments and will be available self-testing at home. The platform, based on OraSure's OraQuick® technology, will allow testing in less than half an hour by using oral samples such as saliva. The company had successfully developed an oral-sample-HIV home test previously, which was used by millions around the globe. |
Sofia 2 SARS Antigen Test Kit by QUIDEL was received and EUA from FDA in mid-May 2020.
Early research stage SARS-COV-2 detection strategies in the literature.
| Target | Method | Result | Ref |
|---|---|---|---|
| A new framework to predict COVID-19 using onboard smartphone sensors | Measurement of well-known disease symptoms (fever, fatigue, headache, nausea, dry cough, lung CT imaging features, and shortness of breath) through the sensors already embedded in smartphones (cameras, inertial sensors, microphone, and temperature sensor) | The proposed framework is expected to read the smartphone sensors' signal measurements to predict the grade of severity of pneumonia. Although the sensitivity is still a question, such systems can be useful to monitor and act on mass populations worldwide online. | |
| An electrical probe to detect COVID-19 spike protein S1 | Receptor Binding Domain-modified graphene field-effect transistor was used to identify spike proteins | The sensor can capture S1 protein at a limit of detection down to 0.2 pM, in a real-time and label-free manner. The platform could also be used to screen high-affinity antibodies. Portable electrochemical measurement systems are widely available at low-cost, and thus FET principle may be quickly transformed into a biomedical instrument for on-site diagnosis, especially in rural areas. | |
| An artificial intelligence tool (based on deep learning and transfer learning algorithms) to predict COVID-10 cases | Collection of X-rays and CT scan images from multiple sources and processing by simple convolution neural network (CNN) and modified the pre-trained Alex Net model. | The constructed models provide accuracy up to 98% via a pre-trained network and 94.1% accuracy by using the modified CNN. Such algorithms can be quite fast and effective for health and regulatory institutions to monitor the pandemic in real-time and obtain fast-track data of individuals who are at risk. | |
| A field-effect transistor device for SARS-CoV-2 spike protein detection in clinical samples | The graphene sheets coated by SARS-CoV-2 spike protein-specific antibodies were used as the transducer for sensing the signal production | The sensor detected SARS-CoV-2 in culture medium (limit of detection [LOD]: 1.6 × 101 pfu/mL) and clinical samples (LOD: 2.42 × 102 copies/mL) | |
| RT-LAMP-coupled with Nanoparticles are suggested for COVID-19 diagnosing | The assay is based on two sets of LAMP primers against ORF1ab and N genes of the virus. The assay results were interpreted through the nanoparticles | The sensitivity was reported as 12 copies/reaction, and no cross-reactivity was generated from non-SARS-CoV-2 templates. The analytical sensitivity was 100% (33/33) in the clinically validated oropharynx swab samples, and the specificity was also 100% (96/96) when analyzed with samples from non-COVID-patients. RT-LAMP has rapidly become an efficient tool for viral gene detection because of faster reaction times and increased sensitivity. These systems can be an alternative to the existent RT-PCR method because RT-LAMP can also be incorporated with LFA technology for individual implementation (please see the previous sections). | ( |
| A microfluidic ELISA technology for rapid (15–20 min) detection of viral IgG and viral S antigen | The portable, microfluidic-based ELISA array has 12 channels. The signal intensities of the microfluidic ELISA were measured with the chemiluminescent imaging method, using a CMOS camera. Multiple exposures with adjustable exposure time were applied to enhance the dynamic ranges of the ELISA | A candidate IgG with a high binding affinity towards the SARS-CoV-2 S1 protein was identified. The microfluidic ELISA platform was used for the detection of anti-S1 monoclonal antibodies. No clinical testing was performed. The current rapid antibody tests are mainly LFA-based, and many of them still rely on instruments for increased sensitivity. Although ELISA is also instrument-dependent, it can give high throughput results with better sensitivity. | |
| The selected gene sequences (RdRp, E gene, ORF1ab) from SARS-CoV- through nucleic acid hybridization | A dual-functional plasmonic biosensor combining the plasmonic photothermal (PPT) effect and localized surface plasmon resonance (LSPR) was proposed for COVID-19 diagnosis. | A reasonably low detection limit of 0.22 pM was reported. SPR instruments are quite sensitive in general and easy to operate in the laboratories. They only require chip or surface modification by antigens or antibodies. They, therefore, can be a good alternative to current diagnostic tools that are limited by RT-PCR instruments. | |
| Reverse transcription loop-mediated isothermal amplification (RT-LAMP) methodology was reported for simultaneous SARS-CoV-2 RNA region detection (ORF1a and N regions) | ORF1a and N gene regions from SARS-CoV-2 RNA were targeted with the RT-LAMP system using China-CDC approved primers | 45 SARS-CoV-2 positive and 25 negative samples were employed in the study. The dual gene RT-LAMP assay was found to be 95% accurate in detecting positive cases and showed no cross-reactivity or false-positive results in non-COVID- 19 samples | |
| A portable Surface Plasmon Resonance (SPR)-based platform for SARS-CoV-2 specific antibody detection | The SPR chip surface was modified with the viral N proteins to be able to detect the antibodies against the nucleocapsid proteins of the virus in diluted human serum samples. | SPR instrument used with undiluted human serum samples provided binding affinities in the nanomolar range. The results were collected within 15 min of sample/sensor contact. | |
| CRISPR, Cas12-based lateral flow assay for detection of SARS-CoV-2 from RNA extracts. | The platform performs RT-LAMP with RNA samples extracted from nasopharyngeal or oropharyngeal swabs in universal transport media (UTM). Then, selected SARS-CoV-2 sequences are detected by Cas 12 enzyme, and the cleavage of a reporter dye confirms the presence of the virus | The method was validated by employing contrived reference samples and 40 clinical samples from infected US patients. The results said to be comparable with the US CDC SARS-CoV-2 real-time RT-PCR assay. | |
| SARS-CoV-2 spike protein detection in saliva | A built in- house electrochemical measurement platform (eCovSens) was used for the detection. The fluorine-doped tin oxide and the gold nanoparticle (signal amplifier)-based electrode was decorated with anti-spike monoclonal antibodies to monitor the change in the conductivity upon target binding | The limit of detection was reported as small as 90 fM for the spiked saliva samples. | |
| One-pot detection of SARS-CoV-2 and | The assay platform, AIOD-CRISPR, was based on dual CRISPR-Cas12a components and the LAMP principles. The assays were conducted in one pot at one step and one temperature. | The optimized system was able to detect 1.2 copies of DNA targets, and 4.6 copies of RNA targets in 40 min without the need for a preamplification step. | |
| SARS- CoV-2 genome sequences | Nanopore target sequencing (NTS) platform was developed to detect novel coronavirus as well as previous respiratory viruses in a simultaneous manner in 6–10 h. | The NTS platform was compared with the approved qPCR for 61 samples from suspected clinical samples. The results demonstrated that the NTS could detect more positive cases. Besides, the mutated sequences can be found along with the other respiratory viruses present in the sample. The sequencing-based virus diagnosis strategies are quite rare but highly needed since the revealed genomic and proteomic elements of the virus form the basis for the current and future diagnosis tools. | (M. |
| SARS-CoV-2 nucleic acids: N1, N2, and N3 gene regions | The diagnosis system was based on the combined use of a portable mini PCR machine and a 96-well plate reader. EvaGreen dye was employed as an intercalator for fluorescent detection of the targeted regions. | The method detected ~625 to 2 × 105 DNA copies through direct PCR amplification, and the signal measurements were performed on a plate reader, which was proposed as a portable alternative for viral gene sequencing. |
Fig. 3(a) Illustration of the method workflow. Standard RNA extraction solution or original sample matrix can be used as an input to detect E, N, and RNase P genes. The assay is monitored by a fluorescent reader or lateral flow strip. (b) Lateral flow readout of SARS-CoV-2 positive sample. Detection of at least two genes is necessary for positive sample confirmation. Reproduced from ref (Broughton et al., 2020).