| Literature DB >> 32694544 |
Leila Kaviani Feizi1, Sabihe Soleymanian Zad2,3, Seyed Amir Hossein Jalali3,4, Hassan Rafiee1, Masoud Boroumand Jazi5, Khaled Sadeghi1, Rasoul Kowsar6.
Abstract
The effect of soybean meal (SBM) replacement with fermented SBM (FSBM) on ruminal fermentation and bacterial abundance in Holstein calves was investigated in this study. Thirty nine calves were randomized to: (1) control: 27% SBM + 0% FSBM (FSBM0, n = 13); (2) 18% SBM + 9% FSBM (FSBM9, n = 13); and (3) 13.5% SBM + 13.5% FSBM (FSBM13, n = 13). SBM contained a greater amount of large peptides containing 3 to 10 amino acids (AAs), while FSBM had a greater amount of ammonia nitrogen (NH3-N), free AAs, and small peptides containing 2 to 3 AAs. The calves fed FSBM13 had the lowest acetic acid, NH3-N, and the ratio of acetate to propionate, with the greatest concentration of caproic acid, valeric acid and isovaleric acid in ruminal fluid. Compared to those fed FSBM9 or FSBM13, the calves fed FSBM0 had the greatest proportion of Butyrivibrio fibrisolvens and Ruminococcus albus in rumen fluid. However, the ruminal abundance of Prevotella ruminicola in calves fed FSBM13 was greater than in calves fed FSBM0. Network analysis showed that the abundance of the Ruminococcus albus was associated with large peptides, and butyric acid was correlated with small peptide. Taken together, our findings suggest that FSBM may have the potential to boost calf performance by changing the fermentation products and the relative abundance of some members of the bacterial community in the rumen.Entities:
Mesh:
Substances:
Year: 2020 PMID: 32694544 PMCID: PMC7374609 DOI: 10.1038/s41598-020-68778-6
Source DB: PubMed Journal: Sci Rep ISSN: 2045-2322 Impact factor: 4.379
Protein fractions, peptide composition, and amino acid profile of soybean meal (SBM) and fermented SBM (FSBM).
| Item | FSBM | SBM |
|---|---|---|
| Protein (% DM) | 48.17 ± 0.44 | 43.30 ± 0.31 |
| Large peptide (% of protein)a | 4.96 ± 0.14 | 10.16 ± 0.65 |
| Small peptide (% of protein)b | 43.22 ± 0.38 | 40.11 ± 0.51 |
| A (non-protein nitrogen) | 13.78 ± 0.81 | 4.77 ± 0.26 |
| B1 (rapidly degradable true protein) | 1.87 ± 0.04 | 19.29 ± 0.95 |
| B2 (moderately degradable true protein) | 44.39 ± 1.25 | 65.89 ± 2.14 |
| B3 (slowly degradable true protein) | 28.40 ± 1.98 | 3.32 ± 0.19 |
| C (undegradable true protein) | 11.54 ± 0.49 | 6.71 ± 0.26 |
| RUP | 58.01 ± 1.75 | 38.35 ± 1.25 |
| RDP | 41.99 ± 1.25 | 61.65 ± 1.61 |
| Phenylalanine | 2.12 ± 0.04 | 1.77 ± 0.04 |
| Proline | 3.71 ± 0.17 | 3.12 ± 0.10 |
| Histidine | 2.75 ± 0.07 | 2.53 ± 0.11 |
| Asparagine | 4.98 ± 0.21 | 4.21 ± 0.21 |
| Glutamine | 9.19 ± 0.25 | 8.34 ± 0.15 |
| Methionine | 0.88 ± 0.05 | 0.75 ± 0.03 |
| Lysine | 2.96 ± 0.13 | 2.10 ± 0.15 |
| Alanine | 2.78 ± 0.16 | 2.14 ± 0.19 |
| Serine | 3.29 ± 0.22 | 2.56 ± 0.19 |
| Leucine | 4.01 ± 0.19 | 3.75 ± 0.26 |
| Isoleucine | 3.10 ± 0.28 | 2.24 ± 0.23 |
| Tryptophan | 2.74 ± 0.19 | 1.64 ± 0.08 |
| Glycine | 2.14 ± 0.14 | 2.11 ± 0.21 |
| Cystine | 0.71 ± 0.10 | 0.85 ± 0.09 |
| Arginine | 4.09 ± 0.32 | 4.15 ± 0.39 |
| Threonine | 2.34 ± 0.28 | 2.58 ± 0.11 |
| Tyrosine | 1.58 ± 0.12 | 1.68 ± 0.15 |
| Valine | 2.98 ± 0.20 | 2.51 ± 0.22 |
| Total amino acids | 56.35 ± 1.87 | 49.03 ± 1.70 |
| Ammonia nitrogen (NH3–N, mg/g of dry mater) | 2.25 ± 0.11 | 0.58 ± 0.04 |
Data were presented as mean ± SD; DM: dry matter.
) Large peptide: consisting of 3–10 amino acids.
) Small peptide: consisting of 2–3 amino acids.
Molar ratio of VFAs, concentration of NH3–N, and abundance of selected bacterial species in the rumen fluid of Holstein calves.
| Items | Treatments a | P value b | ||||
|---|---|---|---|---|---|---|
| FSBM0 | FSBM9 | FSBM13 | Diet effect | Linear | Quadratic | |
| Acetic acid (Ac) (mol/100 mol) | 52.42 ± 4.80a | 36.48 ± 2.41b | 35.38 ± 0.68b | 0.31 | ||
| Propionic acid (Pr) (mol/100 mol) | 26.71 ± 3.17 | 21.57 ± 1.84 | 25.61 ± 1.71 | 0.27 | 0.65 | 0.14 |
| Ac:Pr ratio | 2.06 ± 0.11a | 1.94 ± 0.21ab* | 1.58 ± 0.12b | 0.35 | 0.06 | 0.18 |
| Isobutyric acid (mol/100 mol) | 0.47 ± 0.04 | 0.46 ± 0.03 | 0.44 ± 0.02 | 0.61 | 0.53 | 0.98 |
| Butyric acid (mol/100 mol) | 4.73 ± 0.33 | 5.14 ± 0.21* | 4.52 ± 0.14 | 0.74 | 0.55 | 0.11 |
| Isovaleric acid (mol/100 mol) | 0.50 ± 0.04b | 0.57 ± 0.05ab* | 0.71 ± 0.04a | 0.52 | ||
| Valeric acid (mol/100 mol) | 1.36 ± 0.09b | 1.46 ± 0.13b | 2.04 ± 0.18a | 0.19 | ||
| Caproic acid (mol/100 mol) | 0.34 ± 0.03b | 0.65 ± 0.04a | 0.67 ± 0.07a | 0.15 | ||
| NH3–N (mmol/l) | 9.95 ± 0.33b | 10.92 ± 0.36ab | 12.03 ± 0.82a | 0.25 | ||
| 0.019 ± 0.001a | 0.0002 ± 0.00001b | 0.0001 ± 0.00005b | 0.21 | |||
| 0.0006 ± 0.0001b | 0.0088 ± 0.004ab | 0.017 ± 0.007a | 0.09 | 0.98 | ||
| 0.0165 ± 0.001a | 0.0028 ± 0.001b | 0.0030 ± 0.001b | ||||
Over time, calves fed various amounts of fermented soybean meal (FSBM). Calves were abruptly weaned at 59 days of age but remained in the experiment until day 67 when rumen fluid was collected (n = 13 calves per treatment).
) FSBM0 (control, 27% SBM + 0% FSBM); FSBM9 (18% SBM + 9% FSBM); and FSBM13 (13.5% SBM + 13.5% FSBM).
) The data was analyzed by the SAS software using the one-way ANOVA, followed by multiple comparisons tests, the Tukey’s test. The data was presented as Least Squares Means (LSM) ± Standard Error of the Mean (SEM).
Different superscripts (a, b) in a row indicate statistically significant differences at P < 0.05. * indicates P < 0.10: a tendency towards statistical significance between FSBM9 and FSBM13. Orthogonal polynomial contrasts were used to determine the linear or quadratic effect of FSBM using SAS software (SAS Institute Inc., Cary, NC).
) The relative abundance of bacteria was measured using qPCR as a proportion of the total bacterial 16S rDNA.
Figure 1Pairwise-Spearman correlation between peptides, concentration of NH3–N, VFAs and bacterial abundance in the rumen fluid of Holstein calves. The color intensity is proportional to the correlation coefficients. The scale bar on the right side of the heatmap is the color range for different R values. Correlations that are significant at P < 0.05 are shown in the bold and italic profiles. It is important to note that the Spearman correlation can only determine that there is an association between two variables, so it does not imply a casual relationship[50]. Prop: propionic acid; Acet: acetic acid; Isobut: isobutyric acid; Isoval: isovaleric; Butyric: butyric acid; Val: veleric acid; Cap: caproic acis; Rumin: Ruminococcus albus; Prevot: Prevotella ruminicola; Butyri:Butyrivibrio fibrisolvens; L-Pep: large peptides; S-Pep: small peptides.
Figure 2(a) Hierarchical cluster analysis (HCA) on peptides, ruminal VFAs, NH3–N and bacterial abundances. The HCA was developed by PAST using Spearman distance measurement and UPGMA. Boxes with different colors (i.e., red, green, and yellow) represent various clusters. (b) Biplot was developed from the principal component analysis of variables. Close-angles Vectors (< 45°) indicate a strong association, perpendicular vectors indicate no correlation, and vectors in opposite directions (approaching 180°) indicate a negative association. Rumin A: Ruminococcus albus; Butyri. F: Butyrivibrio fibrisolvens; Prevot. R: Prevotella ruminicola; L: large; S: small.
Figure 3Network analysis to study the relationship between peptides, concentration of NH3–N, VFAs and bacterial abundance in the rumen fluid of Holstein calves. Network analysis and visualization was carried out by the PAST program using the Fruchterman-Reingold algorithm as a force-directed layout algorithm. The Rho correlation thresholds of (a) 0.0, (b) 50%, and (c) 60% were chosen for the description of edges (interactions between parameters) and nodes (variables). The threshold of 60% was the highest cut-off since there was no interaction between the variables afterwards. The size of the nodes and edges corresponds to the clustering and correlation coefficients, respectively. Small nodes and thin edges represent small values. Peptides are displayed in the green hue. The bacterium is shown in blue. The VFAs are displayed in red.
Ingredients and chemical composition (% of dry matter, unless otherwise stated) of experimental starter feeds.
| Items | Treatmentsa | ||
|---|---|---|---|
| FSBM0 | FSBM9 | FSBM13 | |
| Chopped alfalfa hay | 10 | 10 | 10 |
| Barley grain, ground | 26.6 | 26.6 | 26.6 |
| Corn grain, ground | 26.6 | 26.6 | 26.6 |
| Soybean meal | 27 | 18 | 13.5 |
| Fermented soybean meal | 0 | 9 | 13.5 |
| Wheat bran | 6.8 | 6.8 | 6.8 |
| Vitamin and mineral mixb | 1.00 | 1.00 | 1.00 |
| Calcium carbonate | 0.75 | 0.75 | 0.75 |
| Di calcium phosphate | 0.19 | 0.19 | 0.19 |
| Sodium bicarbonate | 0.70 | 0.70 | 0.70 |
| Salt | 0.36 | 0.36 | 0.36 |
| ME (Mcal/kg)c | 2.70 | 2.71 | 2.71 |
| NEg (Mcal/kg) | 1.54 | 1.54 | 1.55 |
| DM | 90.48 ± 0.51 | 90.90 ± 1.11 | 91.09 ± 1.87 |
| OM | 92.17 ± 0.18 | 92.09 ± 1.14 | 92.39 ± 1.32 |
| CP | 19.72 ± 0.24 | 20.16 ± 0.26 | 20.38 ± 0.14 |
| Ether extract | 3.01 ± 0.11 | 3.12 ± 0.09 | 3.63 ± 0.14 |
| NDF | 23.86 ± 0.95 | 23.13 ± 1.10 | 21.30 ± 0.97 |
| ADF | 8.33 ± 0.47 | 8.79 ± 0.68 | 8.11 ± 0.73 |
| NFC | 45.58 ± 1.21 | 45.68 ± 1.14 | 47.08 ± 1.26 |
| Starch | 34.14 ± 1.11 | 33.55 ± 2.02 | 33.04 ± 1.36 |
| RUP | 8.12 ± 0.24 | 8.61 ± 0.16 | 8.92 ± 0.74 |
| RDP | 11.6 ± 0.16 | 11.20 ± 0.54 | 10.79 ± 0.91 |
| A (non-protein nitrogen) | 3.86 ± 0.22 | 4.02 ± 0.54 | 4.13 ± 0.32 |
| B1 (rapidly degradable true protein) | 1.94 ± 0.11 | 1.67 ± 0.15 | 1.54 ± 0.19 |
| B2 (moderately degradable true protein) | 10.78 ± 0.41 | 10.68 ± 0.65 | 10.55 ± 0.87 |
| B3 (slowly degradable true protein) | 2.28 ± 0.13 | 2.80 ± 0.24 | 3.07 ± 0.19 |
| C (undegradable true protein) | 0.88 ± 0.05 | 1.02 ± 0.10 | 1.21 ± 0.11 |
| Ca | 0.67 | 0.66 | 0.66 |
| P | 0.53 | 0.53 | 0.53 |
) FSBM0 = 27% soybean meal + 0% fermented soybean meal, FSBM9 = 18% soybean meal + 9% fermented soybean meal, FSBM13 = 13.5% soybean meal + 13.5% fermented soybean meal.
) Contained per kilogram of supplement: 250,000 IU of vitamin A, 50,000 IU of vitamin D, 1,500 IU of vitamin E, 2.25 g of Mn, 120 g of Ca, 7.7 g of Zn, 20 g of P, 20.5 g of Mg, 186 g of Na, 1.25 g of Fe, 3 g of S, 14 mg of Co, 1.25 g of Cu, 56 mg of I, and 10 mg of Se.
) Calculated according to NRC (2001).
) NFC = 100—% neutral detergent fiber—% crude protein—% ether extract—% ash; Data are presented as mean ± SD.
Bovine primers used in qPCR.
| Bacteria | Sequence of nucleotide (5′–3′) * | Tm, °C | Ry[ | Slope | Efficiency, % | |||
|---|---|---|---|---|---|---|---|---|
| F | CCCTAAAAGCAGTCTTAGTTCG | 60 | 0.992 | − 3.394 | 97.8 | CP002403.1 | 62,63 | |
| R | CCTCCTTGCGGTTAGAACA | |||||||
| F | CGAACGGAGATAATTTGAGTTTACTTAGGTTAGG | 58.5 | 0.987 | − 3.331 | 98.9 | AB849343.1 | 62 | |
| R | CGGTCTCTGTATGTTATGAGGTATTACC | |||||||
| F | GTTCGGAATTACTGGGCGTAAA | 59.5 | 0.985 | − 3.356 | 102.5 | AB275512.1 | 62 | |
| R | CGCCTGCCCCTGAACTATC | |||||||
| F | TCTGGAAACGGATGGTA | 55 | 0.994 | − 3.256 | 102.1 | HQ404372.1 | 62 | |
| R | CCTTTAAGACAGGAGTTTACAA | |||||||
| F | GAAAGTCGGATTAATGCTCTATGTTG | 58 | 1.00 | − 3.421 | 95.6 | LT975683.1 | 62 | |
| R | CATCCTATAGCGGTAAACCTTTGG | |||||||
| Total bacterial | F | CGGCAACGAGCGCAACCC | 60 | 0.996 | − 3.324 | 101.2 | AY548787.1 | 61,62 |
| 16S rDNA | R | CCATTGTAGCACGTGTGTAGCC |
The efficiency of the qPCR reaction was sufficient, on average 99.68 ± 2.71 (mean ± SD). F Forward, R Reverse.