Literature DB >> 25049708

Effects of soybean small peptides on rumen fermentation and on intestinal and total tract digestion of luxi yellow cattle.

W J Wang1, W R Yang1, Y Wang1, E L Song1, X M Liu1, F C Wan1.   

Abstract

Four Luxi beef ies">cattle (400±10 kg) fitted with rumiical">nal, duodeical">nal aical">nd ical">n class="Disease">ileal cannulas were used in a 4×4 Latin square to assess the effects of soybean small peptide (SSP) infusion on rumen fermentation, diet digestion and flow of nutrient in the gastrointestinal tract. The ruminal infusion of SSP was 0 (control), 100, 200 and 300 g/d. Ruminal SSP infusion linearly (p<0.01) and quadratically (p<0.01) increased microbial protein synthesis and rumen ammonia-N concentration. Concentrations of total volatile fatty acid were linearly increased (p = 0.029) by infusion SSP. Rumen samples were obtained for analysis of microbial ecology by real-time PCR. Populations of rumen Butyrivibrio fibrisolvens, Streptococcus bovis, Ciliate protozoa, Ruminococcus flavefaciens, and Prevotella ruminicola were expressed as a proportion of total Rumen bacterial 16S ribosomal deoxyribonucleic acid (rDNA). Butyrivibrio fibrisolvens populations which related to total bacterial 16S rDNA were increased (p<0.05), while Streptococcus bovis populations were linearly (p = 0.049) and quadratically (p = 0.020) decreased by infusion of SSP. Apparent rumen digestibility of DM and NDF were (Q, p<0.05; L, p<0.05) increased with infusion SSP. Total tract digestion of DM, OM and NDF were linearly (p<0.01) and quadratically (p<0.01) increased by infusing SSP. The flow of total amino acids (AA), essential amino acids (EAA) and individual amino acids were linearly (p<0.01) and quadratically (p<0.01) increased with infusion SSP. The digestibility of Lysine was quadratically (p = 0.033) increased and apparent degradability of Arginine was linearly (p = 0.032) and quadratically (p = 0.042) increased with infusion SSP. The results indicated that infusion SSP could improve nutrient digestion, ruminal fermentation and AA availability.

Entities:  

Keywords:  Cattle; Digestibility; Flow; Microbial; Rumen Fermentation; Soybean Small Peptide

Year:  2013        PMID: 25049708      PMCID: PMC4093062          DOI: 10.5713/ajas.2012.12277

Source DB:  PubMed          Journal:  Asian-Australas J Anim Sci        ISSN: 1011-2367            Impact factor:   2.509


INTRODUCTION

It has been demonstrated that rumen bacteria uical">se both ical">n class="Chemical">ammonia-N and non-ammonia-N (NAN; e.g. amino acid, peptides) for bacterial protein synthesis and some species of bacteria prefer NAN to ammonia-N (Russell et al., 1992; Cruz Soto et al., 1994; Griswold et al., 1996). Lindemann et al. (2000) and Dabrowski et al. (2003) showed that supplying peptides offered an advantage over free AA that is easily deaminated in the rumen. However, discrepant results were reported from in vitro studies that assessed the effects of peptides on the rumen metabolism. Whilst some studies showed that rumen bacteria growth, fibre digestion and overall rumen fermentation were improved by supplementation of peptides (Griswold et al., 1996; Carro and Miller, 1999; Russi et al., 2002), this was not observed in other studies (Cruz Soto et al., 1994; Jones et al., 1998). However, there is little information about the effects of supplementation of peptide on rumen microbial activity and on ruminal metabolism in vivo. Small ical">peptides obtaiical">ned from proteolytic hydrolysis of difical">n class="Chemical">ferent plant proteins have been shown to have various biological and pharmaceutical activities including enhancing growth performance and immunological status (Kotzamanis et al., 2007), offering a more cost-effective way of supplementing AA (Zimmerman et al., 1997; Lindemann et al., 2000; Dabrowski et al., 2003), improving nitrogen retention (Adibi et al., 1993), and increasing mohair fiber growth (Puchala et al., 2002). Zhang et al. (2007) reported that feeding or duodenal infusing SSP, improved nitrogen balance and protein biological value and increased digestibility of dietary nutrients in goats and that supplying SSP by infusing through a duodenum fistula was more efficient than feeding. Liu et al. (2009) also observed increased absorption of small peptides from small the intestine and increased milk protein synthesis by duodenal infusion of SSP. However, information of the effects of SSP on rumen fermentation, microbes and digestive tract metabolism is limited. The objective of this study was to determine the effects of SSP on ruminal fermentation and nutrition digestibility of beef cattle.

MATERIALS AND METHODS

Experimental design and diets

The experiment consisted of four treatments and was conducted in a 4×4 Latin square arrangement using four Luxi ies">Cattle steers (approximate 30 mopan class="Chemical">ical">nths old) averagiical">ng 400±10 kg body weight aical">nd fitted with rumiical">nal, proximate duodeical">nal (simple T-piece) aical">nd termiical">nal ical">n class="Disease">ileal cannula. The fistulation procedures and animal care were according to the experimental protocol that was reviewed and approved by Shandong Academy of Agriculture Sciences. Cattle were fed indoors in individual stalls. Each period lasted for 20 d, comprising a 10-d adaptation and 10-d experiment and sampling. The four treatments were basal diet supplemented with SSP which was produced from proteolytic hydrolysis (ZS Duqing Biotech CO., Ltd., Shandong, China) and dosed by ruminal infusion at the levels of 0, 100, 200 and 300 g/d (denoted as Control, SSP100, SSP200 and SSP300 respectively). The AA composition of the SSP is shown in Table 1. The basal diet (Table 2) was a total mixed ration (TMR) formulated to meet the nutrient requirements of cattle (Feeding Standard of Cattle of the People’s Republic of China, NY/T815- 2004). The TMR was offered in equal amount twice daily at 07:00 and 19:00 for 95% of the ad libitum intake and all cattle had free access to fresh water. The daily amount of SSP of each treatment was dissolved in 1,000 ml of 0.9% physiological saline and was infused using a peristaltic pump (BL-100, Prefluid Technology Company, Jiangsu, China) into the rumen through the ruminal cannula upon morning feeding from d 11 to d 20 at 7:00 clock everyday. Cattle without SSP were infused 1.0 L of physiological saline only (Control).
Table 1

The concentration (mg/g) of total amino acids and peptide amino acids in soybean small peptides

ItemsTotal amino acid contentPeptide amino acid content
Aspartic acid90.9189.06
Glutamic acid196.10189.48
Serine46.6046.06
Histidine19.7018.97
Glycine32.6032.09
Threonine32.0030.72
Arginine62.0060.85
Alanine34.9032.85
Tyrosine27.6026.19
Cystine6.706.19
Valine32.0030.65
Methionine12.5011.45
Phenylalanine38.2035.49
Isoleucine30.8030.15
Leucine61.1055.77
Lysine55.4054.59
Proline52.3052.29
TAA1831.41802.85

TAA = Total amino acids.

Table 2

Ingredients and chemical composition of the basal diet (% DM) fed during the experiment

IngredientsContent
  Chinese wild rye61.61
  Corn27.00
  Wheat bran2.89
  Cottonseed meal6.75
  Calcium hydrogen phosphate0.35
  Calcium carbonate0.58
  Sodium chlorid0.39
  Sodium bicarbonate0.39
  Minerals premix10.04
  Vitamins preminx20.19
  Total100.00
Analyzed composition
  CP %9.55
  ADF %27.68
  NDF %52.27
  Ca %0.86
Calculated composition
  NEm/(MJ/kg)6.48

Provides per kg of minerals premix: 40 g of Mn, 60 g of Zn, 20 g of Fe, 30 g of Cu, 1.5 g of I, 1 g of Se, 400 mg of Co.

Provides per kg of minerals vitamins premix: 30,000,000 IU of vitamin A, 100,000,000 IU of vitamin D, 6,000 mg of vitamin E.

Sampling and preparations

Samples of ical">feed ofical">n class="Chemical">fered were taken daily during the entire experimental period, composted, oven dried (55°C) and ground to pass 1.0 mm screen for chemical analysis. Duodenal and ileal flow and fecal output were measured by 15 g/d of chromic oxide (Uden et al., 1980), which was given as three boluses of 2.5 g each (7.5 g twice daily at 07:00 and 19:00 h) and administered into the rumen via fistula before feeding on d 11 through 20. On d 18 to 20, samples of duodenal (300 ml) and ileal (200 ml) chyme, faeces (300 g wet basis) and ruminal fluid (200 ml) from the rumen were collected every 6 h daily. The sampling time was adjusted 2 h ahead of the previous day so that samples obtained represented every 2 h during 24-h period (12 total samples). The duodenal, ileal and fecal samples were immediately stored at −20°C, lyophilized and ground in a Wiley mill to pass a 1.00 mm screen for laboratory analysis. Sub-samples of rumen fluid were also strained through four layers of cheesecloth, pH measured immediately using a pH meter (Model PB-20, Sartorius, Germany), and were then stored at −20°C for analysis of ammonia-N, microbial crude protein (MCP) and volatile fatty acids (VFA). Approximately 200 ml of rumen fluid collected at 6 h after n class="Chemical">feediical">ng oical">n d 20 of each period was immediately stored at −80°C for determiical">natioical">n of the relative quaical">ntity to total bacterial 16 S rDical">n class="Chemical">NA of Butyrivibrio fibrisolvens, Ruminococcus flavefaciens, Ciliate protozoa, Butyrivibrio fibrisolvens and Streptococcus bovis.

Chemical analysis

Samples were analyzed for total n class="Chemical">N, ical">n class="Disease">DM, OM, Ca and P (AOAC, 1997), and for NDF and ADF (Van Soest et al., 1991). Amino acid analyses were performed according to the methods of the AOAC (1997) using the cationic HPLC system that utilizes post derivatization with ninhydrin followed by UV. ical">Chromium copan class="Chemical">ical">nceical">ntratiopan class="Chemical">ical">ns of duodeical">nal, ileal, aical">nd ical">n class="Chemical">fecal samples were determined by atomic absorption spectrophotometry with an acetylene/air flame according to the methods of Willams et al. (1962). Rumen fluid samples were analyzed for ammonia N and VFA concentration using methods described by Hu et al. (2005) and for MCP by analyzing purine concentration using method described by Zinn and Owens (1986). Quantification of microbial 16S rRical">NA marker geical">nes by RT-PCR: Total Dical">n class="Chemical">NA was extracted from rumen fluid by a SDS-based DNA extraction method as described by Zhou et al. (1996). The primers of total bacteria, ciliate protozoa, Prevotella ruminicoal, Butyrivibrio fibrisolvens, Ruminococcus flavefaciens and Sreptococus bovis are listed in Table 3, as described by Khafipour et al. (2009) and Stuart and McSweeney (2006). The species-specific real-time quantitative PCR was performed using the Roche 4500 real time PCR system with fluorescence detection of SYBR green dye. Amplification conditions were as follows: one cycle at 95°C for 30 s for initial denaturation and followed by 40 cycles of 95°C for 5 s and 60°C for 20 s. Specificity of amplified products was confirmed by melting temperature and dissociation curves after each amplification. Amplification efficiencies for each primer pair were investigated by examining dilution series of total ruminal microbial DNA template in triplicate.
Table 3

PCR primers for real-time PCR assay

Target speciesForward/reversesPrimer sequence
Butyrivibrio fibrisolvens1FACCGCATAAGCGCACGGA
RCGGGTCCATCTTGTACCGATAAAT
Prevotella ruminicoal1FGCGAAAGTCGGATTAATGCTCTATG
RCCCATCCTATAGCGGTAAACCTTTG
Sreptococus bovis1FTTCCTAGAGATAGGAAGTTTCTTCGG
RATGATGGCAACTAACAATAGGGGT
Ruminococcus flavefaciens1FGAGTGAAGTAGAGGTAAGCGGAATTC
RGCCGTACTCCCCAGGTGG
Ciliate protozoa1FGCTTTCGWTGGTAGTGTATT
RCTTGCCCTCYAATCGTWCT
Total bacteria2FCGGCAACGAGCGCAACCC
RCCATTGTAGCACGTGTGTAGCC

Khafipour et al. (2009).

Denman and McSweeney (2006).

Data calculation and statistical analysis

Duodenal, ileal, and ical">fecal output for each ical">n class="Species">cattle were calculated as the amount of chromic oxide consumed (g/d) divided by the chromic oxide concentration (g/kg of DM) in the duodenal and ileal chyme or feces (Wang et al., 1998). Nutrient apparently digested in the rumen was calculated as the difference between the nutrient intake (kg/d) and its duodenal flow (kg/d). Nutrient apparently digested in the small intestinal was calculated as the difference between the duodenal flow (kg/d) and ideum flow (kg/d). Nutrient apparently digested in the large intestinal was calculated as the difference between the ideum flow and fecal output (kg/d). Nutrient apparently digested in the total tract was calculated as the difference between the intake and fecal output (kg/d). The abundance of 16S rRn class="Chemical">NA marker gepan class="Chemical">ical">ne copy ical">number for the ciliate protozoa, ical">n class="Species">P. ruminicola, B. fibrisolvens, R. flavefacien and S.bovis were expressed relative to the copy number of total rumen bacterial 16S rRNA according to the following equation: Where Ct repren class="Chemical">seical">nts threshold cycle. Data were analyzed as 4×4 Latin square using Mixed procedure of SAS (version 8.0, 2000). The following model was fitted to all variables that did not have repeated measurements over time. Where Yijkl is the dependent variable, μ is the overall mean, Ci is the efical">fect of ical">n class="Species">cattle (i = 1 to 4), Pj is the effect of period (j = 1 to 4), Tk is the effect of treatment (k = 1 to 4), Zl is the effect of sample time l, and εijkl is the residual error. All terms were considered fixed except for εijkl which was considered random. Polynomial contrasts were used to assess linear and/or quadratic dose-effects of SSP. Differences among treatments were declared significant at p<0.05 using LSMEANS with PDIFF and adjusted with a Dunnett’s test of SAS (2000).

RESULTS

Ruminal fermentation characteristics

In general, increasing the rate of ical">SSP iical">nfusiopan class="Chemical">ical">n from 100 to 300 g/d iical">ncreaical">n class="Chemical">sed concentrations of ammonia-N (L, Q; p<0.001), MCP (L, Q; p<0.001) and VFA (L; p = 0.029) and molar proportions of acetate (Q; p<0.05) and propionate (p<0.001), but reduced molar proportion of butyrate (L, p<0.05; Q, p<0.001) and acetate:propionate (A:P) ratio (L, Q; p<0.001; Table 4). Compared to Control, rumen fluid from all SSP infused cattle had higher (p<0.001) concentrations of ammonia-N and MCP, lower (p<0.001) A:P ratio but similar pH. In contrast, effects of SSP on ruminal VFA profile depended on the rate of SSP infusion. Rumen fluid from cattle in SSP200 and SSP300 had higher (p<0.05) concentrations of VFA and higher (p<0.05) molar proportions of propionate than that in Control, whereas these differences were not found between SSP100 and Control.
Table 4

Effects of soybean small peptide (SSP) infusion into rumen at the rates of 0 (Control), 100 (SSP100), 200 (SSP200) and 300 (SSP300) g/d on characteristics of rumen fermentation and microbial abundance as determined by marker gene copy number in total bacterial 16 S rRNA (percentage of total bacterial 16 S rRNA ) (n = 4)

ItemTreatmentSEM1Contrast2


ControlSSP100SSP200SSP300LQ
pH6.546.486.546.560.6180.6860.820
Ammonia N (mg/L)66.91c84.39b96.79b116.31a9.363<0.001<0.001
Microbial protein (mg/L)62.49c74.99b82.27b92.45a8.594<0.001<0.001
Total VFA (mmol/L)86.03b89.92ab91.74a92.01a1.3130.0290.092
Acetate (mol/100 mol)75.97a71.93c73.74bc74.35ab1.0350.4230.038
Propionate (mol/100 mol)13.98c14.53c16.48b19.14a0.8<0.001<0.001
Butyrate (mol/100mol)10.05b13.55a9.78b6.51c1.0040.022<0.001
Acetate:propionate5.45a4.95b4.49c3.92d0.672<0.001<0.001
Ruminal microbial
  P. ruminicola (×10−2)1.942.182.032.210.7320.2310.437
  R. flavefaciens (×10−2)5.515.915.785.750.8320.6990.93
  B. fibrisolvens (×10−4)1.50b1.68ab1.82a1.70ab0.6220.1620.194
  S. bovis (×10−6)5.91a4.87b4.85b4.94b0.8010.0490.020
  Ciliate protozoa (×10−2)3.823.833.983.870.7710.6860.866

SEM = Standard error of mean.

p values for the linear (L) or quadratic (Q) effects of SSP infused at the rates 0, 100, 200, 300 g·cattle−1·d−1.

Means within a row with different superscript letter differ (p<0.05).

Infusion of ical">SSP at the rates of 100, 200 aical">nd 300 g/d iical">ncreaical">n class="Chemical">sed (p<0.05) percentage of 16S rRNA gene copies of S. bovis, but did not affect percentages of 16S rRNA gene copies of P. ruminicola, R. flavefaciens or ciliate protozoa in the total bacterial 16S rRNA gene copies as compared to that of Control. In contrast, percentage of 16S rRNA gene copies of B. fibrisolvens was increased (p<0.05) by SSP infused at the rate of 200 g/d but not others.

Nutrient intake, flow and digestibility in gastrointestinal tract

Nutrient intakes and apparent total tract digestibility are preical">seical">nted iical">n Table 5. Becauical">n class="Chemical">se DMI was restrained, intake of DM, OM, NDF, and ADF did not differ among treatments. Nitrogen intake increased as the levels of SSP infusion increasing (p<0.05). The duodenal flow (kg/d) of DM was linearly (p<0.001) and quadratically (p<0.001) decreased and the duodenal flow of NDF was linearly decreased (p = 0.042) by the infusion of SSP. On the contrary, duodenal flow of ADF increased (p<0.05) in cattle receiving 300 g/d of SSP infusion as compared to the control.
Table 5

Effects of soybean small peptide (SSP) infusion into rumen at the rates of 0 (Control), 100 (SSP100), 200 (SSP200) and 300 (SSP300) g/d on digestion of nutrient at different digestive sites of Luxi Yellow cattle (n = 4)

ItemTreatmentSEM1Contrast2


ControlSSP100SSP200SSP300LQ
DM
  Flux to duodenum (kg/d)4.15a4.15a4.07a3.97b2.675<0.001<0.001
  Flux to ileum (kg/d)3.213.183.153.143.2270.3810.677
  Fecal flux (kg/d)2.71a2.62b2.59bc2.53c2.5690.0010.002
Apparent digestion, of intake (g/100 g)
  Rumen43.02b43.14b44.12b45.49a0.9180.0670.021
  Small intestine12.9213.4812.6311.41.0920.1840.275
  Large intestine6.947.797.658.391.0550.1890.436
  Total tract62.88b64.41a64.40a65.28a0.905<0.0010.002
OM
  Flux to duodenum (kg/d)3.93a3.97a3.91a3.80b2.3730.1230.153
  Flux to ileum (kg/d)3.0532.972.963.3190.1830.399
  Fecal flux (kg/d)2.61a2.47b2.47b2.42b2.774<0.0010.001
Apparent digestion, of intake (g/100 g)
  Rumen47.54b47.04b47.80b49.26a0.8070.9810.25
  Small intestine11.7712.8312.6411.231.150.7130.484
  Large intestine5.837.136.627.291.072<0.0010.001
  Total tract65.13b67.00a67.05a67.79a0.943<0.0010.001
NDF
  Flux to duodenum (kg/d)2.17a2.11ab2.15ab2.09b2.5320.0420.136
  Flux to ileum (kg/d)2.08a1.98ab1.99ab1.94b2.8480.0220.04
  Fecal flux (kg/d)1.73a1.71a1.66b1.61c2.2240.0010.004
Apparent digestion, of intake (g/100 g)
  Rumen48.7750.2849.2650.810.9920.0420.136
  Small intestine2.222.913.853.421.130.1770.31
  Large intestine8.276.227.767.681.1060.9510.582
  Total tract59.26c59.42c60.87b61.91a0.8630.0010.004
ADF
  Flux to duodenum (kg/d)1.32b1.34ab1.34ab1.38a2.3280.0680.183
  Flux to ileum (kg/d)1.261.241.221.262.6270.950.66
  Fecal flux (kg/d)1.091.051.041.052.3660.1220.084
Apparent digestion, of intake (g/100 g)
  Rumen34.80a33.70ab33.84ab31.84b1.0980.0680.183
  Small intestine3.074.845.555.611.2460.0680.137
  Large intestine8.139.529.1310.441.1610.1450.36
  Total tract45.9948.0648.5347.901.1160.1220.085
N
  Intake (g/d)119.1d130.4c142.1a153.2b0.71<0.001<0.001
  Flux to duodenum (g/d)121.7125.0129.6132.91.710.0190.072
  Flux to ileum (g/d)51.8453.3158.2962.31.6110.0080.032
  Fecal flux (g/d)48.0747.1848.9149.391.1520.4060.649
  Urinary (g/d)52.41a57.65b55.37c63.94d0.908<0.001<0.001
  Retain nitrogen (g/d)18.65c25.54b37.77a39.83a1.057<0.001<0.001

SEM = Standard error of mean.

p values for the linear (L) or quadratic (Q) effects of SSP infused at the rates 0, 100, 200, 300 g·cattle−1·d−1.

Means within a row with different superscript letter differ (p<0.05).

Apparent rumen digestibility of isease">DM was quadratically (p<0.05) iical">ncreaical">n class="Chemical">sed, and apparent rumen digestibility of NDF was linearly (p<0.05) increased, whereas the ileum flow of NDF decreased (L, Q, p<0.05) with the increasing rate of SSP infusion. Similarly, OM digestion in the large intestine and the total tract digestion of DM, OM, and NDF were also linearly and quadratically (p<0.01) increased as the rate of SSP infusion increased. Ruminal infusion of n class="Chemical">SSP at the rates up to 300 g/d did ical">not afical">n class="Chemical">fect N flow to duodenum and ileum or fecal N output, but increased urinary N excretion (L, Q; p<0.001) and N retention (L, Q; p<0.001).

Flux and digestion of AA at different digestive sites

Ruminal infusion of ical">SSP iical">ncreaical">n class="Chemical">sed (p<0.05) duodenal flux of all 17 AA examined in this study as compared to Control (Table 6). The efficacy of different amounts of SSP on the AA duodenal flux depended on the individual AA with the greatest effects observed at the higher dosage. In general, increasing the amount of infused SSP from 100 to 300 g/d linearly and quadratically increased (p<0.01) increased duodenal flux of 17 AA with the exception of Tyrosine that was only quadratically (p<0.01) increased by the infusion of SSP. Similarly, flux at the terminal ileum of AA examined were also increased (p<0.05) by the ruminal infusion of SSP compared to Control with the exception of Arginine, Threonine, Tyrosine, and Methionine (Table 7). The increased flux of these AA by SSP was also observed in a dose dependent manner and most of them were linearly and/or quadratically (p<0.05) increased as the SSP increased from 100 to 300 g/d. In contrast, the digestibilities of most of the AA examined in the small intestine were not affected by SSP (Table 8) and increased AA digestibility was only observed for Arginine at SSP100, SSP200 and SSP300 and for Lysine at SSP200 (p<0.05).
Table 6

Effects of soybean small peptide (SSP) infusion into rumen at the rates of 0 (Control), 100 (SSP100), 200 (SSP200) and 300 (SSP300) g/d on flux of amino acids at proximate duodenum of Luxi Yelow cattle (n = 4)

ItemTreatmentSEM1Contrast2


ControlSSP100SSP200SSP300LQ
Aspartic acid43.20b45.59b54.87a57.74a1.308<0.001<0.001
Glutamic acid72.26c78.00b89.87a94.24a1.330<0.001<0.001
Serine29.67c31.73c40.66b44.46a1.106<0.001<0.001
Glycine23.26bc22.10c26.78b31.57a1.240<0.001<0.001
Histidine13.86c17.42b18.21ab19.71a0.968<0.001<0.001
Arginine23.01c24.95b27.96a28.49a1.010<0.0010.002
Threonine25.04c26.62bc29.36ab30.95a1.130<0.001<0.001
Alanine30.10b30.14b29.76b36.73a0.9220.004<0.001
Proline27.79c31.43b33.97b38.12a1.127<0.001<0.001
Tyrosine17.80ab15.87c16.86bc19.21a0.9790.1610.003
Valine30.74c31.96bc33.39ba34.38a1.053<0.0010.002
Methionine8.66b9.68ba10.54ba10.82a1.0190.0030.009
Cystine8.96c8.97c10.17b12.32a0.849<0.001<0.001
Isoleucine26.37b28.36ab30.27a30.31a1.1540.0040.009
Leucine42.02b44.74b49.06a49.93a1.232<0.001<0.001
Phenylalanine20.59c23.39b26.30a25.07a0.9640.002<0.001
Lysine25.38d29.88c33.50b35.78a1.067<0.001<0.001
TAA3468.43b495.15b548.73a583.85a2.181<0.001<0.001
NEAA4244.08d254.85c292.75b322.07a1.509<0.001<0.001
EAA5224.63c245.97b269.62a276.85a1.604<0.001<0.001

SEM = Standard error of mean.

p values for the linear (L) or quadratic (Q) effects of SSP infused at the rates 0, 100, 200, 300 g·cattle−1·d−1.

TAA = Total amino acids.

NEAA = Non-essential amino acids.

EAA = Essential amino acids.

Means within a row with different superscript letter differ (p<0.05).

Table 7

Effects of soybean small peptide (SSP) infusion into rumen at the rates of 0 (Control), 100 (SSP100), 200 (SSP200) and 300 (SSP300) g/d on flux of amino acids at the terminal ilenum of Luxi Yelow cattle (n = 4)

ItemTreatmentSEM1Contrast2


ControlSSP100SSP200SSP300LQ
Aspartic acid13.76b14.49b17.89a18.87a1.015<0.0010.005
Glutamic acid25.26b26.91ab31.29ab32.57a1.3930.0040.018
Serine12.22c12.80c15.19b17.80a0.946<0.0010.002
Glycine9.65b9.02b10.69ab12.47a1.0340.001<0.001
Histidine3.10b4.06a4.57a4.53a0.790<0.001<0.001
Arginine6.746.466.286.930.8560.7800.328
Threonine9.3259.3259.8810.771.0050.0490.123
Alanine10.37b10.18b10.78ab13.16a1.0990.0200.018
Proline12.13b13.33b14.09ab16.27a1.125<0.0010.001
Tyrosine6.30b5.62b6.02b7.20a0.8070.3400.268
Valine10.1810.7411.4012.051.0080.0070.031
Methionine2.42.382.582.750.7860.1070.242
Cystine2.96b2.91b2.76b3.86a0.8360.0620.017
Isoleucine6.837.457.748.490.9900.0180.067
Leucine11.79c12.38bc13.13ab14.34a0.922<0.0010.004
Phenylalanine6.68c7.18bc7.82ab8.64a0.853<0.0010.001
Lysine6.43b6.83ab7.07ab8.04a0.9150.0020.007
TAA3158.04c162.25bc179.13b198.73a1.787<0.0010.001
NEAA489.68b92.35b105.93a118.33a1.658<0.001<0.001
EAA566.43c69.91bc73.20b80.40a1.334<0.001<0.001

SEM = Standard error of mean.

p values for the linear (L) or quadratic (Q) effects of SSP infused at the rates 0, 100, 200, 300 g·cattle−1·d−1.

TAA = Total amino acids.

NEAA = Non-essential amino acids.

EAA = Essential amino acids.

Means within a row with different superscript letter differ (p<0.05).

Table 8

Effects of soybean small peptide (SSP) infusion into rumen at the rates of 0 (Control), 100 (SSP100), 200 (SSP200) and 300 (SSP300) g/d on digestion (g/g) of amino acids in the small intestine of Luxi Yelow cattle (n = 4)

ItemTreatmentSEM1Contrast2


ControlSSP100SSP200SSP300LQ
Aspartic acid68.0068.2568.3467.221.2850.8110.924
Glutamic acid64.9465.5262.2165.351.4700.8430.930
Serine58.8959.6660.5859.831.3160.6750.857
Glycine59.3559.1161.7660.171.5310.4190.638
Histidine77.4676.6176.5576.931.3310.8270.916
Arginine70.71b70.01a76.74a75.54a1.1170.0320.042
Threonine62.7464.2064.6365.181.4250.3000.575
Alanine65.4466.1665.0664.181.4130.6330.845
Proline56.3427.4858.2857.351.5400.6810.816
Tyrosine64.2864.4365.8261.991.4090.7840.876
Valine66.7966.3465.0364.971.4160.3250.622
Methionine72.3175.0676.5474.611.4370.3320.291
Cystine66.8767.7668.6173.221.5090.3110.299
Isoleucine74.0473.6974.8571.941.4630.5610.692
Leucine71.8672.2572.7870.641.3280.6250.603
Phenylalanine67.56ab69.24ab70.23a65.48b1.2120.5100.131
Lysine74.63b77.10ab79.35a77.52ab1.2320.0600.033
TAA366.2567.1267.4665.811.2280.8870.711
NEAA463.2363.7763.7963.231.3120.9980.948
EAA570.4271.5472.8370.951.1640.4580.149

SEM = Standard error of mean.

p values for the linear (L) or quadratic (Q) effects of SSP infused at the rates 0, 100, 200, 300 g·cattle−1·d−1.

TAA = Total amino acids.

NEAA = Non-essential amino acids.

EAA = Essential amino acids.

Means within a row with different superscript letter differ (p<0.05).

DISCUSSION

Effect of ruminal SSP infusion on rumen fermentation

In the ical">curreical">nt study, iical">nfusiopan class="Chemical">ical">n ical">n class="Chemical">SSP into the rumen had no effect on ruminal pH, which is consistent with other reports using peptides or sodium caseinate (Cruz Soto et al., 1994; Kazemi et al., 2010). However, ammonia-N was linearly increased as the SSP infusion rate increased, indicating a portion of the infused SSP was degraded and deaminated to ammonia. Increasing crude protein concentration or degradation of dietary protein usually results in increased ammonia concentrations in the rumen (Davidson et al., 2003). Increased ammonia concentration in the rumen was also observed when casein was infused into rumen (Khalili and Huhanen, 2002; Kazemi et al., 2010). Microbial protein synthesized in the rumen is influenced by many factors such as fermentative synchrony of degradable carbohydrate and ruminally degradable protein, ammonia concentration and pH (Fu et al, 2001) and it has been reported that between 18 and 100% microbial protein was derived from ammonia-N Salter et al. (1979). Providing peptides has been shown to stimulate the growth of rumen bacteria (Cruz Soto et al., 1994; Chikunya et al., 1996), and to enhance digestion of fiber (McAllan, 1991; Griswold et al., 1996). The results of this study demonstrated that infusion of SSP in the rumen positively increased microbial crude protein synthesis, which is consistent with another report that showed that supplying peptides and free amino acid to the rumen stimulated microbial yield and fermentation (Chikunya et al., 1996). The enhanced MCP synthesis by SSP infusion may partly due to the increased availability of ammonia-N and the improved synchronization between fermentative energy and ammonia-N (Cruz Soto et al., 1994; Chikunya et al., 1996). In the preical">seical">nt study, rumeical">n copan class="Chemical">ical">nceical">ntratiopan class="Chemical">ical">n of total ical">n class="Chemical">VFA and molar proportions of propionate were increased but molar proportion of butyrate and acetate: propionate ration were reduced by SSP infusion. This indicated that SSP infusion increased energy supply to the animal as well as improved energy efficiency. Griswold et al. (1996) found total VFA, acetate and butyrate were all increased by adding different amounts and sources of rumen degradable protein. However, Hristov et al. (2004) reported no effect of different rumen degradable protein levels on concentrations of total VFA, acetate, butyrate or propionate in rumen fluid. The discrepancy in the effects of the various forms of rumen degradable proteins on the rumen VFA profile among these studies might be due to the differences in type of animals, diet and the sources of rumen degradable proteins.

Effect of SSP infusion on ruminal microbial communities

This study found that infusion of ical">SSP had ical">no efical">n class="Chemical">fect on the population of R. flavefaciens, increased the population of B. Fibrisolvens but reduced population of S. bovis. It has been shown that some hemicelluloytic bacteria (e.g., B. fibrisolvens) utilize peptide or AA N directly for microbial protein synthesis (Cotta and Hespell, 1986). F.succinogenes, R. flavefaciens and R. albus are the main cellulolytic bacteria in the rumen (Forsberg et al., 1997) and all of them utilize ammonia-N. The results of this study may suggest that effect of ruminal infusion of SSP on rumen bacteria depend on bacterial capability in utilizing peptide- AA- and ammonia-N.

Effect of SSP infusion on nutrient digestibility

It is generally regarded that ruminally available ical">N iical">n the form of ical">n class="Chemical">peptides and AA can improve the digestion of both structural carbohydrate and nonstructural carbohydrate by rumen microorganisms. However, the Cornell net carbohydrate and protein system assumes that bacteria fermenting structural carbohydrates do not utilize peptides or amino acid and all their N must come from NH3 (Russell et al., 1992). The improved ruminal digestion of NDF by SSP infusion observed in this study indicated that microbial activity relating to fibre digestion was enhanced by the SSP infusion and this is consistent with the finding of increased microbial protein concentration by infusion of SSP in this study. The digestibility of crude fiber was also increased by addition of SSP in the diet of the goats (Zhang et al., 2004). The exact mechanism by which the microbial activity was increased by supply of SSP is not clear. However, the result that the linear increase of microbial protein was positively associated with the linear increase of ruminal ammonia-N by SSP infusion suggests that increasing the rate of SSP infusion increased the production of ammonia-N thereby enhanced MCP synthesis. Bryant (1973) proposed that ammonia-N in rumen fluid could stimulate the activity of cellulolytic bacteria. On the other hand, Carro and Miller (1999) argued that N forms other than NH3-N are needed for both maximum growth of fiber digesting ruminal microorganisms for maximum fiber digestion. Therefore the increased MCP by SSP infusion might be a combined result of increased ammonia-N and NAN. Overall, the results of this study showed ruminal infusion of ical">SSP at the rates of 100, 200 aical">nd 300 g/d iical">ncreaical">n class="Chemical">sed the apparent digestibilities of DM, OM, NDF and CP in the total digestive tract of beef cattle. The fact that the improvement in digestibilities of the nutrient by SSP mainly occurred in the rumen indicated that the beneficial effects of supplying SSP on nutrient digestion were mainly through improving rumen fermentation efficiency.

Effect of infusion SSP on AA flow and apparent digestibility of small intestinal

Ruminal infusion of ical">SSP iical">ncreaical">n class="Chemical">sed all measured AA flux to the small intestine without affecting their digestibility in the small intestine. This suggests that amount of AA absorbed from the small intestine was increased, which is consistent with the observation of an increased amount of N retained due to SSP infusion. The increased AA flux to the small intestine by SPP infusion is likely a combined result of increased flux of ruminal undegradable SPP and MCP. The similar small intestinal digestibility of AA across all the treatments also indicate that the small intestinal digestibility of AA in SPP is similar to that of other feed components used in this study.

IMPLICATIONS

In this experiment, infusion ies">soybean small ical">n class="Chemical">peptide profoundly influenced ruminal fermentation, duodenal and ileal amino acid flow, and digestion of dry matter, organic matter and fiber. Soybean small peptide may improve the absorption of individual amino acids in the small intestine. But there are still many questions to be answered, including the ruminal degradability of small peptides, the net absorption of intact peptides in the gastrointestinal tract and the influence on microbial population of infusion soybean small peptides, specially the relationship between peptide nitrogen and fiber. More research is needed in this area to determine the intake at which undegraded intake soybean small peptide supplementation becomes beneficial. Although practical application of peptides to livestock nutrition is lacking, further investigations will provide more information, which may enable the improvement of nutritional management decisions.
  33 in total

1.  Effects of urea infusion and ruminal degradable protein concentration on microbial growth, digestibility, and fermentation in continuous culture.

Authors:  K E Griswold; G A Apgar; J Bouton; J L Firkins
Journal:  J Anim Sci       Date:  2003-01       Impact factor: 3.159

2.  Effect of form of nitrogen on growth of ruminal microbes in continuous culture.

Authors:  K E Griswold; W H Hoover; T K Miller; W V Thayne
Journal:  J Anim Sci       Date:  1996-02       Impact factor: 3.159

3.  Protein supply from undegraded dietary protein.

Authors:  L D Satter
Journal:  J Dairy Sci       Date:  1986-10       Impact factor: 4.034

4.  Effect of ammonia concentration of rumen microbial protein production in vitro.

Authors:  L D Satter; L L Slyter
Journal:  Br J Nutr       Date:  1974-09       Impact factor: 3.718

5.  Proteolytic activity of the ruminal bacterium Butyrivibrio fibrisolvens.

Authors:  M A Cotta; R B Hespell
Journal:  Appl Environ Microbiol       Date:  1986-07       Impact factor: 4.792

6.  Effects of small peptides or amino acids infused to a perfused area of the skin of Angora goats on mohair growth.

Authors:  R Puchala; S G Pierzynowski; T Wuliji; A L Goetsch; T Sahlu; M Lachica; S A Soto-Navarro
Journal:  J Anim Sci       Date:  2002-04       Impact factor: 3.159

7.  The limiting amino acids in growing cattle.

Authors:  C R Richardson; E E Hatfield
Journal:  J Anim Sci       Date:  1978-03       Impact factor: 3.159

8.  Effects of different dietary levels of fish protein hydrolysates on growth, digestive enzymes, gut microbiota, and resistance to Vibrio anguillarum in European sea bass (Dicentrarchus labrax) larvae.

Authors:  Y P Kotzamanis; E Gisbert; F J Gatesoupe; J Zambonino Infante; C Cahu
Journal:  Comp Biochem Physiol A Mol Integr Physiol       Date:  2007-01-16       Impact factor: 2.320

9.  Site and extent of digestion and amino acid flow to the small intestine in beef cattle consuming limited amounts of forage.

Authors:  E J Scholljegerdes; P A Ludden; B W Hess
Journal:  J Anim Sci       Date:  2004-04       Impact factor: 3.159

10.  PEPTIDES AND OTHER NITROGEN SOURCES FOR GROWTH OF BACTEROIDES RUMINICOLA.

Authors:  K A PITTMAN; M P BRYANT
Journal:  J Bacteriol       Date:  1964-08       Impact factor: 3.490

View more
  4 in total

1.  Effects of antibacterial peptides on rumen fermentation function and rumen microorganisms in goats.

Authors:  Zhihua Ren; Renjie Yao; Qi Liu; Youtian Deng; Liuhong Shen; Huidan Deng; Zhicai Zuo; Ya Wang; Junliang Deng; Hengmin Cui; Yanchun Hu; Xiaoping Ma; Jing Fang
Journal:  PLoS One       Date:  2019-08-30       Impact factor: 3.240

2.  Rumen Fermentation and Microbiome Responses to Enzymatic Hydrolysate of Cottonseed Protein Supplementation in Continuous In Vitro Culture.

Authors:  Jia Zhou; Ziyue Ding; Qijian Pu; Benchu Xue; Shuangming Yue; Shengtao Guan; Zhisheng Wang; Lizhi Wang; Quanhui Peng; Bai Xue
Journal:  Animals (Basel)       Date:  2022-08-18       Impact factor: 3.231

3.  In vitro and in vivo Studies of Soybean Peptides on Milk Production, Rumen Fermentation, Ruminal Bacterial Community, and Blood Parameters in Lactating Dairy Cows.

Authors:  Tian Xie; Fanlin Kong; Wei Wang; Yajing Wang; Hongjian Yang; Zhijun Cao; Shengli Li
Journal:  Front Vet Sci       Date:  2022-08-11

4.  Fermented soybean meal affects the ruminal fermentation and the abundance of selected bacterial species in Holstein calves: a multilevel analysis.

Authors:  Leila Kaviani Feizi; Sabihe Soleymanian Zad; Seyed Amir Hossein Jalali; Hassan Rafiee; Masoud Boroumand Jazi; Khaled Sadeghi; Rasoul Kowsar
Journal:  Sci Rep       Date:  2020-07-21       Impact factor: 4.379

  4 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.