Emanuela Berrino1, Andrea Angeli1, Dmitry D Zhdanov2,3, Anna P Kiryukhina2, Andrea Milaneschi1, Alessandro De Luca1, Murat Bozdag1, Simone Carradori4, Silvia Selleri1, Gianluca Bartolucci1, Thomas S Peat5, Marta Ferraroni6, Claudiu T Supuran1, Fabrizio Carta1. 1. NEUROFARBA Department, Sezione di Scienze Farmaceutiche e Nutraceutiche, Università degli Studi di Firenze, Via Ugo Schiff 6, 50019 Sesto Fiorentino (Florence), Italy. 2. Institute of Biomedical Chemistry, Pogodinskaya st. 10/8, 119121 Moscow, Russia. 3. Peoples Friendship University of Russia (RUDN University), Miklukho-Maklaya st. 6, 117198 Moscow, Russia. 4. Department of Pharmacy, "G. d'Annunzio" University of Chieti-Pescara, Via dei Vestini 31, 66100 Chieti, Italy. 5. CSIRO, 343 Royal Parade, Parkville, Victoria 3052, Australia. 6. Dipartimento di Chimica "Ugo Schiff", Università di Firenze, Via della Lastruccia 3-13, 50019 Sesto Fiorentino (Florence), Italy.
Abstract
Cancer cells rely on the enzyme telomerase (EC 2.7.7.49) to promote cellular immortality. Telomerase inhibitors (i.e., azidothymidine) can represent promising antitumor agents, although showing high toxicity when administered alone. Better outcomes were observed within a multipharmacological approach instead. In this context, we exploited the validated antitumor targets carbonic anhydrases (CAs; EC 4.2.1.1) IX and XII to attain the first proof of concept on CA-telomerase dual-hybrid inhibitors. Compounds 1b, 7b, 8b, and 11b showed good in vitro inhibition potency against the CAs IX and XII, with KI values in the low nanomolar range, and strong antitelomerase activity in PC-3 and HT-29 cells (IC50 values ranging from 5.2 to 9.1 μM). High-resolution X-ray crystallography on selected derivatives in the adduct with hCA II as a model study allowed to determine their binding modes and thus to set the structural determinants necessary for further development of compounds selectively targeting the tumoral cells.
Cancer cells rely on the enzyme telomerase (EC 2.7.7.49) to promote cellular immortality. Telomerase inhibitors (i.e., azidothymidine) can represent promising antitumor agents, although showing high toxicity when administered alone. Better outcomes were observed within a multipharmacological approach instead. In this context, we exploited the validated antitumor targets carbonic anhydrases (CAs; EC 4.2.1.1) IX and XII to attain the first proof of concept on CA-telomerase dual-hybrid inhibitors. Compounds 1b, 7b, 8b, and 11b showed good in vitro inhibition potency against the CAs IX and XII, with KI values in the low nanomolar range, and strong antitelomerase activity in PC-3 and HT-29 cells (IC50 values ranging from 5.2 to 9.1 μM). High-resolution X-ray crystallography on selected derivatives in the adduct with hCA II as a model study allowed to determine their binding modes and thus to set the structural determinants necessary for further development of compounds selectively targeting the tumoral cells.
Eukaryotic
cells do possess limited replicative potential as progressive
shortage of the chromosome ends (i.e., the telomeres) takes place
after every duplication cycle.[1] Once the
criticalphysicallimits are reached, cellular senescence programs,
that is, apoptosis, are triggered.[2] Such
an effect is properly referred as the “Hayflick limit”,
who first reported experimentally the finite capacity of normal cells
to replicate.[1,3]The state-of-the-art knowledge
on telomeres accounts for rather
complicated and highly dynamic structures which are evolutionarily
conserved among the eukaryotic cells.[4] Human
telomeres are composed of repetitive, noncoding hexameric nucleotide
repeats in complex with the telomere-associated proteins (i.e., the
shelterin proteins) and the telomerase.[5−8] The former are mainly responsible for maintaining
the telomere structure and its signaling functions, whereas the latter
for synthetizing new telomeric DNA strands from its own RNA template.[4,5] This enzyme is normally highly active in adult germ line and stem
cells, whereas it is poorly or not expressed at all in the somatic
ones.[9,10] Besides the canonical function of telomere
elongation, the telomerase enzymes (EC 2.7.7.49) were also found to
act as transcriptional regulators of the Wnt/β-catenin signaling
pathway, thus suggesting a role in determining cell growth, differentiation,
and apoptosis via a nontelomer-dependent manner.[11−13]The majority
of malignant tumors in humans were demonstrated to
depend on the telomerase activity, which resulted in increased telomerase
activity when compared to the nontumorigenic counterpart cells.[14] As a matter of fact, the catalytic subunit of
the telomerase enzyme (i.e., hTERT) was found overexpressed in severaltumors,[15−18] and its regulatory role in metastatic events was also proved.[19] In light of such data, the telomerase is properly
considered a tumor marker,[20] and still
it is taken into consideration as a rational target for developing
potent and effective anticancer drugs.[15,20−22]By making use of the DNA polymerase activity of the telomerase,
nucleoside and nucleotide analogues have been extensively investigated
as potential inhibitors.[23] In particular,
chain-terminator reverse-transcriptase inhibitors have been explored
as antitumor agents.[23] The first study
of this type was conducted by Blackburn in 1994 on the ciliated protozoan Tetrahymena thermophila which is quite rich in telomeres.[24] Such studies revealed that azidothymidine (AZT) was able to decrease the de novo telomere addition, thus
resulting in shortening of telomeres.[24] Further studies showed that in spite of the low affinity of AZT for mammalian DNA polymerases, its triphosphate derivative
(AZT-TP) was incorporated into the telomeric region of
an eukaryotic genome through a process mediated by the telomerases.[25,26] The efficiency of AZT in affecting tumor growth was
properly assessed,[27−29] and its association with cisplatin, paclitaxel, or
5-fluorouracil showed synergistic interactions.[30,31] Although such promising results were obtained, AZT was
dropped as an antitumor drug because of its potentialtumorigenic
properties and the tardiness of the drug to be fully functional, which
may expose patients to dangerous side effects.[32] Various drawbacks are associated with the use of telomerase
inhibitors for cancer therapy.[33] The tardiness
to take action is the most critical issue, as cellular senescence
is induced only when telomeres have reached their criticallength
and thus implying that such agents do require appropriate time to
become effective.[32,33] Induction of cellular senescence
by telomeric dysfunction may also result in activation of oncogenes
and/or silencing of tumor suppressor genes, thus promoting malignant
transformations to occur instead.[34] In
addition, the use of inhibitors of the telomerases may interfere with
highly proliferative cells such germ lines and stem cells.[10,22] For all these reasons, the use of telomerase inhibitors (i.e., AZT, Imetelstat, BIBR1532, and antisense molecules) for the
management of cancer is better envisaged within a polypharmacologically
based approach, and the metalloenzyme carbonic anhydrase (CA; EC 4.2.1.1)
IX is well suited.[35−37] CA IX (and marginally CA XII) is selectively overexpressed
in hypoxic solid tumors, and it actively participates in a complex
pH regulation machinery tuned to warrant cancer cell survival within
a metabolically driven pH-dysregulated environment.[37−40] The paramount importance of CA
IX in regulating proton dynamics by means of eq was conclusively demonstrated, which allowed
to validate such an enzyme as a druggable target for the management
of hypoxic tumors.[38,39]A recent contribution on the active
involvement of CA IX in tumorphysiology demonstrated such an enzyme to provide the H+ ions needed by the matrix metalloproteinase 14 to perform proteolytic
cleavage of collagen, which in turn determines tumor invasiveness.[41] In this context, during the last years, great
interests have been turned to the CA IX “interactome”.[42−45] A significant study conducted on HEK-293 cells showed that the ARM
and/or HEAT-repeat domains are a feature of CA IX interacting partners.[45] The majority of such proteins belong to the
nuclear-cytoplasmic trafficking machinery, such as XPO1 exportin and
TNPO 1 importin, and were found to interact with the CA IX C terminal
region.[45] These results strongly suggested
that CA IX may play the role of a cell–surface signal transducer
by undergoing nuclear translocation. This is in agreement with confocal
immunofluorescence spectroscopy experiments, which showed nuclear
distribution of CA IX in several celllines, with a marked localization
when experimentalhypoxic conditions were established.[45]In consideration of the robust antitumor
effects observed when
the telomerase and the CA IX were targeted, the research herein reported
is aimed to obtain CA–telomerase dual small-molecule inhibitors
(CAI–TI) that are able to (i) efficiently bind
to the CA IX (XII) enzymes which is assumed as a discriminant feature
between the tumor and normal cells and (ii) exert their antitumoral
activity by inhibition of both the CA IX (or XII) and the telomerase.
As a consequence, appropriate CAI–TI molecules
will have the potential to achieve therapeutic performances far superior
to the ones reached when coadministration of single therapeutic agents
is considered. To the best of our knowledge, this is the first report
on CAI–TI; dual-hybrid compounds designed to target
two crucial players in cancer progression.
Results and Discussion
Design
and Synthesis of Compounds
The hybridization
strategy was performed by exploiting the versatile “click chemistry”
approach, which allows to merge efficiently single chemical entities
and thus grant easy access to wide molecular diversities.[46,47] In this study, we performed a copper-catalyzed azide–alkyne
cycloaddition (CuAAC) between the azide of the reverse-transcriptase
inhibitor AZT with the terminalalkyne pendant installed
on various CAI scaffolds (Figure ). Our interest in establishing
such a chemical connection was mainly based on (i) the rapid and regioselective
formation of the 1,4-disubstituted-1,2,3-triazole ring under mild
reaction conditions[47,48] and (ii) the 1,2,3-triazole is
among the most commonly used scaffolds in medicinal chemistry in the
last decade because it is a bioisostere of the amide group and it
shows good tolerance to metabolic processes as well as to pH fluctuations.[49,50] In addition, the abundancy of electrons within the triazole ring
allows it to establish H-bonds and π–π stacking
interactions with biological targets and thus ensuring additional
stabilization of the adducts formed.[49,50]
Figure 1
Schematic representation
of the synthetized hybrids consisting
of a CAI portion linked to AZT through the 1,2,3-triazole
ring.
Schematic representation
of the synthetized hybrids consisting
of a CAI portion linked to AZT through the 1,2,3-triazole
ring.Substrates for the synthesis of alkynes 1b–3b, 5b–10b, 14b–20b, 4d, and 13e.The synthesis and characterization data of the appropriate alkyne
precursors 1a–3a, 5a–10a, 14a–20a, and 4c, reported in Table , are descripted within
the Experimental Protocols section. Both classical
(i.e., sulfonamides) and nonclassical (i.e., coumarins and sulfocoumarins)
CAIs have been included in our study. In particular, sulfonamide-based
compounds 6a, 9a, and 10a and
coumarin-based compounds 14a, 18a, and 19a are new.
Table 1
Reagents and Conditions
for the Synthesis
of Compounds 1a–3a, 5a–10a, 14a–20a, 4c, and 13d
Reported in Figure .
Yields
refer to isolated products.
Reported in Figure .
Figure 2
Substrates for the synthesis of alkynes 1b–3b, 5b–10b, 14b–20b, 4d, and 13e.
Yields
refer to isolated products.Compounds 13d, here reported for the first time, were
obtained through a multistep synthetic approach, reported in Scheme .
Scheme 1
Synthesis of Compounds 1b–3b, 5b–10b, 14b–20b, 4d, and 13e
Yields are reported
in brackets.
Synthesis of Compounds 1b–3b, 5b–10b, 14b–20b, 4d, and 13e
Yields are reported
in brackets.The final compounds 1b–3b, 5b–12b, 14b–20b, 4d, and 13e, reported in Figure , were obtained by performing CuAAC by using
Cu (0) nanosized, tetramethyl
ammonium chloride (TMACl) as a phase-transfer agent in tBuOH/H2O 1:1 as a solvent at 40 °C (Scheme ).
Figure 3
Chemical structures of
compounds 1b–3b, 5b–12b, 14b–20b, 4d, and 13e. Yields
are reported in brackets and are referred
to the final coupling reaction.
Scheme 2
Synthesis of Compounds 1b–3b, 5b–10b, 14b–20b, 4d, and 13e
Yields are reported in brackets.
Chemical structures of
compounds 1b–3b, 5b–12b, 14b–20b, 4d, and 13e. Yields
are reported in brackets and are referred
to the final coupling reaction.Yields are reported in brackets.The syntheses of compounds 11b and 12b are reported separately (Scheme ), as for these compounds, CuAAC was not
performed
as the last reaction step. The synthesis started with the preparation
of compound D, bearing the terminalalkyne pendant, obtained
by reducing 4-selenocyanatoaniline C with NaBH4 and treating it in situ with propargyl bromide. The CuAAC reaction
between the azide of AZT and the terminalalkyne of D was then performed to afford the common intermediate E, which was subsequently reacted with 3-isothiocyanatobenzenesulfonamide
or 4-isothiocyanatobenzenesulfonamide to afford compounds 11b and 12b, respectively. All final compounds were obtained
in good yields and with high-purity grade (i.e., ≥95%) as determined
by high-performance liquid chromatography (HPLC). The structural characterization
of both intermediates and final compounds was assessed by means of 1HNMR and 13CNMR as well as high-resolution mass
spectroscopy (HRMS).
Scheme 3
Synthesis of Compounds 11b and 12b
Yields are reported in brackets.
Synthesis of Compounds 11b and 12b
Yields are reported in brackets.To the best of our knowledge, the AZT–coumarin
derivative 17b was previously reported in the literature
as part of a set of compounds intended to be used for their fluorescent
properties. No biological applications were reported in such a study.[51] In addition, ester-triazole-linked triterpenoid–AZT conjugates were also reported.[52] Cytotoxic analysis of these hybrids and their triterpenoid precursors
revealed moderate to good cytotoxic activities against two humantumor
celllines (KB and Hep-G2).[52] However,
no detailed studies on the specific targets responsible for the anticancer
effects were conducted.
CA Inhibition Profiling
The library
of compounds obtained, 1b–3b, 5b–12b, 14b–20b, 4d, and 13e, was evaluated for the inhibition
properties against the human-expressed (h) CAs I, II, VA, VB, VII,
IX, and XII isoforms by means of the stopped-flow technique applied
to the CO2 hydrase assay.[53] The
inhibition data compared to those of the standard sulfonamide inhibitor
acetazolamide (AAZ) are reported in Table .
Table 2
Inhibition
Data of hCA I, hCA II,
hCA VA, hCA VB, hCA VII, hCA IX, and hCA XII with Compounds 1b–3b, 5b–12b, 14b–20b, 4d, and 13e and the Standard Sulfonamide
Inhibitor AAZ by a Stopped-Flow CO2 Hydrase
Assay[53]
KI (nM)a
hCA I
hCA II
hCA VA
hCA VB
hCA VII
hCA IX
hCA XII
1b
4666.7
9.3
59.1
141.3
51.6
6.2
78.9
2b
4037.5
7.7
57.3
52.6
31.0
653.3
61.6
3b
>10,000
32.9
64.6
52.6
329.8
488.6
74.4
4d
>10,000
8.5
57.3
45.9
383.5
6557.1
74.0
5b
>10,000
70.7
59.4
42.9
281.1
8047.1
74.0
6b
85.5
7.7
3217.2
22.6
688.5
240.1
40.4
7b
28.0
1.3
4795.3
54.2
48.5
3.7
7.0
8b
483.0
13.4
1469.3
29.0
9.5
85.5
7.8
9b
289.7
6.3
3243.0
47.8
9.4
>10,000
8.4
10b
93.1
8.2
437.8
37.9
9.4
267.6
38.9
11b
92.8
73.2
3972.2
45.0
66.0
373.2
9.0
12b
62.3
5.6
6258.9
46.7
21.8
>10,000
7.1
13e
8771.0
21.3
3651.5
28.0
38.0
>10,000
8.1
14b
>10,000
>10,000
1725.8
44.0
0.7
>10,000
8.7
15b
>10,000
>10,000
57.8
161.0
9.3
6557.1
3.6
16b
>10,000
>10,000
666.8
40.1
0.7
21.2
9.4
17b
>10,000
>10,000
179.4
151.5
9.4
4885.7
3.5
18b
>10,000
>10,000
301.8
42.7
0.6
2948.3
40.4
19b
>10,000
>10,000
531.2
43.9
0.6
>10,000
8.9
20b
>10,000
>10,000
172.4
54.6
10.5
5852.3
2.8
AAZ
250.0
12.1
63.0
54.0
2.5
25.8
5.7
Mean from three
different assays
by a stopped-flow technique (errors were in the range of ±5–10%
of the reported values).
Mean from three
different assays
by a stopped-flow technique (errors were in the range of ±5–10%
of the reported values).As reported in Table , the compound series was investigated on the most relevant hCA isoforms
such as the ubiquitous hCAs I and II, the mitochondria-expressed hCAs
VA and VB, the abundantly central nervous system (CNS)-expressed hCA
VII, and the tumor-associated hCAs IX and XII.The structure–activity
relationships (SARs) for the titled
compounds are discussed below:Overall, the compound series screened
in vitro against the ubiquitous hCAs I and II showed preferential
inhibition in the low nanomolar range for the latter. In both cases,
the coumarin- and sulfocoumarin-based derivatives (i.e., 14b–20b) resulted ineffective (i.e., KIs >
10,000
nM) in agreement with the previously reported data.[54,55] The isosteric ethers 1b and 2b resulted
in low micromolar inhibitors of hCA I with the latter being just a
1.2-fold more potent inhibitor (KIs 4666.7
and 4037.5 nM, respectively). Interestingly, the same kinetic profile
for both compounds was retained for the hCA II isoform, although the
kinetic data were in the low nanomolar range (KIs 9.3 and 7.7 nM, respectively). Further manipulations on
the scaffold of the type reported in compounds 3b, 4d, and 5b resulted detrimental for the hCA I
(KIs > 10,000 nM). As for the isoform
II, the introduction of a N atom as in 3b and 5b determined enhancement of the KI values
(32.9 and 70.7 nM, respectively), which were realigned to the previous
ones when the N,N-bis-substituted
aniline moiety was introduced instead (KI4d 8.5 nM). Compound 7b was the most potent
inhibitor among the series against both the hCAs I and II (KIs 28.0 and 1.3 nM, respectively). Variations
of the sulfonamide position (i.e., 6b) or of the linker
connection (i.e., 8b) badly affected the potencies (see Table ). Noteworthily, the
switch of the sulfonamide moiety from 3- to 4-position as in 9b to 10b and 11b to 12b resulted in a decrease of the inhibition values for hCA I. As for
hCA II, a similar profile was observed only for 11b and 12b, whereas the opposite was obtained for the regioisomers 9b and 10b (i.e., KIs 6.3 and 8.2
nM, respectively). Finally, compound 13e showed excellent
discrimination between the isoforms tested, being 411.8-fold more
potent against hCA II over hCA I.Despite the high degree of similarity
between the mitochondrially expressed hCAs VA and VB, the kinetic
profile of the majority of the tested compounds accounted for the
preferential inhibition of the latter. The ether derivative 1b was the only sulfonamide-bearing compound among the series
which showed selective inhibition of hCA VA over VB up to 2.4-fold.
The substitution of the etherealoxygen in 1b with a
sulfur or a nitrogen instead, as in compounds 2b and 3b, respectively, suppressed any isoform selectivity, which
was maintained when N,N-disubstitution
(i.e., 4d) or elongation (i.e., 5b) was
applied (see Table ). As for the remaining sulfonamide derivatives 6b–12b and 13e, their KI values
against hCA VA were all in the micromolar range with compound 10b being the most potent among them (KI 437.8 nM). The same compounds were more effective in inhibiting
the second mitochondrially expressed hCA as they showed medium nanomolar KI values. The derivatives 6b, 13e, and 8b were the most effective against the
hCA VB and their KI values resulted up
to 2.4-fold lower when compared to the reference AAZ (see Table ). Interesting kinetic
data were observed for the coumarin-containing CAIs. The 4-alkyl-substituted
derivative 14b resulted quite effective in inhibiting
hCA VB with a selectivity index (SI; KI hCA VA/hCA VB) of 39.2. Relocation of the chain to 7-position of
the coumarin ring as in 19b did not change the kinetic
profile but heavily reduced the SI for the preferential inhibition
of the VB isoform (see Table ). Regioisomeric effects on kinetics were also evident for
compounds 15b and 17b. As reported in Table , the 6-methylenesubstituted
coumarin derivative 15b resulted a 2.8-fold stronger
inhibitor of hCA VA over hCA VB. The preferential inhibition for the
former was lost when the chain in 15b was moved to the
adjacent 7-position as in 17b (see Table ). Interestingly, the same swapping position
as in compounds 16b and 18b did not alter
the SI, which was in favor of the hCA VB for both derivatives, and
affected its intensity as it resulted halved. Finally, the sulfocoumarin
prodrug 20b also reported preferential inhibition for
the hCA VB isoform with KI values of 172.4
and 54.6 nM, respectively.As for the CNS-expressed hCA VII,
the majority of the compounds tested resulted low nanomolar inhibitors.
On considering the SARs, it is worth noting that the ethers 1b and 2b showed KI values within the medium nanomolar range (51.6 and 31.0 nM, respectively).
The introduction of a nitrogen atom instead (i.e., compounds 3b and 4d) or a tertiary amine with an alkyl
spacer (i.e., compound 5b) spoiled the inhibition potency
against the hCA VII and thus raising the inhibition values up to the
high nanomolar range (see Table ). Interestingly, the esterlinkage seems to affect
the inhibition potency for this isoform as demonstrated by the kinetic
data for both compounds 6b and 7b. As a
matter of fact, the insertion of the amide, as in compound 8b, or the ureidolinker (i.e., 9b and 10b) resulted in a sensible enhancement of the hCA VII inhibition potency
as reported in Table for the corresponding KI values which
are all comprised in the low nanomolar range (i.e., 9.5, 9.42, and
9.4 nM for 8b–10b, respectively). Interesting
results were obtained for the seleno-containing compounds 11b and 12b as the regioisomer effect on kinetics was clearly
observed. As reported in Table , the para-substituted benzenesulfonamide derivative 12b was a 3.0-fold more potent inhibitor of hCA VII when compared
to the meta one 11b (KIs
21.8 and 66.0 nM, respectively). Finally, among the sulfonamide-containing
CAIs is the 2-oxo-2,3-dihydrobenzo[d]oxazole derivative 13e which resulted in a medium hCA VII nanomolar inhibitor
with a KI value of 38.0 nM. As for the
coumarin-containing CAI moieties, the regioisomeric substitution seems
to be ineffective on the kinetic profile of such compounds against
the hCA VII isoform. As reported in Table , compounds 14b–19b resulted
in low nanomolar inhibitors, and among them, the 6- and 7-methylene-substituted
derivatives 15b and 17b were the less effective
when compared to compounds bearing longer alkyne chain between the
CAI portion and the AZT scaffold (14b, 16b, 18b, and 19b).A very interesting inhibitory profile
can be observed for all the synthetized compounds against the tumor-associated
isoforms hCA IX and XII. In general, all of them acted as low nanomolar
inhibitors of CA XII, with KI values ranging
from 2.8 to 78.9 nM. As for CA IX, the different CAI moiety inserted
within the scaffold (sulfonamide or coumarin) as well as the substitution
patterns both turned out to deeply influence the inhibition potency
against this isoform. Three main groups can be delineated on the basis
of the observed KI values against CA IX.
The first group has compounds that efficiently inhibit both tumor-associated
isoforms, such as compounds 1b, 7b, 8b, and 16b (KI values
< 100 nM against CA IX) and compounds 2b, 3b, 6b, 10b, and 11b (KI values < 1000 nM against CA IX). Except
for compound 16b, which is a 6-substituted coumarin derivative,
all the compounds belonging to this group are sulfonamide-based derivatives,
in which only one AZT moiety is present within the scaffold.
In the second group (KI values < 10,000
nM against CA IX), we can include disubstituted sulfonamide-based
compounds 4d and 5b, in which two AZT moieties were “clicked” to the dipropargyl
aminobenzensulfonamide and ethylaminobenzenesulfonamide, respectively.
In particular, the ethylaminobenzenesulfonamide derivative 5b proved to be 1.23-fold less potent against CA IX then the shorter
analogue 4d (Table ). In the second group, we can also enumerate coumarin-based
compounds 15b, 17b, and 18b and sulfocoumarin compound 20b, which inhibited CA
IX in the micromolar range (KI values
ranging from 2948.3 to 6557.1 nM). Interestingly, these compounds
strongly inhibited CA XII in the low nanomolar range (Table ). Finally, in the third group
(KI values > 10,000 nM against CA IX),
we can find compounds which selectively inhibited CA XII over CA IX.
In particular, 4- and 7-substituted coumarins14b and 19b, both bearing a four methylene alkyne chain between the
coumarin scaffold and the AZT moiety, showed to be ineffective
against CA IX in the concentration range considered, whereas a strong
inhibition of CA XIIcan be observed (KI values of 8.7 and 8.9 nM for 14b and 19b, respectively). Meta-substituted ureido compound 9b, para-substituted thioureido compound12b, and 2-oxo-2,3-dihydrobenzo[d]oxazole-5-sulfonamide compound 13e proved
to be inactive in CA IX inhibition too (KI values > 10,000 nM). Again, a strong CA XII inhibition can be
observed
for all the compounds. Noteworthily, comparing homologous compounds
such as meta- and para-substituted ureido compounds 9b and 10b and thioureido compounds11b and 12b, the crucial impact of the regioisomer on the inhibition
potency against CA IXcan be appreciated, one isomer being about 30-fold
more potent than the other. In particular, the meta-substituted ureido
compound 10b proved to be more potent than the para-analogue 9b, whereas for the seleno-containing thioureido compounds11b and 12b, the meta analogue 11b showed to be the most potent.
Cocrystallographic
Studies
In light of the promising KI values observed against the tumor-associated
isoforms CA IX and XII, the binding modes of compounds 1b and 3b within hCA II, used as a model study, were determined
by means of X-ray experiments. The electron density maps of both 1b–hCA II and 3b–hCA II adducts
accounted for both ligands placed well-ordered within the enzymatic
cleft with their sulfonamide moieties deep buried up to the bottom
of the cavity and coordinated to the zinc(II) ion in the canonical
tetrahedral geometry. Again the additional interaction between the
sulfonamidic oxygen with the T199 residue was conserved (Figures and 5).[56]
Figure 4
Inhibitor 1b bound within the active site of hCA II
at 1.1 Å resolution and showing the σA-weighted |Fo – Fc| map contoured at 2.5σ. Ligand 1b is shown in cyan. Hydrogen bonds, van der Waals interactions, and
water bridges are shown and labeled in red, blue, and green, respectively.
Residues involved in the binding of inhibitors are also shown. PDB
access code 6YPW.
Figure 5
Inhibitor 3b bound within the active
site of hCA II
at 1.3 Å resolution and showing the σA-weighted |Fo – Fc| map contoured at 2.5σ. Ligand 3b is shown in magenta. Hydrogen bonds and van der Waals interactions
are shown and labeled in red and blue. Residues involved in the binding
of inhibitors are also shown. PDB access code 6WKA.
Inhibitor 1b bound within the active site of hCA II
at 1.1 Å resolution and showing the σA-weighted |Fo – Fc| map contoured at 2.5σ. Ligand 1b is shown in cyan. Hydrogen bonds, van der Waals interactions, and
water bridges are shown and labeled in red, blue, and green, respectively.
Residues involved in the binding of inhibitors are also shown. PDB
access code 6YPW.Inhibitor 3b bound within the active
site of hCA II
at 1.3 Å resolution and showing the σA-weighted |Fo – Fc| map contoured at 2.5σ. Ligand 3b is shown in magenta. Hydrogen bonds and van der Waals interactions
are shown and labeled in red and blue. Residues involved in the binding
of inhibitors are also shown. PDB access code 6WKA.The ligand backbones of 1b and 3b are
stabilized within the hCA IIcavity site by means of a network of
hydrogen bonds and van der Waals interactions with substantial differences
of the tail orientations as clearly shown when superposition of two
structures was performed as shown in Figure .
Figure 6
Superposition of inhibitors 1b and 3b bound in the active site of hCA II. Ligand 1b is shown
in cyan and 3b in magenta.
Superposition of inhibitors 1b and 3b bound in the active site of hCA II. Ligand 1b is shown
in cyan and 3b in magenta.The diverse spatial orientations of the tail sections must be ascribed
to the replacement of the etherealoxygen in 1b with
the nitrogen atom instead as in 3b, which is the only
structural difference among them. The tail in 1b is located
toward the hydrophobic half of the catalytic cleft with the F131 residue
acting as the major clipping point. The adduct is further stabilized
by a network of hydrogen bonds, which connects the inner face of the
inhibitor to the opposite hydrophilic half of the enzymatic cleft
by means of bridged water molecules (Figures and 6). As for the
compound 3b tail, it resulted laid toward the hydrophilic
section of the enzymatic cavity and directly stabilized by means of
hydrogen bonds to the aminoacidic residues N67, E69, and Q92 (Figures and 6). Such results were in agreement with the previously discussed
CA kinetic data, which showed the strongly stabilized compound 1b being a 3.7-fold more potent inhibitor against hCA II when
compared to 3b.
Telomerase Activity Assay
As mentioned
above, AZT is known to be a potent telomerase inhibitor.[57,58] To check whether our compounds can affect telomerase, we incubated
PC3 and HT-29 cells with the most potent CA IX and XII CAI–TI compounds 1b, 7b, 8b, or 11b and measured telomerase activity. The results of the telomerase
repeated amplification protocol (TRAP) assay showed that all the tested
compounds suppressed telomerase in both PC3 and HT-29 cells (Figure A,B). The telomerase
activity in PC3 cells was higher than in HT-29. Compounds 1b and 11b demonstrated the strongest antitelomerase activity,
while 7b and 8b appeared to be less potent.
Figure 7
Suppression
of telomerase activity by CAI–TI compounds. (A)
Representative TRAP gel electrophoresis for PC3 or
HT-29 cells incubated with 20 μM CAI–TI for
48 h. (B) Quantification of TRAP for living cells. (C) hTERT expression
in incubated PC3 or HT-29 cells. Levels of hTERT mRNA were normalized
relative to the levels of reference 18S RNA. (D,F,H,J) Representative
TRAP gel electrophoresis for cell lysates treated with different concentrations
of CAI–TI. (E,G,I,K) Quantification of TRAP for
treated cell lysates. One representative TRAP gel of total four for
each of the experiment is shown. The results are presented as the
mean ± standard error of the mean. Con., control intact cells.
Suppression
of telomerase activity by CAI–TI compounds. (A)
Representative TRAP gel electrophoresis for PC3 or
HT-29 cells incubated with 20 μM CAI–TI for
48 h. (B) Quantification of TRAP for living cells. (C) hTERT expression
in incubated PC3 or HT-29 cells. Levels of hTERT mRNA were normalized
relative to the levels of reference 18S RNA. (D,F,H,J) Representative
TRAP gel electrophoresis for celllysates treated with different concentrations
of CAI–TI. (E,G,I,K) Quantification of TRAP for
treated celllysates. One representative TRAP gel of total four for
each of the experiment is shown. The results are presented as the
mean ± standard error of the mean. Con., control intact cells.Telomerase activity is strongly regulated by the
expression of
its catalytic subunit hTERT, and inhibition of its expression can
be one of the ways of how CAI–TI suppresses telomerase
in cells.[59]We investigated hTERT
expression in cells incubated with CAI–TI. In
general, hTERT expression in PC3 cells was
higher than in HT-29, which corresponds to increased telomerase activity
in such cells (Figure C). We found that the compounds have no effect on hTERT gene expression
in both types of cells. Another possible way of telomerase inhibition
is the binding of substance to hTERT protein subunit.[60] As it is shown in Figure A, PC3 cells have more active telomerase, that is why
their lysates were used for telomerase testing in cell-free experiments.
All the compounds demonstrated dose-dependent activity to inhibit
telomerase within the rage of concentrations 0.1–100 μM
(Figure D–K).
The IC50 and IC90 values for each compound are
shown in Table . Compounds 1b and 11b had the lowest IC50, that
is in accordance to telomerase inhibition in living cells.
Table 3
Determined IC50 and IC90 Values
for Telomerase Inhibitors (CAI–TI)
IC50, μMa
IC90, μMa
1b
5.2
40.0
7b
6.0
31.8
8b
9.1
60.3
11b
5.6
42.8
Mean from four different assays
by RTQ-TRAP (errors were in the range of ±5% of the reported
values).
Mean from four different assays
by RTQ-TRAP (errors were in the range of ±5% of the reported
values).
Conclusions
To the best of our knowledge, this work is the proof-of-concept
study about the concomitant use of CAIs and TIs merged within the
same molecular scaffold and able to act on two validated targets for
the management of cancer. Molecular hybridization is a powerful tool
in medicinal chemistry with extensive and several successful applications
reported so far.[61] Herein, a series of
20 CAI–TI of the AZT-type compounds
has been synthetized and fully characterized. Then, inhibition potencies
against the two designed targets have been assessed. CA inhibition
data against seven hCA isoforms revealed that all the titled compounds 1b–3b, 5b–12b, 14b–20b, 4d, and 13e strongly inhibit hCA XII,
whereas some of them (1b–3b, 6b–8b, 10b, 11b, and 16b) showed
medium–high inhibition potency against hCA IX.The evaluation
of telomerase activity in celllysates or in cells
incubated with the CA IX and XII most potent inhibitors 1b, 7b, 8b, and 11b showed their
strong antitelomerase properties, which rely on the ability to suppress
processivity of the enzyme rather than the suppression of hTERT expression.High-resolution X-ray crystallography on compounds 1b and 3b in adduct with hCA II as a model study allowed
to properly assess their binding mode. In particular, we (i) highlighted
the crucial role played by a single heteroatom in determining CA isoform
selectivity by means of diverse space orientation of the tail and
(ii) first determined the molecular features of the CAI–TI molecules, which may be useful to address CA selectivity once proper
chemical manipulation is operated.Overall, the preliminary
results obtained in this study fully sustained
our strategy and gave us a strong background to further proceed in
developing ad hoc designed CAI–TI molecules, which
will be considered in appropriate tumor celllines.
Experimental Protocols
Chemistry
Anhydrous solvents and
all reagents were
purchased from Sigma-Aldrich (Milan, Italy), Alfa Aesar (Milan, Italy),
and TCI (Milan, Italy). All reactions involving air- or moisture-sensitive
compounds were used under a nitrogen atmosphere using dried glassware
and syringes to transfer solutions. Nuclear magnetic resonance spectra
(1HNMR: 400 MHz; 13CNMR: 100 MHz) were recorded
in DMSO-d6 using an Avance III 400 MHz
spectrometer (Bruker, Milan, Italy). Chemical shifts are reported
in parts per million (ppm) and the coupling constants (J) are expressed in hertz (Hz). Splitting patterns are designated
as follows: s, singlet; d, doublet; t, triplet; q, quadruplet; m,
multiplet; br s, broad singlet; and dd, double of doublets. The assignment
of exchangeable protons (OH and NH) was confirmed by the addition
of D2O.The purity of the final compounds was determined
in high-purity grade (i.e., ≥95%) by HPLC using an Agilent
1200 liquid chromatography system composed by an autosampler, binary
pumps, a column oven, and a diode-array detector (LC–DAD) operating
in UV range (210–400 nm). The operating conditions were reported
within the Supporting Information file.The solvents used in MS measures were acetone and acetonitrile
(CHROMASOLV grade), purchased from Sigma-Aldrich, and mQ water 18
MΩ cm, obtained from Millipore’s Simplicity system (Milan,
Italy). The HRMS analysis was performed with a Thermo Finnigan LTQ
Orbitrap mass spectrometer equipped with an electrospray ionization
(ESI) source. The accurate mass measure was carried out by introducing,
via a syringe pump at 10 μL min–1, the sample
solution (1.0 μg mL–1 in mQ water/acetonitrile
50:50), and the signal of the positive ions was acquired. The proposed
experimental conditions allowed to monitor the protonated molecules
of studied compounds ([M + H]+ species), such that they
were measured with a proper dwell time to achieve 60,000 units of
resolution at full width at half-maximum.
Synthesis of Final Compounds 1b–3b, 5b–12b, 14b–20b, 4d, and 13e and Their Intermediates
General
Procedure A
Proper alkyl halide (1.2 equiv)
was added to a suspension of either 1, 14, 15, or 17–20 (0.5 g, 1.0 equiv)
and K2CO3 (2.0 equiv) in dry dimethylformamide
(DMF) (4 mL) under a N2 atmosphere. The mixture was stirred
at room temperature (r.t.) or 60 or 100 °C depending on the alkyl
halide until consumption of the starting material [5 h, thin-layer
chromatography (TLC) monitoring]. The reaction mixture was cooled
at r.t. and quenched with slush. The mixture was extracted with EtOAc
(×3), and the combined organic layers were washed with H2O and brine solution, dried over Na2SO4, filtered-off, and then concentrated under vacuum.
General Procedure
B
The proper carbamate derivative 9 or 10 (0.5 g, 1 equiv) was dissolved in EtOH,
and propargylamine (1.2 equiv) was added. The reaction was refluxed
for 16 h, then cooled at r.t., and quenched with slush. The mixture
was extracted with EtOAc (×3), dried over Na2SO4, filtered-off, and concentrated under vacuum to afford a
solid that was purified by silica gel column chromatography eluting
with 60% EtOAc/Hx.
General Procedure C
To a suspension
of azidonucleosideAZT (1.1 equiv or 2.2 equiv) in H2O/t-BuOH 1:1 (4 mL), the appropriate alkyne
(0.12 g, 1.0 equiv) was
added at r.t., followed by copper (0) nanosized (0.1 equiv) and TMACl
(1.0 equiv). The suspension was stirred at 40 °C until starting
materials were consumed (TLC monitoring), then diluted with MeOH (20
mL), and filtered through Celite 521. The solvent was evaporated,
affording to a residue that was triturated from EtOAc, to give a white
powder.
4-(Prop-2-ynyloxy)benzenesulfonamide (1a)
Compound 1a was synthetized according to the general
procedure A using 4-hydroxybenzenesulfonamide 1 and propargyl
bromide 80% in toluene at 60 °C. It was purified by silica gel
column chromatography eluting with 50% ethyl acetate in n-hexane to afford the titled compound 1a as a white
powder. 47% yield; δH (400 MHz, DMSO-d6): 3.67 (1H, br s, CH), 4.94 (2H, br
s, CH2), 7.17 (2H, d, J = 7.2, Ar-H), 7.28 (2H, s, exchange with D2O, SO2NH2), 8.01 (2H,
d, J = 7.2, Ar-H). Experimental
data in agreement with reported data.[62]
Compound 1b was obtained according
to the general procedure A using 1a as the starting material
to afford the title compound 1b as a light yellow solid: 84% yield;
δH (400 MHz, DMSO-d6):
1.85 (3H, s, CH3), 2.73 (2H, m, CH2), 3.70 (2H, m, CH2), 4.27 (1H, q, J = 3.5, CH), 5.29
(2H, s, CH2), 5.34 (1H, br t, exchange
with D2O, OH), 5.45 (1H, m, CH), 6.46 (1H, t, J = 6.5, CH), 7.24
(4H, m, overlapped signals, 2× ArH, exchange
with D2O, SO2NH2), 7.80 (2H, d, J = 8.8, ArH),
7.86 (1H, s, CH), 8.50 (1H, s, CH), 11.36 (1H, br s, exchange with D2O, NH); δC (100 MHz, DMSO-d6): 13.1, 38.0, 55.2, 60.3, 62.0, 84.5, 85.4, 110.5, 115.6, 125.4,
128.5, 137.1, 137.4, 143.2, 151.3, 161.2, 164.6; ESI-HRMS (m/z): calcd for [M + H]+ ion
species C19H23N6O7S, 479.1343;
found, 479.1336.
4-(Prop-2-ynylthio)benzenesulfonamide (2a)
NaBH4 (23 mg, 0.60 mmol, 3.0 equiv)
was added portionwise
to a freshly prepared solution of 4,4′-disulfanediyldibenzenesulfonamide 2 (75 mg, 0.20 mmol, 1.0 equiv) in EtOH (2 mL) at r.t. under
a N2 atmosphere. After 2 h, propargyl chloride (0.42 mmol,
2.1 equiv) was slowly added, and the reaction mixture was stirred
at r.t. for 3 h, until complete consumption of the starting material
was observed by TLC. The reaction was quenched by addition of saturated
NH4Cl aqueous solution (2 mL) and diluted with EtOAc (5
mL). The layers were separated, and the aqueous layer was extracted
with EtOAc (2× 5 mL), dried over Na2SO4, filtered, and concentrated under vacuum. The crude material was
purified by silica gel flash chromatography to afford the titled compound 2a as a white solid. 83% yield; δH (400 MHz,
DMSO-d6): 3.22 (1H, t, J = 2.6, CH), 4.02 (2H, d, J = 2.6,
CH2), 7.37 (2H, s, exchange with D2O, SO2NH2), 7.56 (2H,
dd, J = 2.0, 6.7, Ar-H), 7.79 (2H,
dd, J = 2.0, 6.7, Ar-H). Experimental
data in agreement with reported data.[63]
Compound 2b was obtained according
to the general procedure C using 2a as starting material
to afford the title compound 2b as a white solid: 37%
yield; δH (400 MHz, DMSO-d6): 1.84 (3H, s, CH3), 2.69 (2H, m, CH2), 3.64 (2H, m, CH2), 4.19 (1H, q, J = 3.5, CH), 4.45
(2H, s, CH2), 5.38 (2H, m, overlapped
signals, 1× CH, exchange with D2O,
1× OH), 6.43 (1H, t, J = 6.5,
CH), 7.36 (2H, s, exchange with D2O, SO2NH2), 7.57 (2H, d, J = 8.4, ArH), 7.76 (2H, d, J =
8.4, ArH), 7.85 (1H, s, CH), 8.29
(1H, s, CH), 11.35 (1H, br s, exchange with D2O, NH); δC (100 MHz, DMSO-d6): 13.1, 27.0, 37.9, 60.2, 61.6, 84.8, 85.5,
110.5, 124.2, 127.1, 127.7, 137.1, 141.9, 142.1, 144.1, 151.3, 164.6;
ESI-HRMS (m/z): calcd for [M + H]+ ion species C19H23N6O6S2, 495.1115; found, 495.1118.
4-(Prop-2-ynylamino)benzenesulfonamide
(3a)
Propargyl bromide 80% in toluene (1.2 equiv)
was added to a suspension
of sulfanilamide A (0.5 g, 1.0 equiv) and pyridine (1.2
equiv) in dry DMF (2 mL) under N2 atmosphere and the mixture
was stirred at 70 °C (TLC monitoring). The reaction was quenched
with H2O (10 mL) and extracted with EtOAc (3× 15 mL).
The combined organic layers were washed with H2O (3×
15 mL) and brine (3× 15 mL), dried over anhydrous Na2SO4, filtered-off, and concentrated under vacuum to give
a solid that was purified by silica gel column chromatography eluting
with 50% ethyl acetate in n-hexane to afford the
desired product 65 as a yellow solid. 33% yield; δH (400 MHz, DMSO-d6): 3.13 (1H,
t, J = 2.4, CH), 3.97 (2H, dd, J = 2.4, 6.0, CH2), 6.73 (2H,
d, J = 8.8, Ar-H), 6.76 (1H, br
t, exchange with D2O, NH), 6.98 (2H, br
s, exchange with D2O, SO2NH2), 7.59 (2H, d, J = 8.8, Ar-H). Experimental data in agreement with reported data.[64]
Compound 3b was obtained according
to the general procedure C using 3a as the starting material
to afford the title compound 3b as a white solid. 21%
yield; δH (400 MHz, DMSO-d6): 1.84 (3H, s, CH3), 2.69 (2H, m, CH2), 3.68 (2H, m, CH2), 4.23 (1H, q, J = 3.5, CH), 4.40
(2H, d, J = 5.7, CH2),
5.32 (1H, br t, 1H, exchange with D2O, OH), 5.38 (1H, m, CH), 6.45 (1H, t, J = 6.5, CH), 6.74 (2H, d, J = 8.8,
2× Ar-H), 6.92 (1H, t, J =
5.7, exchange with D2O, NH), 6.98 (2H,
s, exchange with D2O, SO2NH2), 7.55 (2H, d, J = 8.8, 2× Ar-H), 7.84 (1H, s, CH), 8.24 (1H, s, CH), 11.4 (1H, br s, exchange with D2O, NH); δC (100 MHz, DMSO-d6):12.2, 36.9, 37.9, 59.1, 60.7, 83.8, 84.5, 110.1, 111.2,
122.6, 127.2, 130.4, 136.3, 145.2, 150.4, 150.9, 163.7; ESI-HRMS (m/z): calcd for [M + H]+ ion
species C19H24N7O6S, 478.1503;
found, 478.1508.
4-(Diprop-2-ynylamino)benzenesulfonamide
(4c)
Sulfanilamide A (0,5 g, 1.0
equiv) was dissolved in
DMF and the solution was cooled to 0 °C. Then, dimethoxy-N,N-dimethylmethanamine (1.2 equiv) was
added. The solution was stirred at r.t. until consumption of the starting
material (2 h). The reaction was quenched with dichloromethane, and
the precipitate formed was filtered-off and dried to afford N′-((4-aminophenyl)sulfonyl)-N,N-dimethylformimidamide 4a, which was used
for the next step without further purification. N′-((4-Aminophenyl)sulfonyl)-N,N-dimethylformimidamide 4a (1.0 equiv) was solubilized
in dry DMF and K2CO3 (3.0 equiv) was added.
Then, propargyl bromide 80% in toluene (4.0 equiv) was added, and
the mixture was stirred at 80 °C until consumption of the starting
material. Then, the reaction was quenched with H2O (20
mL) and extracted with EtOAc (3× 15 mL). The combined organic
layers were washed with H2O (3× 15 mL) and brine(3×
15 mL), dried over Na2SO4, filtered-off, and
concentrated under vacuum to give a residue (4b) that
was suspended in isopropylamine in a sealed tube and stirred at r.t.
The solvent was removed in vacuo, obtaining a residue that was purified
by silica gel column chromatography eluting with 50% ethyl acetate
in n-hexane to afford a sticky residue which was
triturated from Et2O to afford the titled compound 4c as a white powder: 10% yield; δH (400
MHz, DMSO-d6): 3.21 (2H, t, J = 2.4, 2× CH), 4.29 (4H, d, J = 2.4, 2× CH2), 7.03 (2H, d, J = 8.8, Ar-H), 7.08 (2H, s, exchange with
D2O, SO2NH2), 7.70
(2H, d, J = 8.8, Ar-H). Experimental
data in agreement with reported data.[65]
Propargyl bromide (80% in toluene) (2 equiv) and N, N-diisopropylethylamine (1.7 equiv)
were added to a stirred solution of 4-(2-aminoethyl)benzensulfonamide 5 (0.5 g, 1.0 equiv) in CH3CN (8 mL) under a N2 atmosphere. The mixture was stirred at r.t. until consumption
of the starting material (TLC monitoring). The solvent was removed
under reduced pressure and the obtained residue was portioned between
H2O and EtOAc, followed by extraction with EtOAc (3×
15 mL). The combined organic layers were washed with H2O (3× 15 mL) and brine (3× 15 mL), then dried over Na2SO4, filtered-off, and concentrated under vacuum
to afford compound 5a as a dark oil. 70% yield; δH (400 MHz, DMSO-d6): 2.75 (2H,
t, J = 6.8, CH2), 2.84
(2H, t, J = 6.8, CH2),
3.21 (2H, br t, 2× CH), 3.44 (4H, d, J = 2.0, 2× CH2), 7.37
(2H, s, exchange with D2O, SO2NH2), 7.45 (2H, d, J = 8.4, Ar-H), 7.76 (2H, d, J = 8.4, Ar-H); δC (100 MHz, DMSO-d6): 32.6, 41.5, 53.3, 75.8, 79.1, 125.6, 129.1, 141.9, 144.4; ESI-HRMS
(m/z): calcd for [M + H]+ ion species C14H17N2O2S, 277.1005; found, 277.1009. Experimental data in agreement with
reported data.[66]
Compound 5b was obtained according
to the general procedure C using 5a as the starting material
to afford the title compound 5b as a white solid. 82%
yield; δH (400 MHz, DMSO-d6): 1.85 (6H, s, 2× CH3), 2.72 (6H,
m, overlapped signals, 3× CH2), 2.93
(2H, t, J = 7.2, CH2),
3.70 (4H, m, 2× CH2), 3.80 (4H, s,
2× CH2), 4.24 (2H, q, J = 3.5, 2× CH), 5.40 (4H; m, overlapped signals,
2× CH, exchange with D2O, 2×
OH), 6.48 (2H, t, J = 6.4, 2×
CH), 7.32 (2H, br s, exchange with D2O,
SO2NH2), 7.41 (2H, d, J = 8.3, 2× Ar-H), 7.75 (2H, d, J = 8.3, 2× Ar-H), 7.87 (2H, s, 2×
CH), 8.22 (2H, s, 2× CH), 11.40
(2H, br s, exchange with D2O, 2× NH). δC (100 MHz, DMSO-d6): 13.1, 33.4, 37.9, 48.2, 54.7, 60.1, 61.6, 84.8, 85.5, 110.5, 124.5,
126.5, 130.0, 137.2, 142.6, 144.6, 145.7, 151.4, 164.6; ESI-HRMS (m/z): calcd for [M + H]+ ion
species C34H43N12O10S,
811.2940; found, 811.2951.
Prop-2-yn-1-yl 4-Chloro-3-sulfamoylbenzoate
(6a)
To a stirring solution of 4-chloro-3-sulfamoylbenzoic
acid 6 (1 equiv) in dry DMF, 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide
(EDC) HCl (1.2 equiv) was added at 0 °C. After 30 min, propargyl
alcohol (1.2 equiv) and 4-dimethylaminopyridine (1.2 equiv) were added.
The mixture was stirred at r.t. under N2 for an additional
3 h until consumption of the starting material. The reaction was quenched
with slush and extracted with EtOAc (×3). The organic extract
was washed with saturated aqueous NaHCO3, water, and brine;
dried over Na2SO4; filtered-off; and concentrated
under vacuum. The crude was purified by flash silica chromatography
(40% EtOAc/Hx) to afford the title compound 6a as a white
solid. 40% yield; δH (400 MHz, DMSO-d6): 3.68 (1H, t, J = 2.4, CH), 5.05 (2H, d, J = 2.5, CH2), 7.86 (3H, m, 1× Ar-H, 2× SO2NH2), 8.16 (1H, dd, J = 2.2, 8.2, Ar-H), 8.56 (1H, d, J = 2.1, Ar-H); δC (100 MHz, DMSO-d6): 53.6, 79.0, 79.3, 129.0, 130.6, 133.4, 134.5,
136.7, 142.4, 165.5; ESI-HRMS (m/z): calcd for [M + H]+ ion species C15H16N3O2, 270.1237; found, 270.1237.
Compound 6b was obtained according to the general procedure C using 6a as a starting material to afford the title compound 6b as a white solid. 21% yield; δH (400 MHz,
DMSO-d6): 1.83 (3H, s, CH3), 2.69 (2H, m, CH2), 3.67
(2H, m, CH2), 4.22 (1H, q, J = 3.9, CH), 4.76 (2H, s, CH2), 5.29 (1H, br t, 1H, exchange with D2O, OH), 5.38 (1H, dt, J = 8.3, 5.29, CH), 6.43 (1H, t, J = 6.5, CH), 7.47 (2H, s, exchange with D2O, SO2NH2), 7.86 (2H, m, 2× Ar-H), 7.98 (1H, s, CH), 8.10 (1H, s, Ar-H), 8.38 (1H, s, CH), 11.3 (1H, br s, exchange with
D2O, NH). δC (100 MHz,
DMSO-d6):13.1, 27.5, 38.0, 60.4, 61.6,
84.8, 85.3, 110.5, 111.6, 116.9, 123.1, 124.6, 137.1, 142.0, 143.2,
151.3, 153.8, 163.2, 164.6, 167.1; ESI-HRMS (m/z): calcd for [M + H]+ ion species C20H22ClN6O8S, 541.0903; found, 541.0899.
Prop-2-ynyl 4-Sulfamoylbenzoate (7a)
To
a stirring solution of 4-sulfamoylbenzoic acid 7 (2.0
g, 9.9 mmol) in dry DMF (40 mL) were successively added propargyl
alcohol (1.17 mL, 19.8 mmol, 2.0 equiv), Et3N (2.8 mL,
19.9 mmol, 2.0 equiv), and EDC HCl (1.9 g, 9.9 mmol, 1.0 equiv). The
solution was stirred at r.t. under N2 for an additional
4 h. The mixture was then concentrated under reduced pressure and
ethyl acetate (40 mL) was added. The organic extract was washed with
saturated aqueous NaHCO3 (40 mL) and back-extracted with
ethyl acetate (40 mL). The organic layers were combined and washed
with brine (40 mL), dried over Na2SO4, filtered,
and evaporated. The crude oil was purified by flash silica chromatography
(50% EtOAc/Hx) to afford the title compound 7a as a white
crystalline solid. 38% yield; δH (400 MHz, DMSO-d6): 3.63 (1H, t, J = 2.4, CH), 4.97 (2H, d, J = 2.8, CH2), 7.55 (2H, br s, exchange with D2O, SO2NH2), 7.98 (4H, m, 4× ArH); δC (100 MHz, DMSO-d6): 53.0, 78.1, 78.3, 126.2, 130.0, 131.7, 148.3, 164.0.
Experimental data in agreement with reported data.[67]
Compound 7b was obtained according to the general procedure C using 7a as the starting material to afford the title compound 7b as a white solid. 30% yield; δH (400 MHz, DMSO-d6): 1.84 (3H, s, CH3), 2.74 (2H, m, CH2), 3.71 (2H, m, CH2), 4.28 (1H, m, CH), 5.32
(1H, t, J = 5.1, exchange with D2O, OH), 5.42 (1H, m, CH), 5.50 (2H, s, CH2), 6.46 (1H, t, J = 6.6, CH), 7.60 (2H, s, exchange with D2O, SO2NH2), 7.85 (1H, s, CH), 8.00 (2H, d, J = 8.4, 2× Ar-H), 8.18 (2H, d, J = 8.5, 2× Ar-H), 8.49 (1H, s, CH), 11.4 (1H, br s, exchange with
D2O, NH); δC (100 MHz,
DMSO-d6): 13.3, 38.0, 59.3, 60.5, 61.7,
84.8, 85.3, 110.5, 125.7, 127.3, 131.2, 133.0, 137.1, 142.8, 149.1,
151.3, 164.6, 165.4; ESI-HRMS (m/z): calcd for [M + H]+ ion species C20H23N6O8S, 507.1293; found, 507.1294.
N-(Prop-2-ynyl)-4-sulfamoylbenzamide (8a)
To a stirring solution of 4-sulfamoylbenzoic
acid 7 (2.0 g, 9.9 mmol) and propargylamine (0.64 mL,
9.9 mmol, 1.0 equiv) in dry DMF (40 mL) were successively added N-hydroxybenzotriazole monohydrate (0.94 g, 6.6 mmol, 0.6
equiv), diisopropylethylamine (1.7 mL, 9.9 mmol, 1.0 equiv), and HBTU
(3.8 g, 9.9 mmol, 1.0 equiv). The deep yellow solution was stirred
at r.t. under N2 for 1 h when found complete by TLC. The
mixture was concentrated under reduced pressure and ethyl acetate
(40 mL) was added. The organic extract was washed with water (40 mL)
and back-extracted with EtOAc (×3). The organic extracts were
combined and washed with brine (50 mL). The organic layer was dried
over Na2SO4, filtered, and evaporated to a crude
white solid. Recrystallization from hot methanol/water (9:1) afforded
the title compound 8a as a white crystalline solid. 82%
yield; δH (400 MHz, DMSO-d6): 3.12 (1H, t, J = 2.4, CH), 4.05
(2H, d, J = 5.6, 2.8, CH2), 7.45 (2H, br s, exchange with D2O, SO2NH2), 7.92 (4H, m, 4× ArH), 9.09 (1H, t, J = 5.6, exchange with D2O, NH); δC (100 MHz, DMSO-d6): 29.0, 73.8, 81.7, 126.4, 128.6, 137.3, 147.1,
164.6. Experimental data in agreement with reported data.[67]
Compound 10b was obtained
according to the general procedure C using 10a as the
starting material to afford the title compound 10b as
a yellow solid. 47% yield; δH (400 MHz, DMSO-d6): 1.84 (3H, s, CH3), 2.71 (2H, m, CH2), 3.68 (2H, m, CH2), 4.24 (1H, q, J = 3.9, CH), 4.41 (2H, d, J = 5.6, CH2), 5.30 (1H, t, J = 5.2, exchange with
D2O, OH), 5.39 (1H, dt, J = 8.3, 5.4, CH), 6.45 (1H, t, J = 6.6, CH), 6.84 (1H, t, J = 5.7,
exchange with D2O, NH), 7.18 (2H, s, exchange
with D2O, SO2NH2), 7.59 (2H, d, J = 8.9, 2× Ar-H), 7.71 (2H, d, J = 8.8, Ar-H),
7.84 (1H, s, CH), 8.20 (1H, s, CH), 9.04 (1H, br s, exchange with D2O, NH), 11.4 (1H, br s, exchange with D2O, NH); δC (100 MHz, DMSO-d6): 13.1, 35.7, 38.0, 60.0, 61.6, 84.7, 85.3, 110.5, 117.8, 123.2,
127.6, 137.8, 141.5, 144.3, 146.4, 151.3, 155.6, 164.6; ESI-HRMS (m/z): calcd for [M + H]+ ion
species C20H25N8O7S, 521.1561;
found, 521.1554.
4-(Prop-2-yn-1-ylselanyl)aniline (D)
4-Selenocyanatoaniline C (1 equiv) was dissolved
in EtOH, and NaBH4 (4
equiv) was added. The reaction was stirred for 20 min. Then, propargyl
bromide (1.2 equiv) was added, and the reaction was stirred until
consumption of the starting material. The reaction was quenched with
NH4Cl saturated solution, extracted with EtOAc (×3),
dried over Na2SO4, filtered, and concentrated
in reduced pressure to give the desired product D as
a yellow solid. 79% yield; δH (400 MHz, DMSO-d6): 2.26 (1H, s, CH), 3.34
(2H, d, J = 2.4, CH2),
3.76 (2H, br s, exchange with D2O, NH2), 6.59 (2H, d, J = 8.3, 2× ArH), 7.44 (2H, d, J = 8.3, 2× ArH); δC (100 MHz, DMSO-d6): 13.7, 71.9, 81.7, 115.8, 116.2, 136.8, 147.2; ESI-HRMS
(m/z): calcd for [M + H]+ ion species C9H10NSe, 211.9973; found, 211.9969.
Compound 11b was obtained
by reacting compound E (1 equiv) dissolved in CH3CN with 3-isothiocyanatobenzenesulfonamide 11a (1.1 equiv). The reaction was stirred and then quenched with H2O, assisting in the formation of a yellow precipitate that
was filtered to afford the crude product. It was purified by silica
gel column chromatography, eluting with 8% MeOH/DCM, to obtain the
title compound 11b as a white solid. 15% yield; δH (400 MHz, DMSO-d6): 1.84 (3H,
s, CH3), 2.72 (2H, m, CH2), 3.62 (2H, m, CH2), 4.14
(1H, s, CH), 4.23 (2H, s, CH2), 5.31 (1H, m, exchange with D2O, OH), 5.38 (1H, m, CH), 6.38 (1H, t, J = 6.3, CH), 7.49 (8H, m, exchange with D2O, 2× SO2NH2, 4×
Ar-H, 2× Ar-H), 7.75 (1H, d, J = 7.9, Ar-H), 7.84 (1H, s, CH), 8.00 (1H, s, Ar-H), 8.11 (1H, s, CH), 10.16 (2H, br s, exchange with D2O, 2× NH), 11.37 (1H, br s, exchange with D2O, NH); δC (100 MHz, DMSO-d6): 13.1, 20.9, 37.9, 60.0, 61.6, 84.7, 85.3, 110.5, 121.4,
122.3, 123.6, 125.1, 126.2, 127.7, 129.8, 133.4, 137.1, 139.2, 140.9,
145.1, 145.5, 151.3, 164.6, 180.6; ESI-HRMS (m/z): calcd for [M + H]+ ion species C26H29N8O6S2Se, 693.0812;
found, 693.0822.
A solution of 3-amino-4-hydroxybenzenesulfonamide 13 (2.76 g, 1.0 equiv) in dry tetrahydrofuran (90 mL) was
treated with dropwise phosgene solution (∼20% in toluene, 1.2
equiv) at 0 °C, and then, the reaction was warmed to r.t. and
stirred overnight. After the consumption of the starting material
(TLC monitoring), the reaction was quenched with slush and acidified
with 1 M aqueous solution of HCl, extracted with EtOAc (3× 20
mL), and the combined organic layers were washed with H2O (3× 20 mL), dried over Na2SO4, filtered,
and concentrated in reduced pressure to give the desired product as
a brown solid. 83% yield; δH (400 MHz, DMSO-d6): 7.41 (2H, s, exchange with D2O, SO2NH2), 7.49 (1H, d, J = 8.4, Ar-H), 7.52 (1H, d, J = 1.9, Ar-H), 7.60 (1H, dd, J =
1.9, 8.4, Ar-H), 12.03 (1H, s, exchange with D2O, NH); δC (100 MHz, DMSO-d6): 108.2, 110.5, 121.0, 131.6, 140.8, 146.3,
155.1; ESI-HRMS (m/z): calcd for
[M + H]+ ion species C7H7N2O4S, 215.0121; found, 215.0122.
A solution of 13a (6.27 g,
1.0 equiv) in DMF (5 mL) was cooled to 0 °C and then treated
with N,N-dimethylformamide dimethyl
acetal (1.2 equiv). The reaction continued until the consumption of
the starting material (TLC monitoring). The reaction was quenched
with slush to obtain a precipitate that was filtered and washed with
water (3× 5 mL) and dried under vacuum to afford 13b as a white solid. 41% yield; δH (400 MHz, DMSO-d6): 2.93 (3H, t, J = 0.6, CH3), 3.17 (3H, t, J = 0.6, CH3), 7.43 (2H, m, 2× Ar-H), 7.55 (1H, dd, J = 1.8, 8.4, Ar-H), 8.25 (1H, s, CH), 12.01 (1H, s, exchange with
D2O, NH); δC (100 MHz,
DMSO-d6): 35.9, 41.8, 108.3, 110.5, 121.3,
131.6, 139.6, 146.3, 155.1, 160.7; ESI-HRMS (m/z): calcd for [M + H]+ ion species C10H12N3O4S, 270.0543; found, 270.0538.
Compound 13b (2.0 g, 1.0 equiv) was treated with potassium carbonate
(1.0 equiv) in dry DMF (5 mL) and the suspension was stirred at r.t.
for 20 min. Then, propargyl bromide (1.2 equiv) was added and the
reaction was stirred at r.t. until the starting material was consumed
(TLC monitoring). The reaction was quenched with slush, and the precipitate
formed was collected by filtration, washed with Et2O (3×
5 mL), and dried under vacuum to obtain the desired compound as a
brown solid. 90% yield; δH (400 MHz, DMSO-d6): 2.94 (3H, t, J = 0.7, CH3), 3.19 (3H, t, J = 0.6, CH3), 3.53 (1H, t, J = 2.5, CH), 4.84 (2H, d, J = 2.5, CH2), 7.54 (1H, d, J = 8.4, Ar-H), 7.65 (1H, dd, J = 1.8, 8.4, Ar-H), 7.80 (1H, d, J = 1.8, Ar-H), 8.27 (1H, s, CH); δC (100 MHz,
DMSO-d6): 32.6, 36.0, 41.8, 77.0, 77.7,
108.5, 111.0, 122.1, 131.3, 140.1, 144.8, 153.8, 160.7; ESI-HRMS (m/z): calcd for [M + H]+ ion
species C13H14N3O4S, 308.0700;
found, 308.0698.
Compound 13c (3.4 g, 1.0 equiv) was dissolved in a 1.5 M HCl in MeOH
solution (30 mL), and the reaction was stirred at 60 °C in a
sealed tube for 4 h, concentrated under vacuum to give a precipitate
that was washed water (3× 5 mL) and then with Et2O
(3× 5 mL), and dried under vacuum to afford the desired product
as a brown solid. 55% yield; δH (400 MHz, DMSO-d6): 3.53 (1H, t, J = 2.5, CH), 4.81 (2H, d, J = 2.5, CH2), 7.49 (2H, s, exchange with D2O, SO2NH2), 7.61 (1H, d, J = 8.4, Ar-H), 7.72 (1H, dd, J = 1.9, 8.4, Ar-H), 7.83 (1H, d, J = 1.9, Ar-H); δC (100 MHz, DMSO-d6): 32.7, 35.0, 77.3, 108.2, 111.1, 122.0, 131.1, 141.3, 144.8, 153.9;
ESI-HRMS (m/z): calcd for [M + H]+ ion species C10H9N2O4S, 253.0278; found, 253.0280.
Compound 14b was obtained according to the general procedure
C using 14a as the starting material to afford the title
compound 14b as a white solid. 45% yield; δH (400 MHz, DMSO-d6): 1.84 (3H,
s, CH3), 1.89 (2H, m, 2× CH2), 2.70 (2H, m, CH2), 2.78 (2H, m, CH2), 3.68 (2H, m, CH2), 4.22 (1H, m, CH), 4.29
(2H, m, CH2), 5.34 (2H, m, 1× CH, exchange with D2O, 1× OH), 5.93 (1H, br s, Ar-H), 6.45 (1H, br t, CH), 7.41 (2H, m, 1× Ar-H, 1×
CH), 7.70 (1H, t, J = 7.9, Ar-H), 7.86 (2H, m, 1× Ar-H, 1×
CH), 8.13 (1H, s, Ar-H), 11.4 (1H,
br s, exchange with D2O, NH); δC (100 MHz, DMSO-d6):13.2, 25.5,
26.2, 28.4, 38.0, 59.9, 61.7, 70.1, 84.8, 85.4, 91.4, 110.5, 116.2,
117.4, 122.5, 123.7, 125.1, 133.6, 137.1, 147.8, 151.3, 153.7, 162.6,
164.6, 165.9; ESI-HRMS (m/z): calcd
for [M + H]+ ion species C25H28N5O7, 510.1983; found, 510.1989.
6-(Prop-2-ynyloxy)-2H-chromen-2-one (15a)
Compound 15a was synthetized according
to the general procedure A using 6-hydroxy-2H-chromen-2-one 15 as the starting material and propargyl bromide 80% in toluene
as the alkyl halide. The reaction was performed at r.t. Compound 15a was obtained as a white powder: 65% yield; δH (400 MHz, DMSO-d6): 3.64 (1H,
br t, CH), 4.90 (2H, d, J = 2.1,
CH2), 6.54 (1H, d, J =
9.6, Ar-H), 7.30 (1H, dd, J = 2.9,
9.0, Ar-H), 7.38 (1H, d, J = 2.9,
Ar-H), 7.41 (1H, d, J = 9.0, Ar-H), 8.06 (1H, d, J = 9.6, Ar-H); δC (100 MHz, DMSO-d6): 56.0, 78.6, 78.9, 112.3, 116.8, 117.4, 119.2, 120.0, 144.0, 148.3,
153.4, 160.1; ESI-HRMS (m/z): calcd
for [M + H]+ ion species C12H9O3, 201.0546; found, 201.0543. Experimental data in agreement
with reported data.[68]
Compound 16b was obtained according to the general procedure
C using 16a as the starting material to afford the title
compound 16b as a white solid. 27% yield; δH (400 MHz, DMSO-d6): 1.84 (3H,
s, CH3), 2.14 (2H, q, J = 6.8, CH2), 2.71 (2H, m, CH2), 2.85 (2H, t, J = 7.5, CH2), 3.69 (2H, m, CH2), 4.12
(2H, t, J = 6.3, CH2),
4.23 (1H, q, J = 4.1, CH), 5.34
(2H, m, 1× CH, exchange with D2O,
1× OH), 6.45 (1H, t, J = 6.6,
CH), 6.52 (1H, d, J = 9.5, 1×
Ar-H), 7.25 (1H, dd, J = 2.9, 9.0,
1× Ar-H), 7.32 (1H, d, J =
2.9, 1× Ar-H), 7.38 (1H, d, J = 8.9, 1× Ar-H), 7.85 (1H, s, CH), 8.04 (1H, d, J = 9.5, 1× Ar-H), 8.15 (1H, s, CH), 11.4 (1H, br s, exchange with
D2O, NH); δC (100 MHz,
DMSO-d6):13.1, 22.5, 29.2, 38.0, 59.9,
61.6, 68.3, 84.8, 85.4, 110.5, 112.3, 117.4, 118.2, 120.1, 120.8,
122.5, 137.1, 144.9, 147.3, 148.7, 151.3, 155.8, 161.0, 164.1; ESI-HRMS
(m/z): calcd for [M + H]+ ion species C24H26N5O7, 496.1827; found, 496.1830.
7-(Prop-2-ynyloxy)-2H-chromen-2-one (17a)
Compound 17a was synthetized according
to the general procedure A using 7-hydroxy-2H-chromen-2-one 17 as the starting material and propargyl bromide 80% in toluene
as the alkyl halide. The reaction was performed at r.t. Compound 17a was obtained as a white powder. 73% yield; δH (400 MHz, DMSO-d6): 3.69 (1H,
t, J = 2.4, CH), 4.97 (2H, d, J = 2.4, CH2), 6.36 (1H, d, J = 9.6, Ar-H), 7.03 (1H, dd, J = 2.4, 8.6, Ar-H), 7.09 (1H, d, J = 2.4, Ar-H), 7.70 (1H, d, J =
8.6, Ar-H), 8.04 (1H, d, J = 9.6,
Ar-H). Experimental data in agreement with reported
data.[70]
Compound 18b was obtained according to the general procedure
C using 18a as the starting material to afford the title
compound 18b as a white solid. 21% yield; δH (400 MHz, DMSO-d6): 1.84 (3H,
s, CH3), 2.13 (2H, m, CH2), 2.70 (2H, m, CH2), 2.86
(2H, m, CH2), 3.69 (2H, m, CH2), 4.21 (3H, m, 1× CH2, 1× CH), 5.34 (2H, m, 1× CH, exchange with D2O, 1× OH), 6.32
(1H, d, J = 9.47, 1× Ar-H),
6.45 (1H, m, CH), 7.01 (2H, m, 1× CH, 1× Ar-H), 7.66 (1H, m, Ar-H), 7.85 (1H, s, CH), 8.03 (1H, m, Ar-H), 8.15 (1H, s, CH), 11.4 (1H, br s, exchange with
D2O, NH); δC (100 MHz,
DMSO-d6):13.2, 22.4, 29.1, 38.0, 59.9,
61.6, 68.4, 84.8, 85.4, 102.1, 110.5, 113.2, 113.3, 113.6, 122.6,
130.4, 137.1, 145.2, 147.3, 151.3, 156.3, 161.2, 162.7, 164.1; ESI-HRMS
(m/z): calcd for [M + H]+ ion species C24H26N5O7, 496.1827; found, 496.2000.
7-(Hex-5-yn-1-yloxy)-2H-chromen-2-one (19a)
Compound 19a was synthetized according
to the general procedure A using 7-hydroxy-2H-chromen-2-one 17 as the starting material and 6-chlorohex-1-yne as the alkyl
halide at 100 °C. Compound 19a was obtained as a
white powder. 80% yield; δH (400 MHz, DMSO-d6): 1.64 (2H, m, CH2), 1.86 (2H, m, CH2), 2.28 (2H, m, CH2), 2.82 (1H, t, J = 2.5, CH), 4.13 (2H, t, J = 6.4, CH2), 6.31 (1H, d, J = 9.5, Ar-H), 6.97 (1H, dd, J = 2.1, 8.6, Ar-H), 7.01 (1H, d, J = 2.1, Ar-H), 7.65 (1H, d, J = 8.6, Ar-H),
8.02 (1H, d, J = 9.5, Ar-H); δC (100 MHz, DMSO-d6):18.7, 25.9,
28.8, 68.8, 72.4, 85.3, 102.3, 113.3, 113.4, 113.7, 130.5, 145.3,
156.5, 161.3, 162.9; ESI-HRMS (m/z): calcd for [M + H]+ ion species C15H15O3, 243.1016; found, 243.1012.
Compound 20b was obtained according to the general procedure
C using 20a as the starting material to afford the title
compound 20b as a white solid. 78% yield; δH (400 MHz, DMSO-d6): 1.85 (3H,
s, CH3), 2.74 (2H, m, CH2), 3.70 (2H, m, CH2), 4.26
(1H, q, J = 3.5, CH), 5.26 (2H,
s, CH2), 5.37 (1H, br t, exchange with
D2O, OH), 5.45 (1H, m, CH), 6.47 (1H, t, J = 6.5, CH), 7.29
(1H, dd, J = 3.0, 9.0, ArH), 7.44
(1H, d, J = 9.0, ArH), 7.47 (1H,
d, J = 3.0, ArH), 7.54 (1H, d, J = 10.3, ArH), 7.68 (1H, d, J = 10.3, ArH), 7.87 (1H, s, CH),
8.51 (1H, s, CH), 11.38 (1H, br s, exchange with
D2O, NH). δC (100 MHz,
DMSO-d6):13.1, 38.0, 60.3, 61.6, 62.7,
84.8, 85.4, 110.5, 115.7, 119.9, 120.4, 120.5, 124.0, 125.5, 137.1,
137.3, 143.3, 145.6, 151.4, 156.4, 164.9; ESI-HRMS (m/z): calcd for [M + H]+ ion species C21H22N5O8S, 504.1184; found,
504.1183.
CA Inhibition
An Applied Photophysics
stopped-flow
instrument has been used for assaying the CA-catalyzed CO2 hydration activity.[53] Phenol red (at
a concentration of 0.2 mM) has been used as an indicator, working
at the absorbance maximum of 557 nm, with 20 mM Hepes (pH 7.5) as
a buffer, and 20 mM Na2SO4 (for maintaining
the ionic strength constant), following the initial rates of the CA-catalyzed
CO2 hydration reaction for a period of 10–100 s.
The CO2 concentrations ranged from 1.7 to 17 mM for the
determination of the kinetic parameters and inhibition constants.
For each inhibitor, at least six traces of the initial 5–10%
of the reaction have been used for determining the initial velocity.
The uncatalyzed rates were determined in the same manner and subtracted
from the total observed rates. Stock solutions of the inhibitor (0.1
mM) were prepared in distilled deionized water, and dilutions up to
0.01 nM were done thereafter with the assay buffer. The inhibitor
and enzyme solutions were preincubated together for 15 min for sulfonamide
derivatives and 6 h for coumarin and sulfocoumarin derivatives at
r.t. prior to the assay, in order to allow for the formation of the E–I complex. The inhibition constants
were obtained by nonlinear least-squares methods using PRISM 3 and
the Cheng–Prusoff equation, as reported earlier, and represent
the mean from at least three different determinations. AllCA isoforms
were recombinant ones obtained in-house as reported earlier.[53]
Cocrystallization and X-ray Data Collection
The crystals
of hCA II were obtained using the hanging drop vapor diffusion method
using a 24-wellLinbro plate. Two microliters of 10 mg/mL solution
of hCA II in Tris-HCl 20 mM pH 8.0 was mixed with 2 μL of a
solution of 1.5 M sodium citrate and 0.1 M TrispH 8.0 and was equilibrated
against the same solution at 296 K. The crystals of the protein grew
in 1 week. Afterward, hCA II crystals were soaked in 5 mM inhibitor
solution for 3 days. The crystals were flash-frozen at 100 K using
a solution obtained by adding 15% (v/v) glycerol to the mother liquor
solution as a cryoprotectant. Data on the crystal of the complex with 1b was collected using synchrotron radiation at the ID-11.2C
beamline at Elettra (Trieste, Italy) with a wavelength of 1.000 Å
and a Pilatus3_6M Dectris CCD detector. Data on the crystal of the
complex with 3b was collected using synchrotron radiation
at the MX1 beamline of the Australian Synchrotron. Data were integrated
and scaled using the program XDS.[71]
Structure
Determination
The crystal structure of hCA
II (PDB accession code: 3P58) without solvent molecules and other heteroatoms was
used to obtain the initialphases of the structures using Refmac5.[72] Unique reflections (5%) were selected randomly
and excluded from the refinement data set for the purpose of Rfree calculations. The initial |Fo – Fc| difference
electron density maps unambiguously showed the inhibitor molecules.
Atomic models for inhibitors were calculated and energy-minimized
using the program JLigand 1.0.40.[73] Refinements
were proceeded using normal protocols of positional, isotropic atomic
displacement parameters alternating with manual building of the models
using COOT.[74] Solvent molecules were introduced
automatically using the program ARP.[75] The
quality of the final models was assessed with COOT and RAMPAGE.[76] Atomic coordinates were deposited in the Protein
Data Bank (PDB accession code: 6YPW, 6WKA). Graphical representations were generated
with Chimera.[77]
In Vitro Telomerase Activity
Assay
Humanprostate cancerPC3 and human colorectal adenocarcinoma HT-29 celllines (both from
ATCC, Manassas, VA) were cultivated in RPMI-1640 cell media supplemented
with 10% fetal bovine serum (Hyclone Laboratories, Logan, UK) at 37
°C in the presence of 5% CO2 and 95% humidity. Celllines have been tested for mycoplasma contamination before the experiment
using the Mycoplasma Detection Kit PlasmoTest (InvivoGen, San Diego,
CA). The most potent CA IX and XII inhibitors 1b, 7b, 8b, or 11b were diluted to a
final concentration of 20 μM and incubated with cells for 48
h. Telomerase activity was determined using the TRAP assay[15] with modifications previously described by us.[78,79] Briefly, cells were lysed in 10 mM Tris-HCl, pH 7.5, 1 mM MgCl2, 1 mM ethylene glycol-bis(2-aminoethylether)-N,N,N′,N′-tetracetic acid (EGTA), 0.1 mM phenylmethylsulfonylfluoride,
5 mM 2-mercaptoethanol, 0.5% 3-[(3-cholamidopropyl)dimethylammonium]-1-propanesulfonate
hydrate, and 10% glycerol (all from Sigma-Aldrich, St. Louis, MO)
and centrifuged for 30 min at 12,000g. Supernatants
were stored at −80 °C. The protein concentration of cell
extracts was determined using the BCA-1 protein assay kit (Sigma-Aldrich,
St. Louis, MO). For elongation reaction, 5 μg of total protein
and CAI–TI within the range of concentrations
0–100 μM were added to 30 μL of the reaction mixture
containing 67 mM Tris-HCl, pH 8.8, 16.6 mM (NH4)2SO4, 0.01% Tween-20, 1.5 mM MgCl2, 1 mM EGTA
(all from Sigma-Aldrich, St. Louis, MO), 0.25 mM each dNTPs (Evrogen,
Moscow, Russia), and the telomerase substrate primer (TS-primer—AATCCGTCGAGCAGAGTT).
Elongation was performed for 30 min at 37 °C and 10 min at 96
°C to inactivate the telomerase. Copy-extended primer 0.1 μL
(CX-primer—CCCTTACCCTTACCCTTACCCTAA) and 2.5 units of Taq-polymerase
were added to the elongation mixture, followed by the following PCR
reaction: 94 °C—5 min; 30 cycles of 94 °C—30
s, 50 °C—30 s, and 72 °C—40 s; and 72 °C—5
min. PCR product visualization was performed using 12% nondenaturing
PAAG electrophoresis and TBE buffer. Each sample (10 μL) was
added to each well of the gel comb. Gels were stained with SYBR Green
I (Invitrogen, Grand Island, NY), photographed under UV light in a
ChemiDoc XRS imaging system, and analyzed using a GelAnalyzer 2010a.
Statistical analysis involving the Student’s t-test was implemented with the Statistica 6.0 software (StatSoft,
Tulsa, OK). To determine the IC50 and IC90 values
(inhibitor concentration where the response is reduced by 50 and 90%,
respectively), 1 μL of the reaction mixture was subjected to
the real-time quantitative TRAP assay (RTQ-TRAP) as described by Hou
and co-authors.[80]
RNA Isolation and Real-Time
RT-PCR
A previously described
protocol was followed.[81] Briefly, total
RNA from cells was extracted using a PureLink RNA Mini kit (Life Technologies,
Carlsbad, CA). Five micrograms of total RNA were reverse-transcribed
using the RevertAid RT Kit (Invitrogen, Grand Island, NY) in a 25
μL reaction mixture, followed by real-time RT-PCR using DTprime5
(DNA Technology, Protvino, Russia). The reaction mix was prepared
using Platinum SYBR Green qPCR Supermix-UDG (Invitrogen, Grand Island,
NY) according to the manufacturer’s recommendations using the
following primers (5′–3′). hTERT sense: GTCCGAGGTGTCCCTGAGTA;
hTERT antisense: CAGGGCCTCGTCTTCTACAG; 18S sense: GGATCCATTGGAGGGCAAGT;
18S antisense: ACGAGCTTTTTAACTGCAGCAA (all primers were from Evrogen,
Moscow, Russia). Two temperature cycles for annealing/extension were
used. The fluorescence was measured at the end of each annealing step,
and the melting curve analysis was performed at the end of the reaction
(after the 35th cycle), between 60 and 95 °C, to assess the quality
of the final PCR products. The standard curves indicating reaction
effectiveness were generated using four serial dilutions (1:40, 1:80,
1:160, and 1:320) of total cDNAs. The relative level of hTERT mRNA
was calculated using DTprime5 software. The levels of mRNA were normalized
relative to the expression of the reference gene 18S. The data are
presented as normalized mRNA levels of the studied genes using the
averaged expression values of the reference gene.
Statistical
Analysis
Telomerase activity assay and
measurement of hTERT gene expression were performed in quadruplicate.
Statistical analysis using Student’s t-test
was completed using Statistica 9.0 software (StatSoft, Tulsa, OK).
Differences described as p ≤ 0.05 were considered
significant. The values of IC50 and IC90 were
calculated using Prism 6 software (GraphPad, San Diego, CA) according
to the recommendations by Sebaugh.[82]
Authors: Kenkichi Masutomi; Evan Y Yu; Shilagardy Khurts; Ittai Ben-Porath; Jennifer L Currier; Geoffrey B Metz; Mary W Brooks; Shuichi Kaneko; Seishi Murakami; James A DeCaprio; Robert A Weinberg; Sheila A Stewart; William C Hahn Journal: Cell Date: 2003-07-25 Impact factor: 41.582
Authors: Fabrizio Carta; Lorenzo Di Cesare Mannelli; Melissa Pinard; Carla Ghelardini; Andrea Scozzafava; Robert McKenna; Claudiu T Supuran Journal: Bioorg Med Chem Date: 2015-02-21 Impact factor: 3.641
Authors: Tuyet Anh Dang Thi; Nguyen Thi Kim Tuyet; Chinh Pham The; Ha Thanh Nguyen; Cham Ba Thi; Tien Doan Duy; Matthias D'hooghe; Tuyen Van Nguyen Journal: Bioorg Med Chem Lett Date: 2014-10-05 Impact factor: 2.823
Authors: Andrey A Lebedev; Paul Young; Michail N Isupov; Olga V Moroz; Alexey A Vagin; Garib N Murshudov Journal: Acta Crystallogr D Biol Crystallogr Date: 2012-03-17
Authors: M Swayampakula; P C McDonald; M Vallejo; E Coyaud; S C Chafe; A Westerback; G Venkateswaran; J Shankar; G Gao; E M N Laurent; Y Lou; K L Bennewith; C T Supuran; I R Nabi; B Raught; S Dedhar Journal: Oncogene Date: 2017-07-10 Impact factor: 9.867
Authors: Haytham O Tawfik; Anwar A El-Hamaky; Eman A El-Bastawissy; Kirill A Shcherbakov; Alexander V Veselovsky; Yulia A Gladilina; Dmitry D Zhdanov; Mervat H El-Hamamsy Journal: Pharmaceuticals (Basel) Date: 2022-04-14
Figure 1
Figure 2
Scheme 1
Figure 3
Scheme 2
Scheme 3
Figure 4
Figure 5
Figure 6
Figure 7