Literature DB >> 32142522

Characterization of the complete mitochondrial genome of Orthaga olivacea Warre (Lepidoptera Pyralidae) and comparison with other Lepidopteran insects.

Liangli Yang1, Junjun Dai2, Qiuping Gao1, Guozhen Yuan1, Jiang Liu1, Yu Sun1, Yuxuan Sun1, Lei Wang1, Cen Qian1, Baojian Zhu1, Chaoliang Liu1, Guoqing Wei1.   

Abstract

Orthaga olivacea Warre (Lepidoptera: Pyralidae) is an important agricultural pest of camphor trees (Cinnamomum camphora). To further supplement the known genome-level features of related species, the complete mitochondrial genome of Orthaga olivacea is amplified, sequenced, annotated, analyzed, and compared with 58 other species of Lepidopteran. The complete sequence is 15,174 bp, containing 13 protein-coding genes (PCGs), 22 transfer RNA (tRNA) genes, 2 ribosomal RNA (rRNA) genes, and a putative control region. Base composition is biased toward adenine and thymine (79.02% A+T) and A+T skew are slightly negative. Twelve of the 13 PCGs use typical ATN start codons. The exception is cytochrome oxidase 1 (cox1) that utilizes a CGA initiation codon. Nine PCGs have standard termination codon (TAA); others have incomplete stop codons, a single T or TA nucleotide. All the tRNA genes have the typical clover-leaf secondary structure, except for trnS(AGN), in which dihydrouridine (DHU) arm fails to form a stable stem-loop structure. The A+T-rich region (293 bp) contains a typical Lepidopter motifs 'ATAGA' followed by a 17 bp poly-T stretch, and a microsatellite-like (AT)13 repeat. Codon usage analysis revealed that Asn, Ile, Leu2, Lys, Tyr and Phe were the most frequently used amino acids, while Cys was the least utilized. Phylogenetic analysis suggested that among sequenced lepidopteran mitochondrial genomes, Orthaga olivacea Warre was most closely related to Hypsopygia regina, and confirmed that Orthaga olivacea Warre belongs to the Pyralidae family.

Entities:  

Mesh:

Substances:

Year:  2020        PMID: 32142522      PMCID: PMC7059908          DOI: 10.1371/journal.pone.0227831

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

The insect mitochondrial DNA (mtDNA) is a closed-circular molecule ranging in size from 14,000 to 19,000 bp [1]. It generally contains 37 genes, of which seven are NADH dehydrogenase subunits (nad1-nad6 and nad4L), three cytochrome C oxidase subunits (cox1-cox3), two ATPase subunits (atp6 and atp8), one cytochrome b (cytb) subunit, two ribosomal RNAs (rrnL and rrnS), and 22 transfer RNAs (tRNA) [2, 3], and a variable length A+T-rich region, the largest noncoding sequence that modulates transcription and replication [4, 5, 6]. Whole mitochondrial genomes are a useful data source for several research areas [7, 8], such as evolutionary genomics [9, 10] and comparative molecular evolution [11, 12], phylogeography [13], and population genetics [14]. The Lepidoptera (butterflies and moths) comprises over 160,000 described species, classified into 45–48 superfamilies and is cosmopolitan in distribution [15]. Pyralidae is one of the largest families in Lepidoptera, including over 25,000 species and some of pyralids are important agricultural pests, such as Ostrinia nubilalis and Cnaphalocrocis medinalis, whose complete mitogenomes had been sequenced [16-18]. Despite their diversity and great importance as pests of agricultural and forestry plants, they are also valuable for pollinating plants of economic importance. Most species in the family Pyralidae do not yet have sequenced mitogenomes. Orthaga olivacea Warre (Lepidoptera: Pyralidae) is a notorious pest, widely distributed in East China. The larvae feed on Cinnamomum camphora leaves and cause considerable economic losses. Farmers apply chemical prevention and removal strategies to combat this pest species particularly during larval and pupa life stages [19]. However, overlapping generations and irregularity of abundance in the field from May to October make it very difficult to control [19]. Previous studies have investigated the host preference, distribution and morphological characteristics of Orthaga olivacea Warre, and the control of it by bio-pesticide has been investigated [20, 21]. However, the use of pesticides is harmful to the environment. Therefore, it is necessary to find new strategies to prevent this pest. In this study we sequenced the complete mitogenome of Orthaga olivacea Warre, and compared it with other insect species, especially with the members of Pyralidae species. Phylogenetic relationships among lepidopteran superfamilies were reconstructed using the nucleotide sequences from the 13 PCGs to test the position of Orthaga olivacea within Pyralidae. The study of mitogenomes of Orthaga olivacea can provide fundamental information for mitogenome architecture, phylogeography, future phylogenetic analyses of Pyralidae, and biological control of pests.

Materials and methods

Sample collection and DNA isolation

Orthaga olivacea Warre, larvae (the larvae are about 22–30 mm long, brown, reddish-brown on the head and anterior thoracic plate, and have a brown wide band on the back of the body, with two yellow-brown lines on each side.) were collected from the camphor trees on the campus of Anhui Agricultural University (Hefei, China). Specimens were preserved with 100% ethanol and stored at -80°C. This insect is not an endangered or protected species. Total genomic DNA was extracted from the larvae using the Aidlab Genomic DNA Extraction Kit (Aidlab Co., Beijing, China) according to the manufacturer’s instructions. Extracted DNA quality was assessed by 1% agarose (w/v) gel electrophoresis.

Amplification and sequencing

Thirteen pairs of conserved primers were designed from the mitogenomes of previously sequenced Pyralidae species (synthesized by BGI Tech Co., Shenzhen, China) (Table 1). All PCRs were performed in 50 μL reaction volumes; 34.75 μL sterilized distilled water, 5 μL 5 × Taq buffer (Mg2+ plus), 4 μL dNTPs (2.5 mM), 2 μL genomic DNA, 2 μL of each primer (10 μM) and 0.25 μL (1.25 unit) Taq polymerase (TaKaRa Co., Dalian, China). A two-step PCR was performed under the following conditions: initial denaturation at 94°C for 5 min followed by 35 cycles of 30s at 94°C, annealing 2–3 min (depending on putative length of the fragments) at 51–58°C (depending on primer combination) and a final extension step of 72°C for 10 min.
Table 1

Details of the primers used to amplify the mitogenome of O. olivacea Warre.

Primer pairPrimer sequence (5’ -3’)
F1TAAAAATAAGCTAAATTTAAGCTT
R1TATTAAAATTGCAAATTTTAAGGA
F2AAACTAATAATCTTCAAAATTAT
R2AAAATAATTTGTTCTATTAAAG
F3ATTCTATATTTCTTGAAATATTAT
R3CATAAATTATAAATCTTAATCATA
F4TGAAAATGATAAGTAATTTATTT
R4AATATTAATGGAATTTAACCACTA
F5TAAGCTGCTAACTTAATTTTTAGT
R5CCTGTTTCAGCTTTAGTTCATTC
F6CCTAATTGTCTTAAAGTAGATAA
R6TGCTTATTCTTCTGTAGCTCATAT
F7TAATGTATAATCTTCGTCTATGTAA
R7ATCAATAATCTCCAAAATTATTAT
F8ACTTTAAAAACTTCAAAGAAAAA
R8TCATAATAAATTCCTCGTCCAATAT
F9GTAAATTATGGTTGATTAATTCG
R9TGATCTTCAAATTCTAATTATGC
F10CCGAAACTAACTCTCTCTCACCT
R10CTTACATGATCTGAGTTCAAACCG
F11CGTTCTAATAAAGTTAAATAAGCA
R11AATATGTACATATTGCCCGTCGCT
F12TCTAGAAACACTTTCCAGTACCTC
R12AATTTTAAATTATTAGGTGAAATT
F13TAATAGGGTATCTAATCCTAGTT
R13ACTTAATTTATCCTATCAGAATAA
PCR amplicons were analyzed on 1.0% agarose gel electrophoresis, and purified using a gel extraction kit (CWBIO Co., Beijing, China). Purified fragments were ligated into the T-vector (TaKaRa Co., Dalian, China) and transformed into Escherichia coli DH5α. Positive recombinant colonies with insert DNA were sequenced in both directions and at least three times by Invitrogen Co. Ltd. (Shanghai, China).

Sequence annotation

The complete mtDNA sequence was assembly using the DNAStar package (DNAStar Inc. Madison, USA) and sequence annotation was performed using the blast tools from NCBI (http://blast.ncbi.nlm.nih.gov/Blast). The sequences were submitted to GenBank at NCBI under the accession number MN078362. The tRNA genes were identified using the tRNAscan-Se program software available online at http://lowelab.ucsc.edu/tRNAscan-SE/, and visually identify sequences using the alignment with the appropriate anticodons capable of folding into the typical clover-leaf structure [22]. PCGs were initially identified by sequence identity with Pyralidae species and aligned with the other lepidopteran using ClustalX version 2.0 [23]. Nucleotide sequences of the PCGs were translated into their putative amino acids based on the invertebrate mtDNA genetic code. Composition skew was performed according to the formulas AT skew = [A−T]/[A+T], GC skew = [G−C]/[G+C]) [24]. Relative Synonymous Codon Usage (RSCU) values were calculated in MEGA 6.0 [25]. Tandem repeats in the A+T-rich region were predicted using the Tandem Repeats Finder program (http://tandem.bu.edu/trf/trf.html) [26].

Phylogenetic analysis

To reconstruct the phylogenetic relationships of Lepidoptera, 58 lepidopteran mitogenomes (Table 2) representing seven lepidopteran superfamilies (Bombycoidea, Noctuoidea, Geometroidea, Pyraloidea, Tortricoidea, Papilionoidea and Yponomeutoidea) were used. The mitogenomes of Limnephilus hyalinus (NC_044710.1) [27], Locusta migratoria (NC_001712.1) [28], and Drosophila yakuba (NC_001322) [29] were used as outgroups. The 13 PCGs concatenated nucleotide sequences of these lepidopterans were initially aligned using ClustalX version 2.0. Phylogenetic analysis was performed using Maximum Likelihood (ML) method with the MEGA 6.0 program. This method was used to infer phylogenetic trees with 1000 bootstrap replicates.
Table 2

Details of the lepidopteran mitogenomes used in this study.

SuperfamilyFamilySpeciesSize (bp)GenBank accession no.Reference
BombycoideaBombycidaeBombyx mandarina15,682AY301620[30]
Bombyx mori15,643NC_002355Direct submission
Rondotia menciana15,301KC881286.1[31]
SaturniidaeAntheraea pernyi15,566AY242996[32]
Antheraea yamamai15,338NC_012739[33]
SphingidaeManduca sexta15,516NC_010266[34]
Sphinx morio15299KC470083.1[35]
NoctuoideaLymantriidaeLymantria dispar15,569NC_012893Unpublished
Euproctis pseudoconspersa15461KJ716847.1[36]
ErebidaeAmata formosae15,463KC513737[37]
NotodontidaeOchrogaster lunifer15,593NC_011128[38]
NoctuidaeCtenoplusia agnata15261KC414791.1[39]
Agrotis ipsilon15,377KF163965[40]
NolidaeGabala argentata15,337KJ410747[41]
GeometroideaGeometridaeApocheima cinerarium15,722KF836545[42]
Biston thibetaria15,484KJ670146.1Unpublished
PyraloideaCrambidaeChilo suppressalis15,395NC_015612[43]
Diatraea saccharalis15,490NC_013274[44]
Ostrinia furnacalis14,536NC_003368[45]
Ostrinia nubilalis14,535NC_003367.1[45]
Cnaphalocrocis medinalis15388NC_015985[43]
Paracymoriza distinctalis15354KF859965.1[46]
Tyspanodes hypsalis15329NC_025569[47]
Paracymoriza prodigalis15,326NC_020094.1[48]
Elophila interruptalis15,351NC_021756.1[49]
Pseudargyria interruptella15.231NC_029751.1Direct submission
Chilo auricilius15,367NC_024644.1[50]
Chilo sacchariphagus15,378NC_029716.1Direct submission
Evergestis junctalis15,438NC_030509.1Direct submission
Nomophila noctuella15,309NC_025764.1[51]
Tyspanodes striata15,255NC_030510.1Direct submission
Glyphodes quadrimaculalis15,255NC_022699.1[52]
Spoladea recurvalis15,273NC_027443.1[53]
Dichocrocis punctiferalis15,355NC_021389.1[54]
Glyphodes pyloalis14,960NC_025933.1Unpublished
Maruca vitrata15,385NC_024099.1Unpublished
Maruca testulalis15,110NC_024283.1[55]
Haritalodes derogat15,253NC_029202.1Unpublished
Pycnarmon lactiferalis15,219NC_033540.1[56]
Loxostege sticticalis15,218NC_027174.1Unpublished
PyralidaeOrthaga olivacea WarreThis study
Lista haraldusalis15213NC_024535[57]
Galleria mellonella15320KT750964Unpublished
Corcyra cephalonica15,273NC_016866.1[58]
Amyelois transitella15,205NC_028443.1[59]
Plodia interpunctella15,264NC_027961.1Unpublished
Ephestia kuehniella15,295NC_022476.1Direct submission
Meroptera pravella15,260NC_035242.1[60]
Hypsopygia regina15,212NC_030508.1Direct submission
Endotricha consocia15,201NC_037501.1[61]
Euzophera pyriella15,184NC_037175.1[62]
TortricoideaTortricidaeGrapholita molesta15,717NC_014806[63]
Spilonota lechriaspis15,368NC_014294[64]
PapilionoideaPapilionidaeLuehdorfia taibai15,553KC952673[65]
Teinopalpus aureus15,242NC_014398Unpublished
Apatura ilia15,242NC_016062[66]
Apatura metis15,236NC_015537[67]
YponomeutoideaPlutellidaePlutella xylostella16,179JF911819[68]
LyonetiidaeLeucoptera malifoliella15,646NC_018547[69]

Results and discussion

Genomic structure, organization and composition

The complete mitogenome of Orthaga olivacea Warre is a circular molecule with 15,174 base pairs (bp) in size (Fig 1). This is comparable to the mitogenome sizes documented for other sequenced lepidopterans which range from 14,535 bp in Ostrinia nubilalis to 16,179 bp in Plutella xylostella, and it is similar to Lista haraldusalis (15213) (Table 2). The Orthaga olivacea Warre mitogenome is identical to that of other lepidopterans in terms of gene organization, including all 13 PCGs (cox1–3, nad1–6, nad4L, cytb, atp6 and atp8), 22 tRNA genes, two ribosomal RNAs (rrnS and rrnL), and the important non-coding region also known as “A+T-rich region” [70, 71] (Fig 1; Table 3). Variety in non-coding regions is the primarily reason for size differences across Lepidoptera mitochondrial genomes. Nucleotide composition revealed that the most common base is T = 6249 (41.18%) and the least common base is G = 1249 (8.23%) and AT skew [72] (As to Ts) is slightly negative (−0.042). This trend has also been reported from Manduca sexta (−0.005) [34], Ctenoplusia agnata (−0.023) [39], Paracymoriza distinctalis (−0.002) [46], and Lista haraldusalis (−0.007) [57]. In addition, the GC skew (Gs to Cs) is also negative (−0.215). Base composition of the Orthaga olivacea Warre mitogenome is A+T rich (79.02% A+T content and 20.98% G+C content). Highly A+T biased mitogenomes have been previously sequenced from lepidopterans (ranging from 77.8% in Rondotia menciana to 81.94% in Cnaphalocrocis medinalis) [17, 31], (Table 4). Nucleotide skew is negative, similar to the mitogenome of other lepidopterans, such as M. sexta (-0.005 and -0.181) [33] and C.medinalis (-0.030 and -0.175) [17] (Table 4).
Fig 1

Map of the mitogenome of O. olivacea Warre.

Labeling tRNA genes according to the IUPAC-IUB single-letter amino acids: cox1, cox2 and cox3 present the three subunits of cytochrome c oxidase; cob present cytochrome b; nad1-nad6 constitutes NADH dehydrogenase; rrnL and rrnS refer to ribosomal RNAs. Genes named above the bar are located on major strand, while the others are located on minor strand. Anti-clockwise rRNA or PCGs genes are located on L strand and others are located on H strand.

Table 3

Summary results for characteristics of the mitogenome of Orthaga olivacea Warre.

GeneLocationDirectionSizeIntergenic NucleotidesStart codonStop codon
tRNA-Met1–67F671
tRNA-Ile69–132F64-3
tRNA-Gln130–198R6952
ND2251–1264F10140ATTTAA
tRNA-Trp1265–1332F68-8
tRNA-Cys1325–1394R704
tRNA-Tyr1399–1464R663
COX11468–2973F15060CGATAA
tRNA-Leu12974–3040F670
COX23041–3712F6720ATTTAA
tRNA-Sup3713–3781F694
tRNA-Asp3786–3853F680
ATP83854–4015F162-7ATCTAA
ATP64009–4689F681-1ATGTAA
COX34689–5478F7902ATGT
tRNA-Gly5481–5548F680
ND35549–5902F35412ATTTAA
tRNA-Ala5915–5980F660
tRNA-Arg5981–6044F642
tRNA-Asn6047–6112F663
tRNA-Ser16116–6168F5319
tRNA-Glu6188–6253F66-2
tRNA-Phe6252–6318R670
ND56319–8052R17340ATTTAA
tRNA-His8053–8118R660
ND48119–9455R13370ATATA
ND4L9456–9746R2912ATGTAA
tRNA-Thr9749–9812F640
tRNA-Pro9813–9877R650
ND69878–10398F5219ATATAA
CYTB10408–11566F1159-2ATGT
tRNA-Ser211565–11631F6720
ND111652–12577R9261ATGTA
tRNA-Leu212579–12648R700
rRNA-16s12649–14032R13840
tRNA-Val14033–14096R640
rRNA-12s14097–14881R7850
A-T-rich region14882–15174F293
Table 4

Composition and skewness in different Lepidopteran mitogenomes.

SpeciesSize (bp)A%G%T%C%A+T %ATskewnessGCskewness
Whole genome
O. olivacea Warre1517437.838.2341.1812.7579.020.0420.215
B. mori1564343.057.3238.2711.3681.320.051−0.216
R. menciana1530141.427.8237.4513.3178.860.050−0.259
M. sexta1551640.677.4641.1110.7681.79−0.005−0.181
E. pseudoconspersa1546140.427.6139.5112.4679.930.011−0.241
C. agnata1526139.587.7141.5211.281.1−0.023−0.184
A. cinerarium1572241.517.8039.3211.3780.830.027−0.186
D. saccharalis1549040.877.4239.1512.5680.020.021−0.258
C. medinalis1538840.367.4541.5810.6181.94−0.030−0.175
1P. distinctalis1535441.047.4941.2210.2482.27−0.002−0.155
L. haraldusalis1521340.477.6641.0410.8381.52−0.007−0.172
G. mellonella1532038.627.4741.8012.1180.42−0.039−0.237
S. lechriaspis1536839.867.6341.3411.1781.19−0.018−0.188
A. ilia15,24239.777.7540.6811.8080.45−0.011−0.207
P. xylostella1617940.667.6840.2210.8280.890.005−0.170
PCG
O. olivacea Warre1114737.129.1140.2413.5377.36−0.040−0.195
B. mori1117742.928.1736.6612.2679.570.079−0.200
R. menciana1122540.978.5836.1214.3377.10.063−0.251
M. sexta1118540.418.2339.8811.4880.300.007-0.165
E. pseudoconspersa1118739698.4338.313.5877.990.017−0.233
C. agnata1123839.128.3740.7911.7279.91−0.020−0.166
A. cinerarium1122740.638.7838.1912.3978.830.031−0.171
D. saccharalis1120640.348.2737.5513.8377.900.036−0.252
C. medinalis1121039.888.1540.6911.2880.56−0.010−0.161
P. distinctalis1118940.548.1240.5310.8181.070−0.142
L. haraldusalis1119339.888.4740.1611.4980.04−0.003−0.151
G. mellonella1119638.038.2040.8412.9278.88−0.036−0.224
S. lechriaspis1125639.308.3540.4111.9379.72−0.014−0.177
A. ilia11,14839.418.4139.4912.6978.89−0.001−0.203
P. xylostella1104940.478.8238.8511.8679.320.020−0.147
tRNA
O. olivacea Warre145239.4618.2640.7011.5780.17−0.015−0.167
B. mori146842.107.9039.3110.6981.400.034−0.150
R. menciana148541.088.0839.9310.9181.010.014−0.149
M. sexta155440.997.9241.0610.0482.05−0.001−0.118
E. pseudoconspersa146641.418.1940.1810.2381.580.015−0.111
C. agnata147741.238.1940.2210.3681.450.012−0.117
A. cinerarium148342.018.0239.4510.5281.460.031−0.135
D. saccharalis147841.817.71340.3210.1582.140.018−0.136
C. medinalis147541.298.0040.819.9082.100.006−0.106
P. distinctalis153642.198.1439.789.981.970.029−0.098
L. haraldusalis145141.087.8641.429.6582.49−0.004−0.102
G. mellonella148940.098.0640.9010.9580.51−0.010−0.152
S. lechriaspis145040.978.0040.9010.1481.860.001−0.118
A. ilia143340.618.3040.9610.1281.58−0.004−0.099
P. xylostella146842.518.1738.8310.4981.340.045−0.124
rRNA
O. olivacea Warre216939.654.8444.3511.1684.00−0.056−0.389
B. mori215843.744.5941.0610.6184.800.032−0.396
R. menciana214743.044.8440.7111.4183.740.028−0.404
M. sexta216841.374.8444.059.7385.42−0.031−0.335
E. pseudoconspersa222542.564.5442.1110.7984.670.005−0.408
C. agnata211240.015.0744.6510.2784.66−0.055−0.339
A.cinerarium217943.974.7741.1710.1085.130.033−0.358
D. saccharalis219341.456.8443.5910.1785.04−0.025−0.360
C. medinalis217041.475.0243.879.6385.35−0.028−0.314
P. distinctalis217441.315.3444.029.3485.33−0.032−0.272
L. haraldusalis212142.204.6743.339.8185.53−0.013−0.355
G. mellonella214340.184.9544.1910.6984.37−0.048−0.367
S. lechriaspis216041.714.9543.849.4985.56−0.025−0.314
A. ilia210940.114.9844.8610.0584.97−0.056−0.337
P. xylostella216241.444.9043.949.7185.38−0.029−0.329
A+T-rich region
O. olivacea Warre29344.032.7349.833.4193.86−0.062−0.111
B. mori44944.691.6050.703.0095.39−0.063−0.304
R. menciana35743.73.3647.345.691.04−0.040−0.250
M. sexta32445.061.5450.313.0995.37−0.005−0.335
E. pseudoconspersa38843.562.3250.263.8793.81−0.071−0.250
C. agnata33446.711.546.715.0993.410.000−0.545
A. cinerarium62547.201.9248.642.2495.84−0.015−0.077
D. saccharalis33543.280.6051.644.4894.93−0.088−0.765
C. medinalis33942.480.8853.393.2495.87−0.114−0.571
P. distinctalis34946.131.15493.7295.13−0.030−0.528
L. haraldusalis31045.810.9750.322.9096.13−0.047−0.499
G. mellonella35044.290.2952.862.5797.14−0.088−0.8
S. lechriaspis44140.362.4952.384.7692.74−0.130−0.313
A. ilia40342.933.2349.634.2292.56−0.072−0.133
P. xylostella108137.742.5045.425.0983.16−0.092−0.341

Map of the mitogenome of O. olivacea Warre.

Labeling tRNA genes according to the IUPAC-IUB single-letter amino acids: cox1, cox2 and cox3 present the three subunits of cytochrome c oxidase; cob present cytochrome b; nad1-nad6 constitutes NADH dehydrogenase; rrnL and rrnS refer to ribosomal RNAs. Genes named above the bar are located on major strand, while the others are located on minor strand. Anti-clockwise rRNA or PCGs genes are located on L strand and others are located on H strand.

Protein-coding genes

The concatenated protein-coding genes are 11,147 bp in length, accounting for approximately 73.46% of the mitogenome. All PCGs are initiated by typical ATN start codons, except cox1, which is initiated by CGA (Table 3). The use of a non-canonical start codon for this gene is common across lepidopterans [17, 37, 73, 74], and cox1 transcripts do not overlap with the upstream tRNA, as has been proposed for several insect species [75]. Annotation of cox1 start codon can be justifiably conducted on the basis of comparative amino acid alignments, aiming to identify conserved sites downstream of the flanking tRNA, and there is thus no justification for continued speculation about polynucleotide start codon [76]. Nine PCGs have canonical termination codons TAA or TAG, while four have incomplete termination codons single T (cox3 and cytb) or TA (nad4 and nad1) (Table 3). Incomplete stop codons have been observed in most other lepidopteran mitogenomes and are common across mitogenomes [77]. It has been proposed that polycistronic pre-mRNA transcripts are processed by endonucleases, cleaving between tRNAs, and that polyadenylation of adjacent PCGs produces functional stop-codons from the partial termination codons such as a single T [78]. Complete mitogenome sequences of several lepidopterans were evaluated for codon usage. These species belonged to seven superfamilies (three species belonging to Pyraloidea, two species belonging to Bombycoidea, and one from each Noctuoidea, Geometroidea, Tortricoidea, Papilionoidea and Yponomeutoidea) (Fig 2). The analysis of codon usage showed that Asn, Ile, Leu2, Lys, Tyr and Phe were the amino acids with high relative usage frequency, while Arg was the least used amino acid. Three species of Geometroidea have consistent codon distributions in and each amino acid has equal content in them (Fig 3). The least used codons are those with high G and C, possibly due to high AT skew in lepidoptera PCGs [37, 79], for instance, L. haraldusalis, G. mellonella, B. mori, B. thibetaria, and L. malifoliella species all lack GCT codons, while G. molesta lacks CGT codons. However, in the present study all of these codons were observed in the mitogenome of Orthaga olivacea Warre (Fig 4) like that of A. yamamai, L. dispar and A. metis species [33, 67].
Fig 2

Codon usage patterns of O. olivacea Warre mitochondrial genome compared with other species of the Lepidoptera.

The lowercase letters above species name (a, b, c, d, e, f and g) indicate the superfamily which the species belong to (a: Pyraloidea, b: Bombycoidea, c: Noctuoidea, d: Geometroidea, e: Tortricoidea, f: Papilionoidea, g: Yponomeutoidea).

Fig 3

Codon distribution of O. olivacea Warre compared with other species of the Lepidoptera.

CDspT = codons per thousand codons.

Fig 4

The Relative Synonymous Codon Usage (RSCU) of the eight superfamilies mitochondrial genome of Lepidoptera.

Codon family is displayed on the X axis. Codons which are not present in mitochondrial genomes are indicated above.

Codon usage patterns of O. olivacea Warre mitochondrial genome compared with other species of the Lepidoptera.

The lowercase letters above species name (a, b, c, d, e, f and g) indicate the superfamily which the species belong to (a: Pyraloidea, b: Bombycoidea, c: Noctuoidea, d: Geometroidea, e: Tortricoidea, f: Papilionoidea, g: Yponomeutoidea).

Codon distribution of O. olivacea Warre compared with other species of the Lepidoptera.

CDspT = codons per thousand codons.

The Relative Synonymous Codon Usage (RSCU) of the eight superfamilies mitochondrial genome of Lepidoptera.

Codon family is displayed on the X axis. Codons which are not present in mitochondrial genomes are indicated above.

Transfer and ribosomal RNA genes

Orthaga olivacea Warre mitogenome has 22 tRNA genes, ranging in size from 53 bp (tRNA) to 70 bp (tRNA and tRNA). TRNAs show high A+T content (80.17%) and negative AT-skew (−0.015). All the tRNAs display typical cloverleaf secondary structures, except trnS which is missing a stable dihydrouridine (DHU) arm (Fig 5); this phenomenon is common across insects [17, 80, 81].
Fig 5

Putative secondary structures of the 22 tRNA genes of the Orthaga olivacea Warre mitogenome.

The rRNAs showed higher A+T content (84.00%) in comparison to the PCGs and tRNAs; this value falls within the range of sequenced insects (Table 4).

Overlapping and intergenic spacer regions

Six overlapping sequences with a total length of 23 bp were identified in the Orthaga olivacea Warre mitogenome. These sequences varied in length from 1 to 8 bp, and between tRNA and tRNA with the biggest overlapping region (8 bp). The overlapping region located between atp8 and atp6 was 7 bp, 3 bp between tRNA and tRNA, while the remainders were shorter than 3 bp (Table 3). The 7 bp overlapping region “ATGATAA” (Fig 6B) has also been documented in several lepidopterans sequenced to date [82, 83].
Fig 6

Conserved sequence across the Lepidoptera order.

(A) Intergenic spacer region alignment between trnS2 (UCN) and ND1 of several Lepidopterans. The framework ‘ATACTAA’ motif is conserved across the Lepidoptera order. (B) Intergenic overlap region alignment between ATP8 and ATP6 of several Lepidopterans. The bold ‘ATGATAA’ motif is the overlap region and it’s conserved across the Lepidoptera order. (C) Features present in the A+T-rich region of Orthaga olivacea Warre. The sequence is shown in the reverse strand. The ATAGA motif is bolded. The poly-T stretch is underlined. The single microsatellite T/A repeat sequence are double underlined.

Conserved sequence across the Lepidoptera order.

(A) Intergenic spacer region alignment between trnS2 (UCN) and ND1 of several Lepidopterans. The framework ‘ATACTAA’ motif is conserved across the Lepidoptera order. (B) Intergenic overlap region alignment between ATP8 and ATP6 of several Lepidopterans. The bold ‘ATGATAA’ motif is the overlap region and it’s conserved across the Lepidoptera order. (C) Features present in the A+T-rich region of Orthaga olivacea Warre. The sequence is shown in the reverse strand. The ATAGA motif is bolded. The poly-T stretch is underlined. The single microsatellite T/A repeat sequence are double underlined. The intergenic spacers of Orthaga olivacea Warre mitogenomes spread over fourteen regions and ranged in size from 1 to 52 bp with a total length of 134 bp. The longest intergenic spacer (52 bp) resided between tRNA and nad2. The 20 bp intergenic spacer region located between tRNA and nad1 contained the ‘ATACTAA’ motif. The 7 bp motif is considered to be a conserved structure found in most of the insect mtDNAs (Fig 6A).

The A+T-rich region

The mitogenome of Orthaga olivacea Warre includes an A+T-rich region of 293 bp. This region showed the highest A+T content (93.86%), within the range reported of other lepidopterans (Table 4). Variation in intergenic length of noncoding regions particularly repeat sequences is responsible for most size variation in mitogenome. The control region is usually the largest noncoding part in the mitogenome [84, 85]. Several conserved structures found in other lepidopteran mitogenomes were also observed in the AT-rich region of Orthaga olivacea Warre, including the ‘ATAGA’ motif followed by a 17 bp poly-T stretch, and a microsatellite-like (AT)13 reapeat [86, 87] (Fig 6C). Above all, there are many remarkable characteristics in nucleotide composition. Compared with reported lepidopteran species, these characteristics include the structure of tRNAs and PCGs, A+T rich region and intergenic spacer region share similarities but also some differences. And these differences and similarities between them can be used as potential markers in phylogenetic analysis. We reconstructed the phylogenetic relationships among seven lepidopteran superfamilies using Maximum Likelihood (ML) method based on concatenated nucleotide sequences of the 13 PCGs. Phylogenetic analysis revealed that different species from the same family clustered together (Fig 7). The complete nucleotide sequences of 59 species of Lepidoptera, represent 16 families (Bombycidae, Saturniidae, Sphingidae, Lymantriidae, Erebidae, Notodontidae, Noctuidae, Nolidae, Geometridae, Crambidae, Pyralidae, Tortricidae, Papilionidae, Nymphalidae, Plutellidae, and Lyonetiidae) were downloaded from GenBank to reconstruct phylogenetic relationships among them. The species Orthaga olivacea Warre belonging to the superfamily Pyralidae, and the relationship were closer with Hypsopygia regina than that with Galleria mellonella and Corcyra cephalonica. Phylogenetic analyses showed that Pyraloidea is clustered with other superfamilies including Bombycoidea, Geometroidea, Noctuoidea, Papilionoidea, Tortricoidea, and Yponomeutoidea. Of these Bombycoidea and Geometroidea were sister groups, and the relationgship of them were closer than Noctuoidea in ML analysis (Fig 7). In the present study, the relationships at superfamily level are consistent with prior studies of lepidopteran phylogeny [88-90]. Previous classifications of Pyralidae species were mostly based on morphology, of which numerous studies are regionally limited; therefore, the precise position of Pyralidae within the Pyraloidea remained unclear, more studies are needed on the complete mitochondrial genome of the diverse Pyraloidea species in order to understand the complexity of phylogenetic relationships.
Fig 7

Phylogenetic relationships tree among Lepidopteran insects.

The Maximum Likelihood method was used in the tree constructing. Bootstrap values (1000 repetitions) of the branches are indicated. Limnephilus hyalinus (NC_044710.1), Drosophila incompta (NC_025936) and Locusta migratoria (JN858212) were used as outgroups.

Phylogenetic relationships tree among Lepidopteran insects.

The Maximum Likelihood method was used in the tree constructing. Bootstrap values (1000 repetitions) of the branches are indicated. Limnephilus hyalinus (NC_044710.1), Drosophila incompta (NC_025936) and Locusta migratoria (JN858212) were used as outgroups.

Conclusion

The newly accessible mitogenome of Orthaga olivacea Warre (Lepidoptera: Pyralidae) is 15,174 bp long, including 13 protein-coding genes (PCGs), two rRNA genes, 22 tRNA genes and an A+T-rich region. The arrangement of 13 PCGs is same to that of other sequenced lepidopterans. All PCGs of the mitogenome start with typical ATN codons, except for cytochrome c oxidase 1 (cox1) with the start codon CGA. The canonical termination codon (TAA or TAG) occurs in nine PCGs (TAA for nad2, cox1, cox2, atp8, atp6, nad3, nad5, nad4L and nad6 genes), and the remainders PCGs were terminated with a single T or TA (a single T for cox3 and cytb genes, TA for nad4 and nad1 genes). Phylogenetic analysis suggested that Orthaga olivacea Warre is more closely related to the Lista haraldusalis, and confirms that Orthaga olivacea Warre belongs to the family Pyralidae. 25 Oct 2019 PONE-D-19-24590 Characterization of the complete mitochondrial genome of Orthaga olivacea Warre (Lepidoptera Pyralididae) and comparison with other Lepidopteran insects PLOS ONE Dear Dr Wei, Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process. The manuscript has been assessed by three reviewers; their comments are available below. The reviewers have raised major concerns that need attention in a revision. The reviewers note that the phylogenetic analysis needs to be substantially revised to add more species and to revisit the approach employed for the analyses. The reviewers also feel that the manuscript should provide a clearer outline of the study aims and research question addressed in the Introduction section and they request improvements to the written language. Could you please carefully revise the manuscript to address the concerns raised by the reviewers? We would appreciate receiving your revised manuscript by Dec 08 2019 11:59PM. When you are ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file. If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. To enhance the reproducibility of your results, we recommend that if applicable you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols Please include the following items when submitting your revised manuscript: A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). This letter should be uploaded as separate file and labeled 'Response to Reviewers'. A marked-up copy of your manuscript that highlights changes made to the original version. This file should be uploaded as separate file and labeled 'Revised Manuscript with Track Changes'. An unmarked version of your revised paper without tracked changes. This file should be uploaded as separate file and labeled 'Manuscript'. Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out. We look forward to receiving your revised manuscript. Kind regards, Iratxe Puebla Senior Managing Editor, PLOS ONE Journal Requirements: 1. When submitting your revision, we need you to address these additional requirements. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at http://www.journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and http://www.journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf 2. We noticed you have some occurrence of overlapping text between the current submission and your previous publication(s) as following, which needs to be addressed: - https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0132951 -https://www.nature.com/articles/srep39153 -https://www.sciencedirect.com/science/article/pii/S0141813017324807?via%3Dihub In your revision ensure you cite all your sources (including your own works), and quote or rephrase any duplicated text outside the methods section. Further consideration is dependent on these concerns being addressed."" Comments to the Author 1. Is the manuscript technically sound, and do the data support the conclusions? The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1: Partly Reviewer #2: Yes Reviewer #3: Yes ********** 2. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1: No Reviewer #2: Yes Reviewer #3: N/A ********** 3. Have the authors made all data underlying the findings in their manuscript fully available? The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #1: Yes Reviewer #2: Yes Reviewer #3: Yes ********** 4. Is the manuscript presented in an intelligible fashion and written in standard English? PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #1: Yes Reviewer #2: Yes Reviewer #3: Yes ********** 5. Review Comments to the Author Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #1: In this manuscript, the authors sequence the complete mitochondrial genome of the moth, Orthaga olivacea. They then describe the annotation of this moth and use phylogenetic methods to compare it with the mitochondrial genomes of 34 other Lepidoptera. The writing is somewhat uneven—I have a number of suggestions for improvement, especially for the Abstract and Introduction in the Minor comments section at the end of this reviewer report. The annotation of the mitochondrial genome is acceptable, but I have a number of concerns especially about the phylogenetic analysis that will need to be addressed before this manuscript will be suitable for publication. Major issues: 1. Pyraloidea taxon sampling. Line 62. “Considering the limited information of the mitochondrial sequences in Pyralidae, we sequenced the complete mitogenome of Orthaga olivacea, and compared it with other insect species, especially with the members of Pyralidae species.” This is a reasonable justification for sequencing the mitogenome of O. olivacea, but it is very curious that only 3 mitogenomes were included in the phylogenetic analysis and many of the other pyralid mitochondrial genomes that are available from Genbank were not included in these analyses including Corcyra cephalonica, Amyelois transitella, Plodia interpunctella (3 mitogenomes), Ephestia kuehniella (3 mitogenomes), Meroptera pravella, and Hypsopygia regina. Similarly, the sister-family to the Pyralidae includes an even larger number of species with sequenced mitochondrial genomes that were not included in the presented analyses including Paracymoriza prodigalis, Elophila interruptalis, Pseudargyria interruptella, Chilo auriculius, Chilo sacchariphagus, Evergestis junctalis, Nomophila noctuella, , Tryspandoes striata, Glyphodes quadrimaculalis, Spoladea recurvalis, Dichocrocis punctiferalis, Glyphodes pyloalis, Maruca vitrata, Maruca testulalis, Haritalodes derogate, Pycnarmon lactiferalis, Loxostege stricticalis, Endotricha consoci, Euzophera pyriella, Dichocrocis punctiferalis, and Cnaphalocrocis medinalis (3 mitogenomes). If one of the goals of the authors is to demonstrate that Orthaga olivacea belongs within the Pyralidae and to determine its closest relatives with sequences mitochondrial genomes, then they need to repeat their phylogenetic analysis after supplementing their current data set with all of these additional species. (Also note that Lista haraldusalis is misspelled in Fig. 7 and in other locations in the manuscript. Also, Family Pyralidae (and probably also Family Crambidae) should be indicated in Fig. 7.) 2. The authors employ 2 non-Lepidoptera outgroup species: Drosophila yakuba, a fly (Order Diptera) and Locusta migratoria, a grasshopper (Order Orthoptera), but the authors do not include any representatives of the insect Order most closely related to the Lepidoptera, the caddisflies (Order Trichoptera). There are at least 17 complete mitochondrial genomes representing several caddisfly Families available through Genbank (Al-Baeity et al. 2019). To root the Lepidopteran tree properly caddisflies sequences MUST also be included in the phylogenetic analyses. Minor issues: Line 2. Title: In modern usage, the lepidopteran family is usually called Pyralidae, not “Pyralididae”. Change here and throughout manuscript. Line 18. Abstract: Suggested reword with greater specificity “Orthaga olivacea Ware (Lepidoptera Pyralidae) is an important agricultural pest of camphor trees (Cinnamomum camphora).” Line 19. Suggested reword “To further supplement the known genome-level…” Line 20. Suggested reword “…other species of Lepidoptera.” Lines 31-31. Suggested reword “Phylogenetic analysis suggested that among sequenced lepidopteran mitochondrial genomes, Orthaga olivacea Warre was most closely related…” Line 38. Suggested reword “…(mtDNA) is a circular molecule range in size from 14 to 19 kb…” Line 42. Suggested reword “…A+T-rich region, the largest noncoding…” Line 43-47. Suggested reword to remove repetition “Whole mitochondrial genomes are a useful data source for several research areas, such as evolutionary genomics (9, 10), comparative molecular evolution (11, 12), phylogeography (13), and population genetics (14).” Line 50-51. Suggested reword to remove extraneous information “…over 25,000 species and some pyralids are important agricultural pests…” Line 53-53. Suggested reword “Despite their diversity and great importance as pests of agricultural and forestry plants, they are also valuable for pollinating plants of economic importance. Most species in the family Pyralidae do not yet have sequenced mitogenomes.” Line 58. “remove” should be “removal” Line 59-60. “However, overlapping generations and irregularity of abundance in the field from May to October make it very difficult to control.” Line 72. Suggested reword “…the camphor trees on the campus of…” Line 94. “…insert DNA were sequenced at least three times…” Query: was sequencing of the inserts done in both directions? If yes, please specify in the text. Lines 99-100. Suggested reword “…under the accession number MN078362.” Line 125-126. “…mitogenome sizes documented for other sequenced lepidopterans which range from 14,534 bp in Ostrinia nublilalis (incomplete)…” Since the sequencing of the mitochondrial genome of O. nublilalis is incomplete, it is inappropriate and incorrect to use this sequence to estimate the minimum mitochondrial genome size in the Lepidoptera. This data point should be replaced with the smallest completely sequenced mitochondrial genome from the Lepidoptera. Lines 136-137. Suggested reword “In addition, the GC skew…” Line 146. Table 4. I’m not sure that this table is necessary and perhaps should be removed. Line 166. Suggested reword “…observed in most other lepidopteran mitogenomes and are…” Line 177-179. Suggested reword “…for instance, L. haraldusalis, G. mellonella, B. mori, B. thibetaria, and L. malifoliella species all lack GCT codons, while G. mollesta lacks CGT codons.” Line 246-248. “The species Orthaga olivacea…” This sentence should be revised based on the updated phylogenetic analysis after adding the taxa I suggested in the major revisions section above. Lines 252-253. Suggested reword “…constituent with prior studies of lepidopteran phylogeny.” References: Al-Baeity, H., Allard, L.S., Arreza, L., et al. (2019) The complete mitochondrial genome of the North American pale summer sedge caddisfly Limnephilus hyalinus (Insecta: Trichoptera: Limnephilidae). Mitochondrial DNA Part B 4: 413-415. Reviewer #2: The manuscript mainly determined the complete mitochondrial genome of Orthaga olivacea Warre (Lepidoptera Pyralididae) and compare the mtDNA with other Lepidopteran insects. The English is acceptable. The literature cited is appropriate and draws on numerous comparative examples of similar research. Overall structure is of good quality and the raw data complete. The paper touches on the pertinent theoretical ideas proposed by earlier researchers. Overall, this manuscript is interesting, the description of the methods is complete and sound, and worthy to be published in “PLoS ONE” after minor modified. 1. the tables would be “three line”. 2. the literature 34 (line 353) was not complete. 3. “Warre” (ects.) in the figures would not be italic. 4. correct others, for examples, line 194 “TRNAs” (tRNAs ?); line 201 “The rNAs” (The rRNAs ?), ect. Reviewer #3: In the manuscript, the mitogenome of Orthaga olivacea was determined and comparison with other lepidopteran sequences were also analyzed. The results of the study are valuable for the readers interested in the comparative mitogenome and phylogeny of Pyralididae. These results are informative and useful. I suggest this article can be published in this journal. However, the manuscript needs to be improved before acceptance for publication. 1. Introduction: the authors should provide clearly the study aim and scientific questions. It includes a description of the importance of the research and the study and reviews most of the previous literature. However, the authors have omitted a few studies of relevance and these should be included, 2. It is not clear from the manuscript that the collected Orthaga olivacea samples were verified astruly belong to the said species. It is suggested for the author to delimit the detailed morphological characters of the species to confirm. 3. Based on the dataset of 13 concatenated protein sequences, the authors reconstructed the phylogeny of Lepidoptera using MEGA with the Maximum Likelihood method. It is more persuasive and popular to carry out such analysis with RAxML method. 4. There are some errors in grammar and syntax throughout the text of the manuscript, the English writing should be further improved. ********** 6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: No Reviewer #2: Yes: Ping You Reviewer #3: No [NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files to be viewed.] While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org. Please note that Supporting Information files do not need this step. 7 Dec 2019 Responds to the reviewer’s comments: Reviewer #1: Major issues: 1. Response to comment: (Pyraloidea taxon sampling. Line 62. “Considering the limited information of the mitochondrial sequences in Pyralidae, we sequenced the complete mitogenome of Orthaga olivacea, and compared it with other insect species, especially with the members of Pyralidae species.” This is a reasonable justification for sequencing the mitogenome of O. olivacea, but it is very curious that only 3 mitogenomes were included in the phylogenetic analysis and many of the other pyralid mitochondrial genomes that are available from Genbank were not included in these analyses including Corcyra cephalonica, Amyelois transitella, Plodia interpunctella (3 mitogenomes), Ephestia kuehniella (3 mitogenomes), Meroptera pravella, and Hypsopygia regina. Similarly, the sister-family to the Pyralidae includes an even larger number of species with sequenced mitochondrial genomes that were not included in the presented analyses including Paracymoriza prodigalis, Elophila interruptalis, Pseudargyria interruptella, Chilo auriculius, Chilo sacchariphagus, Evergestis junctalis, Nomophila noctuella, , Tryspandoes striata, Glyphodes quadrimaculalis, Spoladea recurvalis, Dichocrocis punctiferalis, Glyphodes pyloalis, Maruca vitrata, Maruca testulalis, Haritalodes derogate, Pycnarmon lactiferalis, Loxostege stricticalis, Endotricha consoci, Euzophera pyriella, Dichocrocis punctiferalis, and Cnaphalocrocis medinalis (3 mitogenomes). If one of the goals of the authors is to demonstrate that Orthaga olivacea belongs within the Pyralidae and to determine its closest relatives with sequences mitochondrial genomes, then they need to repeat their phylogenetic analysis after supplementing their current data set with all of these additional species. (Also note that Lista haraldusalis is misspelled in Fig. 7 and in other locations in the manuscript. Also, Family Pyralidae (and probably also Family Crambidae) should be indicated in Fig. 7.)) Response: We are very sorry for our omission that it is inadequate to the goals to demonstrate that Orthaga olivacea belongs within the Pyralidae and to determine its closest relatives with sequences mitochondrial genomes with only 3 pyralid mitochondrial genomes were included in the phylogenetic analysis. According reviewer’s suggestion, we have repeated our phylogenetic analysis after supplementing our current data set with all of these additional species. And we have corrected the misspelled of Lista haraldusalis in Fig. 7 and in other locations in the manuscript. Also, Family Pyralidae (and probably also Family Crambidae) was indicated in Fig. 7. 2. Response to comment: (The authors employ 2 non-Lepidoptera outgroup species: Drosophila yakuba, a fly (Order Diptera) and Locusta migratoria, a grasshopper (Order Orthoptera), but the authors do not include any representatives of the insect Order most closely related to the Lepidoptera, the caddisflies (Order Trichoptera). There are at least 17 complete mitochondrial genomes representing several caddisfly Families available through Genbank (Al-Baeity et al. 2019). To root the Lepidopteran tree properly caddisflies sequences MUST also be included in the phylogenetic analyses.) Response: Considering the Reviewer’s suggestion, we have included the caddisflies sequences of Limnephilus hyalinus in the phylogenetic analyses as outgroup. Minor issues: 1. Response to comment: (Line 2. Title: In modern usage, the lepidopteran family is usually called Pyralidae, not “Pyralididae”. Change here and throughout manuscript.) Response: We are very sorry for our Negligence of the use of “Pyralididae”, and we have corrected it to “Pyralidae” throughout manuscript. 2. Response to comment: (Line 18. Abstract: Suggested reword with greater specificity “Orthaga olivacea Ware (Lepidoptera Pyralidae) is an important agricultural pest of camphor trees (Cinnamomum camphora).”) Response: According reviewer’s suggestion, we have reworded with greater specificity. 3. Response to comment: (Line 19. Suggested reword “To further supplement the known genome-level…”) Response: According reviewer’s suggestion, we have reworded it in the target location. 4. Response to comment: (Line 20. Suggested reword “…other species of Lepidoptera.”) Response: According reviewer’s suggestion, we have reworded it in the target location. 5. Response to comment: (Lines 31-31. Suggested reword “Phylogenetic analysis suggested that among sequenced lepidopteran mitochondrial genomes, Orthaga olivacea Warre was most closely related…”) Response: According reviewer’s suggestion, we have reworded it in the target location. 6. Response to comment: (Line 38. Suggested reword “…(mtDNA) is a circular molecule range in size from 14 to 19 kb…”) Response: According reviewer’s suggestion, we have reworded it in the target location. 7. Response to comment: (Line 42. Suggested reword “…A+T-rich region, the largest noncoding…”) Response: According reviewer’s suggestion, we have reworded it in the target location. 8. Response to comment: (Line 43-47. Suggested reword to remove repetition “Whole mitochondrial genomes are a useful data source for several research areas, such as evolutionary genomics (9, 10), comparative molecular evolution (11, 12), phylogeography (13), and population genetics (14).) Response: According reviewer’s suggestion, we have removed repetition in the target location. 9. Response to comment: (Line 50-51. Suggested reword to remove extraneous information “…over 25,000 species and some pyralids are important agricultural pests…”) Response: According reviewer’s suggestion, we have removed extraneous information in the target location. 10. Response to comment: (Line 53-53. Suggested reword “Despite their diversity and great importance as pests of agricultural and forestry plants, they are also valuable for pollinating plants of economic importance. Most species in the family Pyralidae do not yet have sequenced mitogenomes.”) Response: According reviewer’s suggestion, we have reworded it in the target location. 11. Response to comment: (Line 58. “remove” should be “removal”) Response: According reviewer’s suggestion, we have corrected “remove” to “removal”. 12. Response to comment: (Line 59-60. “However, overlapping generations and irregularity of abundance in the field from May to October make it very difficult to control.”) Response: According reviewer’s suggestion, we have reworded it in the target location. 13. Response to comment: (Line 72. Suggested reword “…the camphor trees on the campus of…”) Response: According reviewer’s suggestion, we have reworded it in the target location. 14. Response to comment: (Line 94. “…insert DNA were sequenced at least three times…” Query: was sequencing of the inserts done in both directions? If yes, please specify in the text.) Response: Yes, the sequencing of the inserts was done in both directins. According reviewer’s suggestion, we have specified in the text. 15. Response to comment: (Lines 99-100. Suggested reword “…under the accession number MN078362.”) Response: According reviewer’s suggestion, we have reworded it in the target location. 16. Response to comment: (Line 125-126. “…mitogenome sizes documented for other sequenced lepidopterans which range from 14,534 bp in Ostrinia nublilalis (incomplete)…” Since the sequencing of the mitochondrial genome of O. nublilalis is incomplete, it is inappropriate and incorrect to use this sequence to estimate the minimum mitochondrial genome size in the Lepidoptera. This data point should be replaced with the smallest completely sequenced mitochondrial genome from the Lepidoptera.) Response: Thank you for pointing out the error. We have re-searched NCBI, and found that the sequencing of the mitochondrial genome of Ostrinia nublilalis is complete with 14,535 bp. And maybe Ostrinia nublilalis is the smallest completely sequenced mitochondrial genome from the Lepidoptera. we have corrected it in the target location. 17. Response to comment: (Lines 136-137. Suggested reword “In addition, the GC skew…”) Response: According reviewer’s suggestion, we have reworded it in the target location. 18. Response to comment: (Line 146. Table 4. I’m not sure that this table is necessary and perhaps should be removed.) Response: Thank you for your suggestion, but we think by base preference and compared it with other species in table 4, can better understand this mitochondrial genome. Therefore, we chose to keep table 4 in the manuscript. 19. Response to comment: (Line 166. Suggested reword “…observed in most other lepidopteran mitogenomes and are…”) Response: According reviewer’s suggestion, we have reworded it in the target location. 20. Response to comment: (Line 177-179. Suggested reword “…for instance, L. haraldusalis, G. mellonella, B. mori, B. thibetaria, and L. malifoliella species all lack GCT codons, while G. mollesta lacks CGT codons.”) Response: According reviewer’s suggestion, we have reworded it in the target location. 21. Response to comment: (Line 246-248. “The species Orthaga olivacea…” This sentence should be revised based on the updated phylogenetic analysis after adding the taxa I suggested in the major revisions section above.) Response: According reviewer’s suggestion, we have revised this sentence based on the updated phylogenetic analysis. 22. Response to comment: (Lines 252-253. Suggested reword “…constituent with prior studies of lepidopteran phylogeny.”) Response: According reviewer’s suggestion, we have reworded it in the target location. Reviewer #2: 1. Response to comment: (the tables would be “three line”.) Response: According reviewer’s suggestion, we have changed all tables into “three line” forms. 2. Response to comment: (the literature 34 (line 353) was not complete.) Response: According reviewer’s suggestion, we have reworded it in the target location. 3. Response to comment: (“Warre” (ects.) in the figures would not be italic.) Response: We are very sorry for our error application of the italic of “Warre” (ects.) in the figures, we have corrected it in all figures. 4. Response to comment: (“correct others, for examples, line 194 “TRNAs” (tRNAs ?); line 201 “The rNAs” (The rRNAs ?), ect.) Response: We are very sorry for our incorrect in spelling, and we have already corrected them in the text and marked in color. Reviewer #3: 1. Response to comment: (Introduction: the authors should provide clearly the study aim and scientific questions. It includes a description of the importance of the research and the study and reviews most of the previous literature. However, the authors have omitted a few studies of relevance and these should be included,) Response: According reviewer’s suggestion, we have reworded the Introduction section to provide a clearer outline of the study aims and research question and marked in color. 2. Response to comment: (It is not clear from the manuscript that the collected Orthaga olivacea samples were verified as truly belongs to the said species. It is suggested for the author to delimit the detailed morphological characters of the species to confirm.) Response: According reviewer’s suggestion, we have added detailed description of the morphological characteristics of the species' larvae in the materials and methods section to better delimit the species. 3. Response to comment: (Based on the dataset of 13 concatenated protein sequences, the authors reconstructed the phylogeny of Lepidoptera using MEGA with the Maximum Likelihood method. It is more persuasive and popular to carry out such analysis with RAxML method.) Response: We are very sorry that we didn’t reconstruct the phylogeny of Lepidoptera using the RAxML method as you suggested. Because we think the RAxML method is an alternative solution in phylogeny, we found that using MEGA method to analyze the phylogeny of Lepidoptera is also popular. For example, in the study of Cerura menciana (Dai et. al., 2015), Biston marginata (Zheng et al., 2018) and Ctenoptilum vasava (Hao et. al., 2012) in Lepidoptera, they used MEGA to reconstruct the evolutionary relationship of Lepidoptera with the Maximum Likelihood method, and also got a better evolutionary relationship tree. In this study, based on the analysis of the original evolutionary relationship, we added another 25 species of Pyralidae and finally got a better evolutionary relationship of Lepidoptera. So we think that the MEGA method can also be used to construct the evolutionary tree based on Lepidoptera mitochondria. 4. Response to comment: (There are some errors in grammar and syntax throughout the text of the manuscript, the English writing should be further improved.) Response: We are very sorry for our incorrect in grammar and syntax, and we have already corrected them in the text and marked in color. We tried our best to improve the manuscript and made some changes in the manuscript. These changes will not influence the content and framework of the paper. And here we did not list the changes but marked in revised manuscript. We appreciate for Editors/Reviewers’ warm work earnestly, and hope that the corrections will meet with approval. Once again, thank you very much for your comments and suggestions. Yours Sincerely Guoqing Wei Submitted filename: Response to Reviewers.docx Click here for additional data file. 16 Dec 2019 PONE-D-19-24590R1 Characterization of the complete mitochondrial genome of Orthaga olivacea Warre (Lepidoptera Pyralidae) and comparison with other Lepidopteran insects PLOS ONE Dear Dr Wei, Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process. We would appreciate receiving your revised manuscript by Jan 30 2020 11:59PM. When you are ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file. If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. To enhance the reproducibility of your results, we recommend that if applicable you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols Please include the following items when submitting your revised manuscript: A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). This letter should be uploaded as separate file and labeled 'Response to Reviewers'. A marked-up copy of your manuscript that highlights changes made to the original version. This file should be uploaded as separate file and labeled 'Revised Manuscript with Track Changes'. An unmarked version of your revised paper without tracked changes. This file should be uploaded as separate file and labeled 'Manuscript'. Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out. We look forward to receiving your revised manuscript. Kind regards, Jeffrey M. Marcus Academic Editor PLOS ONE Additional Editor Comments (if provided): Greetings. After receiving the first round of reviewer comments responding to your initial submission, PLOS ONE has asked me to change my role from Reviewer (I was Reviewer #1) to Guest Academic Editor to guide you through the remainder of the peer review process. I have read your revision and overall, I am very pleased with how you have responded to the reviewer comments. However, there are a few remaining items that you will need to address before your manuscript can be considered acceptable for publication in PLOS ONE. They are listed below. Please make theses additional necessary changes and resubmit your work for final consideration by the journal. 1. Line 62. Delete entire sentence beginning with "What'more considering the limited..." It is unnecessary. 2. Table 2 includes a column of references. These table citations are not in the same format as the in-text citations in the rest of the manuscript and some of these references do not appear in the reference section at the end of the manuscript. Please correct the formatting, and ensure that all of the references listed in Table 2 also appear in the reference section. 3. The reference for the Meroptera pravella mitochondrial genome in Table 2 is listed as "Consortium et al. (2017)". This is properly referenced as "Living Prairie Consortium (2017)". 4. Fig. 7. The vertical line associated with the label "Pyraloidea" should extend from Glyphodes quadrimaculalis to Ephestia kuehniella in this figure. [Note: HTML markup is below. Please do not edit.] [NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files to be viewed.] While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org. Please note that Supporting Information files do not need this step. 27 Dec 2019 Dear Editor: Thank you very much for your letter and the comments concerning our manuscript entitled “Characterization of the complete mitochondrial genome of Orthaga olivacea Warre (Lepidoptera Pyralidae) and comparison with other Lepidopteran insects” (ID: PONE-D-19-24590). Those comments are all valuable and very helpful for revising our paper to meet the acceptable criterion for publication in PLOS ONE. We have studied comments carefully and have made corrections which we hope to meet with approval. Revised portions are marked in color in the manuscript. The main corrections in the paper and the responds to the comments are as flowing: Responds to the reviewer’s comments: 1. Response to comment: (Line 62. Delete entire sentence beginning with "What'more considering the limited..." It is unnecessary.) Response: According to the reviewer’s suggestion, we have deleted it in the target location. 2. Response to comment: (Table 2 includes a column of references. These table citations are not in the same format as the in-text citations in the rest of the manuscript and some of these references do not appear in the reference section at the end of the manuscript. Please correct the formatting, and ensure that all of the references listed in Table 2 also appear in the reference section.) Response: We are very sorry for our negligence of the citations format and omission of some references in Table 2, and we have corrected the formatting in Table 2 and increased the omissive references in the reference section. 3. Response to comment: (The reference for the Meroptera pravella mitochondrial genome in Table 2 is listed as "Consortium et al. (2017)". This is properly referenced as "Living Prairie Consortium (2017)".) Response: Considering the second suggestion, we have modified the reference formats in table 2. 4. Response to comment: (Fig. 7. The vertical line associated with the label "Pyraloidea" should extend from Glyphodes quadrimaculalis to Ephestia kuehniella in this figure.) Response: According the suggestion, we modified the vertical line associated with the label "Pyraloidea" and make sure it is extended from Glyphodes quadrimaculalis to Ephestia kuehniella in fig. 7. We tried our best to improve the manuscript and made some changes in the manuscript. These changes will not influence the content and framework of the paper. And here we did not list the changes but marked in revised manuscript. We appreciate for Editors/Reviewers’ warm work earnestly, and hope that the corrections will meet with approval. Once again, thank you very much for your comments and suggestions. Yours Sincerely Guoqing Wei Submitted filename: Response to Reviewers.docx Click here for additional data file. 31 Dec 2019 Characterization of the complete mitochondrial genome of Orthaga olivacea Warre (Lepidoptera Pyralidae) and comparison with other Lepidopteran insects PONE-D-19-24590R2 Dear Dr. Wei, We are pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it complies with all outstanding technical requirements. Within one week, you will receive an e-mail containing information on the amendments required prior to publication. When all required modifications have been addressed, you will receive a formal acceptance letter and your manuscript will proceed to our production department and be scheduled for publication. Shortly after the formal acceptance letter is sent, an invoice for payment will follow. To ensure an efficient production and billing process, please log into Editorial Manager at https://www.editorialmanager.com/pone/, click the "Update My Information" link at the top of the page, and update your user information. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org. If your institution or institutions have a press office, please notify them about your upcoming paper to enable them to help maximize its impact. If they will be preparing press materials for this manuscript, you must inform our press team as soon as possible and no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org. With kind regards, Jeffrey M. Marcus Guest Editor PLOS ONE Additional Editor Comments (optional): Thank you for responding to my recommendations for revision. I am now prepared to recommend acceptance of this manuscript at PLOS ONE. Reviewers' comments: 24 Feb 2020 PONE-D-19-24590R2 Characterization of the complete mitochondrial genome of Orthaga olivacea Warre (Lepidoptera Pyralidae) and comparison with other Lepidopteran insects Dear Dr. Wei: I am pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department. If your institution or institutions have a press office, please notify them about your upcoming paper at this point, to enable them to help maximize its impact. If they will be preparing press materials for this manuscript, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org. For any other questions or concerns, please email plosone@plos.org. Thank you for submitting your work to PLOS ONE. With kind regards, PLOS ONE Editorial Office Staff on behalf of Dr. Jeffrey M. Marcus Guest Editor PLOS ONE
  72 in total

1.  Tandem repeats finder: a program to analyze DNA sequences.

Authors:  G Benson
Journal:  Nucleic Acids Res       Date:  1999-01-15       Impact factor: 16.971

2.  Complete mitochondrial genome of Chilo suppressalis (Walker) (Lepidoptera: Crambidae).

Authors:  Jiao Yin; Ai-Min Wang; Gui-Yun Hong; Ya-Zhong Cao; Zhao-Jun Wei
Journal:  Mitochondrial DNA       Date:  2011-06

3.  Molecular population genetics of the male and female mitochondrial DNA molecules of the California sea mussel, Mytilus californianus.

Authors:  Brian S Ort; Grant H Pogson
Journal:  Genetics       Date:  2007-08-24       Impact factor: 4.562

4.  The mitochondrial genome of the firefly, Pyrocoelia rufa: complete DNA sequence, genome organization, and phylogenetic analysis with other insects.

Authors:  Jin Sik Bae; Iksoo Kim; Hung Dae Sohn; Byung Rae Jin
Journal:  Mol Phylogenet Evol       Date:  2004-09       Impact factor: 4.286

5.  Characterization of the complete mitochondrial genome of Diaphania pyloalis (Lepidoptera: Pyralididae).

Authors:  Bao-Jian Zhu; Qiu-Ning Liu; Li-Shang Dai; Lei Wang; Yu Sun; Kun-Zhang Lin; Guo-Qing Wei; Chao-Liang Liu
Journal:  Gene       Date:  2013-06-26       Impact factor: 3.688

6.  The complete mitochondrial genome of Leucoptera malifoliella Costa (Lepidoptera: Lyonetiidae).

Authors:  Yu-Peng Wu; Jin-Liang Zhao; Tian-Juan Su; Jie Li; Fang Yu; Douglas Chesters; Ren-Jun Fan; Ming-Chang Chen; Chun-Sheng Wu; Chao-Dong Zhu
Journal:  DNA Cell Biol       Date:  2012-08-02       Impact factor: 3.311

7.  The complete mitochondrial genome of the rice moth, Corcyra cephalonica.

Authors:  Yu-Peng Wu; Jie Li; Jin-Liang Zhao; Tian-Juan Su; A-Rong Luo; Ren-Jun Fan; Ming-Chang Chen; Chun-Sheng Wu; Chao-Dong Zhu
Journal:  J Insect Sci       Date:  2012       Impact factor: 1.857

8.  The complete mitochondrial genome of the oriental fruit moth Grapholita molesta (Busck) (Lepidoptera: Tortricidae).

Authors:  Ya-jun Gong; Bao-cai Shi; Zong-jiang Kang; Fan Zhang; Shu-jun Wei
Journal:  Mol Biol Rep       Date:  2011-06-14       Impact factor: 2.316

9.  The Complete Mitochondrial Genome of Ctenoptilum vasava (Lepidoptera: Hesperiidae: Pyrginae) and Its Phylogenetic Implication.

Authors:  Jiasheng Hao; Qianqian Sun; Huabin Zhao; Xiaoyan Sun; Yonghua Gai; Qun Yang
Journal:  Comp Funct Genomics       Date:  2012-04-05

10.  Characterization of the Complete Mitochondrial Genome of Cerura menciana and Comparison with Other Lepidopteran Insects.

Authors:  Lishang Dai; Cen Qian; Congfen Zhang; Lei Wang; Guoqing Wei; Jun Li; Baojian Zhu; Chaoliang Liu
Journal:  PLoS One       Date:  2015-08-26       Impact factor: 3.240

View more
  4 in total

1.  Organization and phylogenetic relationships of the mitochondrial genomes of Speiredonia retorta and other lepidopteran insects.

Authors:  Yu Sun; Hua Huang; Yudong Liu; Shanshan Liu; Jun Xia; Kai Zhang; Jian Geng
Journal:  Sci Rep       Date:  2021-02-03       Impact factor: 4.379

2.  Organization of the mitochondrial genome of Ramulus irregulatiter dentatus (Phasmatidae: Phasmatidae).

Authors:  Congfen Zhang; Xiaoqiang Guo
Journal:  Front Genet       Date:  2022-08-29       Impact factor: 4.772

3.  Enhanced Resolution of Evolution and Phylogeny of the Moths Inferred from Nineteen Mitochondrial Genomes.

Authors:  Xiaofeng Zheng; Rusong Zhang; Bisong Yue; Yongjie Wu; Nan Yang; Chuang Zhou
Journal:  Genes (Basel)       Date:  2022-09-12       Impact factor: 4.141

4.  The First Mitogenomes of the Subfamily Odontiinae (Lepidoptera, Crambidae) and Phylogenetic Analysis of Pyraloidea.

Authors:  Mujie Qi; Huifeng Zhao; Fang Yu; Aibing Zhang; Houhun Li
Journal:  Insects       Date:  2021-05-24       Impact factor: 2.769

  4 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.