Literature DB >> 21670960

The complete mitochondrial genome of the oriental fruit moth Grapholita molesta (Busck) (Lepidoptera: Tortricidae).

Ya-jun Gong1, Bao-cai Shi, Zong-jiang Kang, Fan Zhang, Shu-jun Wei.   

Abstract

The oriental fruit moth, Grapholita molesta (Busck) (Lepidoptera: Tortricidae) currently is one of the economically most destructive pest species of stone and pome fruits worldwide. Here we sequenced the complete mitochondrial genome of this pest. This genome is 15,776 bp long, with an A + T content of 81.24%, containing 37 typical animal mitochondrial genes and an A + T-rich region. All gene are arranged as hypothesized ancestral gene order of insects except for trnM, which was shuffled from 3' downstream of trnQ to 5' upstream of trnI. cox1 gene uses unusual CGA start codon, as that in all other sequenced lepidopteran mitochondrial genome. The secondary structures for the two rRNA genes were predicted. All helices typically present in insect mitochondrial rRNA genes are generated. A microsatellite sequence was inserted into the region of H2347 in rrnL in G. molesta and two other sequenced tortricid mitochondrial genomes, indicating that the insertion event in this helix might occurred anciently in family Tortricidae. All of the 22 typical animal tRNA genes have a typical cloverleaf structure except for trnS2, in which the D-stem pairings in the DHU arm are absent. An intergenic sequence is present between trnQ and nad2 as well as in other sequenced lepidopteran mitochondrial genomes, which was presumed to be a remnant of trnM gene and its boundary sequences after the duplication of trnM to the upstream of trnI in Lepidoptera. The A + T-rich region is 836 bp, containing six repeat sequences of "TTATTATTATTATTAAATA(G)TTT."

Entities:  

Mesh:

Substances:

Year:  2011        PMID: 21670960      PMCID: PMC3271229          DOI: 10.1007/s11033-011-1049-y

Source DB:  PubMed          Journal:  Mol Biol Rep        ISSN: 0301-4851            Impact factor:   2.316


Introduction

The oriental fruit moth, Grapholita molesta (Busck) (Lepidoptera: Tortricidae), originated from East Asia, currently is one of the economically most destructive pest species of stone and pome fruits worldwide [1, 2]. G. molesta larvae bore in fruits, causing direct damage, or feed on twigs, causing shoot dieback. Management of this pest is mainly based on the use of the insecticides and pheromone-based mating disruption [3]. In addition to controlling methods, recently, ecological strategies and evolutionary patterns were studied, that might facilitate the managements of this pest. Molecular markers, i.e. amplified fragment length polymorphism (AFLP) and microsatellite (SSR) have been used to investigate the population genetic structure of G. molesta [4, 5], however, both are length-based markers from nuclear genome. Insect mitochondrial genomes are about 16 Kb in size with 37 genes, including 13 protein-coding genes, two ribosomal RNA genes (large and small ribosomal RNAs), and 22 tRNA genes [6]. Additionally, an A + T-rich region is present, functioning on the regulation of transcription and replication [7]. Mitochondrial genomes contain abundant molecular markers, such as sequences, gene arrangement patterns and RNA secondary structures, which were frequently used for studies of population genetics, species identification, and phylogeny at different hierarchical levels [8, 9]. Presently, twenty-six complete or nearly complete mitochondrial genomes sequences are available in GenBank for lepidopteran species. However, the number of sequenced lepidopteran mitochondrial genomes is very limited relative to the species-richness of Lepidoptera. In this study, we describe the complete mitochondrial genome sequence of the oriental fruit moth, G. molesta, and compare its features with other available lepidopteran mitochondrial genomes.

Materials and methods

Insects and DNA extraction

Grapholita molesta larvae were collected on the peach trees and kept in absolute alcohol at −80°. Total genomic DNA was extracted from individual larva using a DNeasy tissue kit (Qiagen, Hilden, Germany) following manufacturer protocols.

PCR amplification and sequencing

The G. molesta mitochondrial genome was amplified through nine overlapping fragments by PCR amplification using modified universal primers [10, 11] according to the determined lepidopteran mitochondrial genome sequences and specific primers designed in this study. PCRs were done using Takara LA Taq (Takara Biomedical, Japan) under the following conditions: initial denaturation for 2 min at 94° followed by 35 cycles of 10 s at 96°, 15 s at 45–55°, and 1–4 min at 60° and a subsequent final extension for 8 min at 60°. PCR components were added as recommended by Takara LA Taq, the manufacturer. PCR products were sequenced directly by primer walking from both directions after purification. Sequencing reactions were performed using a BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, USA) and run on an ABI 3730 capillary sequencer.

Genome annotation and secondary structure prediction

tRNA genes were initially identified using the tRNAscan-SE search server with default parameters [12]. Sequences longer than 100 bp between the identified tRNA genes were used as queries in Blast searches in GenBank for identification of protein-coding and rRNA genes. Nucleotide sequences of protein-coding gene were translated using the invertebrate mitochondrial genetic code. The exact initiation and termination codons were identified in ClustalX version 2.0 [13] using reference sequences from other insects. The stop codon of these genes was inferred to be the first in-frame stop codon or, when necessary to avoid overlap with the downstream gene, an abbreviated stop codon corresponding well to the stop codon of other insect genes. The secondary structure of large and small rRNAs (rrnL and rrnS) were derived from Drosophila melanogaster [14] and Drosophila virilis [15] with modifications made based on other predicted mitochondrial rRNA secondary structure [16]. Helix numbering follows the convention established at the CRW site [14] and Apis mellifera rRNA secondary structure [16] with minor modification. All structures were drawn in XRNA (developed by B. Weiser and available at http://rna.ucsc.edu/rnacenter/xrna/xrna.html). All tRNA secondary structures were predicted using the tRNAscan-SE search server except for trnS2, which was predicted manually according to that predicted in other insects.

Results and discussions

Genome structure and base composition

The complete mitochondrial genome of G. molesta is 15,776 bp long, containing 37 typical animal mitochondrial genes and an A + T-rich region (GenBank accession No. HQ116416). All gene are arranged as hypothesized ancestral gene order of insects except for trnM [17], which was shuffled from 3′ downstream of trnQ to 5′ upstream of trnI (Fig. 1). This arrangement pattern of trnM was presumed be an synapomorphic character in lepidopteran mitochondrial genomes [18, 19], however, the presently sequenced lepidopteran mitochondrial genomes used for comparative studies are all from the lineage of Ditrysia, representing limited group of Lepidoptera. Thus, more mitochondrial genomes are needed from other groups to prove the universality of trnM shuffling in this Order.
Fig. 1

Structure of Grapholita molesta mitochondrial genome. cox1, cox2, and cox3 refer to the cytochrome oxidase subunits, cob refers to cytochrome b, nad1–nad6 refer to NADH dehydrogenase components, and rrnL and rrnS refer to ribosomal RNAs. Transfer RNA genes are denoted by one letter symbol according to the IPUC-IUB single-letter amino acid codes. L1, L2, S1 and S2 denote tRNALeu(CUN), tRNALeu(UUR), tRNASer(AGY) and tRNASer(UCN), respectively. AT indicates A + T-rich region. Gene names with lines indicate that the genes are coded on the minority strand while those without lines are on the majority strand

Structure of Grapholita molesta mitochondrial genome. cox1, cox2, and cox3 refer to the cytochrome oxidase subunits, cob refers to cytochrome b, nad1–nad6 refer to NADH dehydrogenase components, and rrnL and rrnS refer to ribosomal RNAs. Transfer RNA genes are denoted by one letter symbol according to the IPUC-IUB single-letter amino acid codes. L1, L2, S1 and S2 denote tRNALeu(CUN), tRNALeu(UUR), tRNASer(AGY) and tRNASer(UCN), respectively. AT indicates A + T-rich region. Gene names with lines indicate that the genes are coded on the minority strand while those without lines are on the majority strand The entire mitochondrial genome of G. molesta is biased to use A and T, with an A + T content of 81.24%, as that of other insects. The AT skew for the majority strand is −0.064, while GC skew is −0.175, referring to the occurrence of more Ts than As and more Cs than Gs.

Protein-coding genes

All protein-coding genes start with ATN codons (one with ATA, three with ATT, one with ATC, and seven with ATG) except for cox1 (Table S1). In G. molesta mitochondrial genome, cox1 gene uses unusual CGA start codon, as that in all other sequenced lepidopteran mitochondrial genome. Annotated cox1 gene in G. molesta could be aligned well with its orthologous genes in other lepidopteran mitochondrial genome, confirmed the atypical start site of cox1 in Lepidoptera. Seven of 13 protein-coding genes in G. molesta harbor the usual termination codon TAA, but cox1, cox2, cob, nad2, nad4 and nad5 use the incomplete termination codon T (Table S1). The assignment of incomplete stop codon on these genes could avoid overlapping nucleotides between their adjacent genes. These incomplete stop codons are commonly found in metazoan mitochondrial genes [18, 20]. The relative synonymous codon usage was analyzed, indicating a biased usage of A and T nucleotides (Table S2). UUA(Leu), AUU(Ile), UUU(Phe), AUA(Met) were the most frequently used codons as in other insects [18, 21]. All protein-coding genes show more T than A, while genes coded on the majority strand show more C than G and genes coded on the minority strand show less C than G (Table S3). This is congruent with the observation of skew values in insect mitochondrial genomes [22].

rRNA structure

Both rRNA genes are present in G. molesta mitochondrial genome, located between trnL1 and trnV for rrnL and between trnV and the A + T-rich region for rrnS. The length of the rrnL is 1382 bp, and the length of rrnS is 775 bp. Both rrnL and rrnS conform to the secondary structure models proposed for these genes from other insects [20, 23, 24]. Forty-nine helices are present in G. molesta rrnL as in M. sexta [23], D. melanogaster [15] and A. mellifera [16], belonging to six domains (Fig. S1). The stem region of H991 was difficult to fold under the criteria of Watson–Crick pairs, and the structure of H991 with a large internal loop among H991, H1057 and H1087 is different from that of M. sexta. A 23 bp insertion was present in the loop region between H1664 and H1764 in M. sexta. In G. molesta, a microsatellite sequence of (TA)12 was inserted into the loop region of H2347. Alignment of the homologous regions in other sequenced lepidopteran mitochondrial genomes showed that similar microsatellite sequence of (TA)14 was also present in the stem region of H2347 in Spilonota lechriaspis [25] and Adoxophyes honmai (Lepidoptera: Tortricidae) [26] (Fig. 2), indicating that the insertion event in the region of H2347 in rrnL might be an synapomorphic character in family Tortricidae.
Fig. 2

Alignment of the homologous regions including Helix 2347 of rrnL in all sequenced lepidopteran mitochondrial genomes Sequences were downloaded from GenBank, and the accession numbers are as in Table 1

Alignment of the homologous regions including Helix 2347 of rrnL in all sequenced lepidopteran mitochondrial genomes Sequences were downloaded from GenBank, and the accession numbers are as in Table 1
Table 1

The intergenic sequences between trnQ and nad2 in all presently sequenced lepidopteran mitochondrial genomes

SpeciesLength (bp)SequenceGenBank accession no. and references
Teinopalpus aureus 65ATATAAATAATGAATTTTTAATTCAAATTTTATTCCCCCTATTTTAAATTTTTTTTAATATTAATHM563681
Spilonota lechriaspis 47ATTAAATGAATTTTCAATTCTAAAAGAAATTATTATTTCTATTTTATNC_014294 [25]
Saturnia boisduvalii 53ATTTTAAATAGAGAATTTCAAATTCTTTTTAATTTATTATTAAATTATTTTAAEF622227 [31]
Sasakia charonda 87ATTTTTATAATATGAATTTAATTATATGTACATATATACATATATAATATTCACTTAAGATTTATTTCTTTATTTTAAATTTTATTTNC_014224
Phthonandria atrilineata 63ATATTTATATAAAGAATTTATATTTCTATTAAATTATTATAATTATTTTATATATTATACCAANC_010522 [32]
Parnassius bremeri 70AAACTATTGTGCATCTTACACTAAAATATATTTATTGAATTTAAATAACAAAACTAACCCCCTATTTTAGNC_014053
Papilio maraho 47TGTAATTTTACACTGAATTTATAATTCAACTTAACCCCCATTTTTAANC_014055
Ostrinia nubilalis 62AATAAATTAAAATATAAATTTAATTTTATATAAAATATTTTTTATTTTAAATTTTTTCCCCTNC_003367 [33]
Ostrinia furnacalis 62AATAAATTAAAATATAAATTTAATTTTATATAAAATATTTTTTATTTTAAATTTTTTCCCCTNC_003368 [33]
Ochrogaster lunifer 72TTATTAATAAAAATATAAATTAATTATTTAGATTAAATTCTAATAAAAATTATTAAATTATAATTATTTTTANC_011128 [34]
Manduca sexta 54ATTTTATCAAATAGAAATCTTAATTTCTTAAATTACAATAAGTAATTATTTTATNC_010266 [23]
Lymantria dispar 47ATTATTTAATCAATGAATTTATAATTCACCAAATAATTTTATCTTAAFJ617240
Hyphantria cunea 50ATTTCTATAATAATGATCTTAAATTCATAATAATTTTTTTTTTATTTTAAGU592049 [18]
Eriogyna pyretorum 54ATTTTCTATAAAGAATTTATAATTCTTTCAAATTTATTCATTAAATTATTTTAAFJ685653 [35]
Diatraea saccharalis 55AATATTTATATTAATATATTTATAATATACTTATTAATTTAATTTTTTATTTTATFJ240227 [36]
Coreana raphaelis 56TTTTTAATTTAAAAAATAAACTTAAAATTTATTAATGAAATTTATTTCTTTTTTATNC_007976 [19]
Bombyx mori 65ATTTAAATAATTAAAATAAAGAATTTATAATTCTATTAAATATATTTATATTTTTTTTTATTTTANC_002355
Bombyx mandarina 48AATTTAAATAATTAAAATAAAGAATTTATAATTCTATTAAATATATTTAY301620 [37]
Bombyx mandarina 47ATTTAAATAATTAAAATAAAGAATTTATAATTCTATTAAATATATTTNC_003395 [38]
Artogeia melete 48TTTAAATAAATAGAACTTAAATTTCTTTTAAATTTTTTTTTATTTTAANC_010568 [39]
Antheraea yamamai 53ATTTTTTAATAAAGAATTGATAATTCTTAGAAATTTATTTATAATTATTTTTGEU726630 [40]
Antheraea pernyi 56ATTTTTCTTAATAAAGAATTGATAATTCTTAAAAATTTATTTAATAATTATTTTTANC_004622 [41]
Adoxophyes honmai 64TATTTTTAAAAAGAAATTTATAATTTCTAAAAGAATTTCATTTCTATTTTAAATTTTTTTTTATNC_008141 [26]
Acraea issoria 51ATTACCAAAATATGAATAAATTTCATTTTAGAATTATAATTCTTATTTTTANC_013604 [42]

Note: For unpublished mitochondrial genomes, only GenBank accession numbers are listed

The secondary structure of rrnS contains 29 helices present in Manduca sexta [23] and A. mellifera [16], belonging to three domains (Fig. 3). The structures of Helix H47, H673, H1047, H1241 and H1303 are different from those in M. sexta. H47 has a small loop in G. molesta compared to that in M. sexta. This region was variable within species [16, 23, 24], and has been used to predict the phylogenetic relationships among subfamilies of Braconidae (Insecta: Hymenoptera) combined with H39 and H367 [9]. H673 in G. molesta was more similar to that in some species of Hymenoptera [20, 24] and Diptera [15] than in species of Lepidoptera [23, 27]. The region of H673 is long, which could yields multiple possible secondary structures. The presently predicted structures of rRNA are mainly based on sequence comparison and mathematical methods, so it is not clear which structures are utilized in situ. The region composed of H1047, H1068, H1074 and H1113 in G. molesta was different in length especially in loop regions from that in M. sexta, indicating it is another variable region in rrnS within species [16, 23].
Fig. 3

Predicted rrnS secondary structure in Grapholita molesta mitochondrial genome. Tertiary interactions and base triples are shown connected by continuous lines. A 5′ half of rrnL; B 3′ half of rrnL. Base-pairing is indicated as follows: Watson–Crick pairs by lines, wobble GU pairs by dots and other noncanonical pairs by circles

Predicted rrnS secondary structure in Grapholita molesta mitochondrial genome. Tertiary interactions and base triples are shown connected by continuous lines. A 5′ half of rrnL; B 3′ half of rrnL. Base-pairing is indicated as follows: Watson–Crick pairs by lines, wobble GU pairs by dots and other noncanonical pairs by circles

tRNA structure

All of the 22 typical animal tRNA genes were present in G. molesta mitochondrial genome, ranging from 65 to 71 bp. All tRNA genes have a typical cloverleaf structure except for trnS2 (Fig. S2). The D-stem pairings in the DHU arm are absent in trnS2, which has also been reported in other insects [24], and is common in Coleoptera [28]. The structure of trnS2 could not be identified and folded using conventional tRNA search methods such as tRNAscan-SE. We found the location of trnS2 by comparisons with those identified in other insects and then determined the exact boundaries according to the secondary structure folded manually. The anticodons for all tRNA genes are identical to their counterparts in most other published insect mitochondrial genomes. In mitochondrial tRNA genes, noncanonical pairs were common in secondary structures. There are 16 wobble G–U pairs and four U–U pairs present in tRNA secondary structures in G. molesta.

Non-coding region

There are 14 non-coding regions ranging from 1 to 62 bp except for the A + T-rich region in G. molesta mitochondrial genome. A 62 bp intergenic sequence is present between trnQ and nad2, from where trnM was translocated to the upstream of trnI. In all other sequenced lepidopteran mitochondrial genomes, the same trnM rearrangement event occurred with a similar intergenic sequence ranging from 47 to 87 bp left in this region (Table 1). Additionally, the length of this intergenic sequence covers that of typical tRNA genes, thus, we presume that this region might be a remnant of trnM gene and its boundary sequences after the duplication of trnM to the upstream of trnI. The intergenic sequences between trnQ and nad2 in all presently sequenced lepidopteran mitochondrial genomes Note: For unpublished mitochondrial genomes, only GenBank accession numbers are listed Intergenic spacer region between trnS1 and nad1 may correspond to the binding site of mtTERM, a transcription attenuation factor [29], which was evidenced by a 7 bp motif (ATACTAA) conserved across Lepidoptera [23], 5 bp (TACTA) motif conserved across Coleoptera [28] and a 6 bp conserved motif (THACWW) in Hymenoptera [24]. The ATACTA motif is also present in G. molesta mitochondrial genome between trnS1 and nad1. The longest intergenic region in G. molesta is the A + T-rich region, between rrnS and trnM. The length of A + T-rich region is 836 bp, and the A + T content is 95.9%. This region usually contains replication origins in both vertebrates and invertebrates [7, 30]. The sequence of “TTATTATTATTATTAAATA(G)TTT” was repeated six times in the A + T-rich region in G. molesta. However, the set of elements that may function in the initiation of genome replication could not be identified [7]. Below is the link to the electronic supplementary material. Fig. S1 Predicted rrnL secondary structure in Grapholita molesta mitochondrial genome. Tertiary interactions and base triples are shown connected by continuous lines. a 5′ half of rrnL; b 3′ half of rrnL. Base-pairing is indicated as follows: Watson–Crick pairs by lines, wobble GU pairs by dots and other noncanonical pairs by circles. (PDF 394 kb) Fig S1b. (PDF 435 kb) Fig. S2 Predicted secondary structures for the 22 typical tRNA genes of Grapholita molesta mitochondrial genome. Symbols are as in Fig. S1 (PDF 700 kb) Supplementary material (DOC 131 kb)
  31 in total

1.  Significant levels of sequence divergence and gene rearrangements have occurred between the mitochondrial genomes of the wild mulberry silkmoth, Bombyx mandarina, and its close relative, the domesticated silkmoth, Bombyx mori.

Authors:  Kenji Yukuhiro; Hideki Sezutsu; Masanobu Itoh; Koichi Shimizu; Yutaka Banno
Journal:  Mol Biol Evol       Date:  2002-08       Impact factor: 16.240

2.  Species identification of aphids (Insecta: Hemiptera: Aphididae) through DNA barcodes.

Authors:  R G Foottit; H E L Maw; C D VON Dohlen; P D N Hebert
Journal:  Mol Ecol Resour       Date:  2008-11       Impact factor: 7.090

3.  tRNAscan-SE: a program for improved detection of transfer RNA genes in genomic sequence.

Authors:  T M Lowe; S R Eddy
Journal:  Nucleic Acids Res       Date:  1997-03-01       Impact factor: 16.971

4.  Oriental fruit moth (Lepidoptera: Tortricidae) phenology and management with methoxyfenozide in North Carolina apples.

Authors:  Daniel M Borchert; Ronald E Stinner; James F Walgenbach; George G Kennedy
Journal:  J Econ Entomol       Date:  2004-08       Impact factor: 2.381

5.  Comparative mitogenomics of Braconidae (Insecta: Hymenoptera) and the phylogenetic utility of mitochondrial genomes with special reference to Holometabolous insects.

Authors:  Shu-jun Wei; Min Shi; Michael J Sharkey; Cornelis van Achterberg; Xue-xin Chen
Journal:  BMC Genomics       Date:  2010-06-11       Impact factor: 3.969

6.  The complete mitochondrial genome of the yellow coaster, Acraea issoria (Lepidoptera: Nymphalidae: Heliconiinae: Acraeini): sequence, gene organization and a unique tRNA translocation event.

Authors:  Jing Hu; Daxiu Zhang; Jiasheng Hao; Dunyuan Huang; Stephen Cameron; Chaodong Zhu
Journal:  Mol Biol Rep       Date:  2009-11-29       Impact factor: 2.316

7.  The complete mitochondrial genome of the tobacco hornworm, Manduca sexta, (Insecta: Lepidoptera: Sphingidae), and an examination of mitochondrial gene variability within butterflies and moths.

Authors:  Stephen L Cameron; Michael F Whiting
Journal:  Gene       Date:  2007-12-11       Impact factor: 3.688

8.  The complete mitogenome and phylogenetic analysis of Bombyx mandarina strain Qingzhou.

Authors:  Xiao-long Hu; Guang-li Cao; Ren-yu Xue; Xiao-jian Zheng; Xing Zhang; Hai-rong Duan; Cheng-liang Gong
Journal:  Mol Biol Rep       Date:  2009-08-30       Impact factor: 2.316

9.  The complete mitochondrial genome of Evania appendigaster (Hymenoptera: Evaniidae) has low A+T content and a long intergenic spacer between atp8 and atp6.

Authors:  Shu-jun Wei; Pu Tang; Li-hua Zheng; Min Shi; Xue-xin Chen
Journal:  Mol Biol Rep       Date:  2009-08-05       Impact factor: 2.316

10.  A comparative analysis of mitochondrial genomes in Coleoptera (Arthropoda: Insecta) and genome descriptions of six new beetles.

Authors:  N C Sheffield; H Song; S L Cameron; M F Whiting
Journal:  Mol Biol Evol       Date:  2008-09-08       Impact factor: 16.240

View more
  17 in total

1.  The complete mitochondrial genome of Leucoptera malifoliella Costa (Lepidoptera: Lyonetiidae).

Authors:  Yu-Peng Wu; Jin-Liang Zhao; Tian-Juan Su; Jie Li; Fang Yu; Douglas Chesters; Ren-Jun Fan; Ming-Chang Chen; Chun-Sheng Wu; Chao-Dong Zhu
Journal:  DNA Cell Biol       Date:  2012-08-02       Impact factor: 3.311

2.  The complete mitochondrial genomes of two ghost moths, Thitarodes renzhiensis and Thitarodes yunnanensis: the ancestral gene arrangement in Lepidoptera.

Authors:  Yong-Qiang Cao; Chuan Ma; Ji-Yue Chen; Da-Rong Yang
Journal:  BMC Genomics       Date:  2012-06-22       Impact factor: 3.969

3.  Characterization of the complete mitochondrial genomes of Cnaphalocrocis medinalis and Chilo suppressalis (Lepidoptera: Pyralidae).

Authors:  Huan-Na Chai; Yu-Zhou Du; Bao-Ping Zhai
Journal:  Int J Biol Sci       Date:  2012-04-17       Impact factor: 6.580

4.  The complete mitochondrial genome of Rondotia menciana (Lepidoptera: Bombycidae).

Authors:  Weiqing Kong; Jinhong Yang
Journal:  J Insect Sci       Date:  2015-04-16       Impact factor: 1.857

5.  Complete mitochondrial genome of Clistocoeloma sinensis (Brachyura: Grapsoidea): Gene rearrangements and higher-level phylogeny of the Brachyura.

Authors:  Zhao-Zhe Xin; Yu Liu; Dai-Zhen Zhang; Xin-Yue Chai; Zheng-Fei Wang; Hua-Bin Zhang; Chun-Lin Zhou; Bo-Ping Tang; Qiu-Ning Liu
Journal:  Sci Rep       Date:  2017-06-23       Impact factor: 4.379

6.  Transcriptome Analysis and Identification of Major Detoxification Gene Families and Insecticide Targets in Grapholita Molesta (Busck) (Lepidoptera: Tortricidae).

Authors:  Yanqiong Guo; Yanping Chai; Lijun Zhang; Zhiguo Zhao; Ling-Ling Gao; Ruiyan Ma
Journal:  J Insect Sci       Date:  2017-01-01       Impact factor: 1.857

7.  The complete mitochondrial genome of the pink stem borer, Sesamia inferens, in comparison with four other Noctuid moths.

Authors:  Huan-Na Chai; Yu-Zhou Du
Journal:  Int J Mol Sci       Date:  2012-08-16       Impact factor: 6.208

8.  The Complete Mitochondrial Genome of Ctenoptilum vasava (Lepidoptera: Hesperiidae: Pyrginae) and Its Phylogenetic Implication.

Authors:  Jiasheng Hao; Qianqian Sun; Huabin Zhao; Xiaoyan Sun; Yonghua Gai; Qun Yang
Journal:  Comp Funct Genomics       Date:  2012-04-05

9.  The Complete Mitochondrial Genome of Brachmia macroscopa (Lepidoptera: Gelechiidae) and Its Related Phylogenetic Analysis.

Authors:  Li Ma; Wan-Wei Dong; Guo-Fang Jiang; Xing Wang
Journal:  J Insect Sci       Date:  2016-01-25       Impact factor: 1.857

10.  The complete mitochondrial genome of the Chinese Daphnia pulex (Cladocera, Daphniidae).

Authors:  Xuexia Geng; Ruixue Cheng; Tianyi Xiang; Bin Deng; Yaling Wang; Daogui Deng; Haijun Zhang
Journal:  Zookeys       Date:  2016-09-07       Impact factor: 1.546

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.