Literature DB >> 31963721

Molecular Alterations in the Stomach of Tff1-Deficient Mice: Early Steps in Antral Carcinogenesis.

Eva B Znalesniak1, Franz Salm1, Werner Hoffmann1.   

Abstract

TFF1 is a pepn>tide of the gastric mucosa co-secreted with the mucin MUC5AC. It plays a key role in gastric mucosal protection and repair. Tff1-deficient (Tff1KO) mice obligatorily develop antropyloric adenoma and about 30% progress to carcinomas. Thus, these mice represent a model for gastric tumorigenesis. Here, we compared the expression of selected genes in Tff1KO mice and the corresponding wild-type animals (RT-PCR analyses). Furthermore, we systematically investigated the different molecular forms of Tff1 and its heterodimer partner gastrokine-2 (Gkn2) in the stomach (Western blot analyses). As a hallmark, a large portion of murine Tff1 occurs in a monomeric form. This is unexpected because of its odd number of seven cysteine residues. Probably the three conserved acid amino acid residues (EEE) flanking the 7th cysteine residue allow monomeric secretion. As a consequence, the free thiol of monomeric Tff1 could have a protective scavenger function, e.g., for reactive oxygen/nitrogen species. Furthermore, a minor subset of Tff1 forms a disulfide-linked heterodimer with IgG Fc binding protein (Fcgbp). Of special note, in Tff1KO animals a homodimeric form of Gkn2 was observed. In addition, Tff1KO animals showed strongly reduced Tff2 transcript and protein levels, which might explain their increased sensitivity to Helicobacter pylori infection.

Entities:  

Keywords:  FCGBP; ROS; TFF1; TFF2; carcinogenesis; gastric cancer; inflammation; innate immunity; oxidative stress; trefoil factor

Year:  2020        PMID: 31963721      PMCID: PMC7014203          DOI: 10.3390/ijms21020644

Source DB:  PubMed          Journal:  Int J Mol Sci        ISSN: 1422-0067            Impact factor:   5.923


1. Introduction

TFF1, a member of the trefoil factor family (TFF), is a typn>ical secretory pepn>tide of gastric surface mucous cells, where it is synthesized together with the mucin MUC5AC [1,2,3,4,5]. Human TFF1 consists of 60 amino acid residues including seven cysteine residues. This odd number allows disulfide-linked heterodimerization with gastrokine-2 (GKN2), which is also a secretory product of surface mucous cells [6,7]. In the human stomach, also relatively low amounts of TFF1 monomers and homodimers were described [8]. The TFF1 content in gastric juice has been reported to 70 ng/mL [1]. Originally, TFF1 (previous name: pS2) was discovered in breast cancer cells and it is considered as a positive prognostic factor [3]. TFF1 is ectopically expressed in a variety of tumors as well as in inflammatory disorders [3,4]. Generally, TFF1, like the other TFF peptides, appears to play an important role in mucosal protection and repair, and thus has therapeutic potential and clinical perspectives [9]. Inactivation of Tff1 in n>an class="Species">mice (Tff1) clearly revealed a characteristic gastric phenotype [10]. All Tff1 mice developed antropyloric adenoma and about 30% progressed to carcinomas [10]. Thus, these mice represent a recognized model for gastric tumorigenesis because the loss of TFF1 expression is one of the most frequent molecular alterations in human gastric carcinogenesis [11,12,13]. The multi-step carcinogenesis cascade is associated with NF-κB-mediated inflammation [14]. For example, the pro-inflammatory genes Cxcl1 and Cxcl5 were upregulated [14]. The selective Cox-2 inhibitor celecoxib strongly reduced the development of gastric dysplasia and induced ulceration and inflammation of the adenoma suppressing tumor growth [11,14,15]. Thus, TFF1 appears to function as a gastric tumor suppressor [11]. This is in line with reports that Tff1 mice are particularly susceptible to chemically induced tumorigenesis [16,17]. However, the precise molecular function of TFF1 as a tumor suppressor has not been elucidated thus far. Furthermore, TFF1 gain- and loss-of-function expn>eriments showed that n>an class="Gene">TFF1 promotes cell migration and invasion of cells indicating that TFF1 is a motogenic (chemotactic) factor [3,4,16,18,19]. This motogenic effect is supported by an anti-apoptotic function [20]. Thus, both activities would be well suited to synergistically enhance rapid repair of damaged mucous epithelia by restitution [21,22]. For example, in different animal models of intestinal damage, Tff1 appeared to have a protective role either when overexpressed in transgenic mice or when delivered by genetically modified Lactococcus lactis [23,24]. Furthermore, a formulation of L. lactis secreting TFF1 has also been used to treat radiation-induced oral mucositis in an animal model [25]. This is a promising step towards further clinical applications, e.g., for treating cancer patients receiving chemotherapy [9]. However, the motogenic effects of TFF peptides generally appear to be rather weak (effective in a concentration range of about 10−6 to 10−7 M; [18]). Generally, in Tff1 animals the differentiation of the gastric mucosa from stem and precursor cells is dysregulated [11]. Antral pits are hypertrophic and these cells are almost devoid of mucus [10,11]. Additionally, the differentiation of fundic pit and parietal cells as well as antral gland cells is dysregulated [26,27]. In the past, homodimeric TFF1 has also been demonstrated to act as a lectin, e.g., it interacts with a lipopolysaccharide of Helicobacter pylori in a pH-dependent manner [28]. Thus, TFF1 may have a role in mediating the tropism of H. pylori within the gastric mucus [29]. Here, we compared the expression of selected genes in Tff1 mice and wild-type animals at the age of 20 weeks. At that time, the first foci of carcinoma develop in about 30% of the Tff1 mice [10]. Furthermore, for the first time, we systematically investigated the different molecular forms of Tff1 and its heterodimeric binding partner Gkn2. In addition, also Tff2 and Fcgbp were examined on the protein level. This is a further step in order to understand the molecular function of Tff1, in particular as a tumor suppressor.

2. Results

2.1. Transcriptional Alterations in Tff1KO and Wild-Type Animals (RT-PCR Analyses)

Relative gene expression levels were investigated in the gastric corpn>us and antrum of n>an class="Gene">Tff1 and wild-type mice. Figure 1 represents mainly a selection of genes, which showed significant differences between wild-type and Tff1 mice or between the corpus and the antrum. For example, the expression of genes was monitored, which encode typical secretory proteins of gastric mucous cells, such as Tff1-3, gastrokines (Gkn1-3), Fcgbp, mucins (Muc5ac, Muc6), and disulfide isomerases (Pdia3, Agr2). Additionally, markers for the gastric antrum (gastrin: Gast; transcription factor Pdx1), a marker for the differentiation of the mucous neck cell-zymogenic cell lineage (Mist1), the stem cell markers Troy and gastrin CCK-B receptor (Cckbr), and a marker for the gastric corpus (Irx3) are shown. Furthermore, expression of the ependymin related protein 1 (Epdr1) was monitored. For comparison and as controls, Cxcl1 and Cxcl5 were also included [14].
Figure 1

Semi-quantitative RT-PCR analyses. Tff1 (21x), Tff2 (20x), Tff3 (30x), Gkn1 (21x), Gkn2 (22x), Gkn3 (24x), Fcgbp (31x), Muc5ac (25x), Muc6 (27x), Pdia3 (25x), Agr2 (24x), Gast (26x), Pdx1 (33x), Mist1 (35x), Troy (35x), Cckbr (33x), Irx3 (35x), Epdr1 (33x), Cxcl1 (32x), and Cxcl5 (32x) expression was monitored in the corpus and antrum of 10 male wild-type (WT) and 10 male Tff1 mice. The relative gene expression levels were normalized against β-actin (Actb, 24x). The number of amplification cycles is given in parentheses. Significances are indicated by asterisks (*, p ≤ 0.05; **, p ≤ 0.01; ***, p ≤ 0.001). WT animals: black bars; Tff1 animals: white bars.

As a hallmark, Tff1 animals showed a reduced Tff2 expression particularly in the corpus, when compared with the wild-type animals. Additionally, Tff3 expression is significantly reduced in Tff1 animals. Both, Gkn3 and Fcgbp expression are significantly higher in the antrum when compared with the corpus; in the antrum of Tff1 animals, Gkn3 is significantly elevated, whereas Fcgbp is significantly reduced when compared with the wild-type. Furthermore, the transcript levels of both disulfide isomerase genes Pdia3 and Agr2 were significantly higher in the Tff1 animals. In contrast, gastrin (Gast) expression was significantly downregulated in the antrum of Tff1 mice. Of note, the expression of Mist1, Cckbr, Irx3 as well as that of Cxcl1 and Cxcl5 was significantly elevated in the antrum of Tff1 animals. Epdr1 expression was significantly reduced in the corpus of Tff1 animals.

2.2. Tff1KO and Wild-Type Animals Differ in Their Gkn2 Protein Forms (Western Blot Analyses)

Since human TFF1 has been reported to form a heterodimer with GKN2 [6,7], we analyzed the Tff1 and Gkn2 protein levels in more detail. Clearly, Tff1 was present in wild-type animals only; whereas Gkn2 was detectable in both wild-type and Tff1 animals (Figure 2A). A semi-quantitative analysis showed that the total Gkn2 level is significantly lowered in both the corpus and the antrum of Tff1 animals (Figure 2B).
Figure 2

Western blot analyses of gastric corpus and antrum extracts of wild-type (WT) and Tff1 animals. (A) Extracts of two male animals of each group were separated on a 15% SDS-PAGE under reducing conditions, and analyzed for Gkn2 and Tff1, respectively. Left: molecular mass standard. Loading control: reactivity for ß-actin (Actb). (B) Semi-quantitative analysis of the relative Gkn2 content (10 male animals per group). (C) Analysis of the same samples as in (A), but under non-reducing conditions. Marked are the positions of the Gkn2 homodimer ((Gkn2)2; indicated by an asterisk), the Tff1-Gkn2 heterodimer, the Gkn2 monomer, possible Tff1-X homo/heterodimers (indicated by asterisks), and the Tff1 monomer. (D) Semi-quantitative analysis of relative monomeric Gkn2, heterodimeric Tff1-Gkn2, and homodimeric (Gkn2)2 contents, respectively (10 male animals per group). (E) Left: Non-reducing SDS-PAGE (Coomassie-stained) of antral extracts pooled from three female WT and three female Tff1 animals (55 µg protein per lane) and elution of the regions 1 and 2; M, molecular mass standard. Right: Reducing Western blot analysis of the eluates concerning Gkn2. (F) Left: Non-reducing SDS-PAGE (Coomassie-stained) of a corpus extract of a single male WT mouse and elution of the regions 1–3. Right: Reducing Western blot analysis of the eluates concerning Tff1. Significances are indicated by asterisks (*, p ≤ 0.05; **, p ≤ 0.01; ***, p ≤ 0.001). WT animals: black bars; Tff1 animals: white bars.

Under non-reducing conditions, both monomeric Tff1 as well as monomeric n>an class="Gene">Gkn2 were detected (Figure 2C). The amount of monomeric Gkn2 is comparable in wild-type and Tff1 animals (Figure 2D). Furthermore, also the Tff1-Gkn2 heterodimer was clearly detectable in wild-type animals with both antisera against Tff1 and Gkn2, respectively (Figure 2C). As expected, the Tff1-Gkn2 heterodimer is missing in Tff1 animals (Figure 2C,D). In return, in the Tff1 animals a weak 37k-Gkn2-band was detected, particularly in the antrum (indicated by an asterisk in Figure 2C). This band is expected to represent homodimeric Gkn2 and is significantly elevated in both the corpus and antrum of Tff1 animals (Figure 2D). The specificity of this 37k-band was confirmed by elution from a non-reducing gel (region 2) followed by Western blot analysis after reducing SDS-PAGE (Figure 2E). Clearly, the 37k-band was shifted to monomeric Gkn2 in the Tff1 animals only (Figure 2E). For comparison, also region 1 containing the Tff1-Gkn2 heterodimer was eluted and analyzed under reducing conditions. As expected, Tff1-Gkn2 was shifted to monomeric Gkn2 in the wild-type animals only (Figure 2E). Thus, Tff1 and wild-type animals differ characteristically in their Gkn2 forms. Under non-reducing conditions, multiple forms of Tff1 were detected in wild-type animals, i.e., the Tff1-Gkn2 heterodimer, the monomeric Tff1, and at least two weak bands between (16-20k region; Tff1-X; indicated by asterisks in Figure 2C). In order to test if the signals in the 16-20k region are specific, this region (region 2) as well as monomeric Tff1 (region 1) and Tff1-Gkn2 (region 3) were eluted from a non-reducing gel followed by Western blot analysis under reducing conditions (Figure 2F). Clearly, monomeric Tff1 was detected in all three regions analyzed indicating that also the 16-20k region contained a dimeric Tff1 form. In addition, region 1 also contained a shortened Tff1 form.

2.3. Tff1 Is Capable of Forming a Heteromer with Fcgbp, Particularly in the Gastric Antrum

In the past, in both the human intestine and saliva TFF3 has been found to form a disulfide-linked heterodimer with FCGBP [30,31]. As TFF1 and FCGBP are both secretory products of gastric surface mucous cells and the overall structure of TFF1 and TFF3 is very similar including the occurrence of seven cysteine residues, we tested whether Tff1 forms a complex with Fcgbp in the murine stomach. As shown in Figure 3, in the murine antrum little Tff1 was traceable also in a high-molecular-mass form; whereas the bulk of Tff1 mainly appeared in the low-molecular-mass region. This high-molecular-mass band was detectable in the same region as Fcgbp, which was again present in the antrum only. As a control, Fcgbp was demonstrated in the colon with a comparable molecular mass. This indicates that part of gastric Tff1 forms a heteromer with Fcgbp. Furthermore, the Fcgbp level was reduced in the antrum of Tff1 animals when compared with the wild-type.
Figure 3

Western blot analyses of gastric corpus and antrum extracts of female wild-type (WT) and female Tff1 animals. Extracts of two animals per group were separated by 1% agarose gel electrophoresis. Shown are the reactivities for Tff1 and Fcgbp, respectively. As a positive control for Fcgbp, two murine colon extracts were analyzed (C1, C2). The start and the dye bromophenol blue (BPB) are marked on the left.

2.4. Tff1KO Mice Show Strongly Reduced Tff2 Levels

As the Tff2 transcripn>t level is diminished in Tff1 animals, particularly in the corpus (Figure 1), we analyzed the Tff2 content also at the protein level (Figure 4). Western blot analysis clearly revealed that in wild-type animals the Tff2 level is much higher in the antrum when compared with the corpus (Figure 4A,B). Furthermore, in Tff1 animals the Tff2 protein level was significantly lower when compared with the wild-type animals (Figure 4B).
Figure 4

Western blot analyses of gastric corpus and antrum extracts of wild-type (WT) and Tff1 animals. (A) Extracts of three male animals per group were separated on a 15% SDS-PAGE under reducing conditions and analyzed for their Tff2 reactivity. Left: molecular mass standard. Loading control: reactivity for ß-actin (Actb). (B) Semi-quantitative analysis of the relative Tff2 content (10 male animals per group). Significances are indicated by asterisks (***, p ≤ 0.001). WT animals: black bars; Tff1 animals: white bars. (C) Analysis of the same samples as in (A), but under non-reducing conditions (post-in-gel reduction). (D) Left: Non-reducing SDS-PAGE (Coomassie-stained) of an antral extract of a single male WT animal (75 µg) followed by elution of the high-(H) and low-molecular mass regions (L1, L2). Additionally, the remaining high-molecular-mass samples not entering the gel were removed from the gel pockets (P). Right: Western blot analysis (reducing conditions) concerning Tff2 of L1, L2, H, P, and an antral extract as a control (c) and semi-quantitative analysis of the relative Tff2 content (six male WT animals; 60–75 µg/lane).

Of note, under non-reducing conditions Tff2 apn>peared as three bands, i.e., the regular 14k monomeric band and two additional bands (about 16k, 17k; Figure 4C). The spn>ecificity of the 16k/17k-double band (region L2) was confirmed by elution from a non-reducing gel followed by Western blot analysis after reducing n>an class="Chemical">SDS-PAGE (Figure 4D). As a control, also the regular 14k band (region L1) was analyzed accordingly. Clearly, the 16k/17K-double band (region L2) shifted to monomeric Tff2 indicating that these entities represent indeed other forms of Tff2. The Tff2 content in both regions L1 and L2 is comparable (Figure 4D). In addition, the Tff2 content of the high-molecular-mass region as well as the gel pocket was determined; both did not contain significant amounts of Tff2 (Figure 4D).

3. Discussion

3.1. Transcriptional Alterations in Tff1KO Animals Are Indicative for Pre-Neoplastic Changes in the Antrum

The gastric mucosae in the corpn>us and antrum differ not only in their architecture, but also their continuous self-renewal occurs from different sets of stem cells [32]. Expn>ression profiling with the gastric antral markers Pdx1 and Gast clearly revealed that corpus and antrum samples were collected properly. In contrast, Troy expression is significantly higher in the corpus, which is in line with the observation that Troy stem cells are located at the base of fundic units [32]. Of special note, gastrin expression in the antrum of Tff1 mice is significantly reduced. This agrees with a recent report that gastrin is among the top downregulated genes in antral low-grade dysplasia in Tff1 animals [13]. Thus, this downregulation of gastrin might be an additional factor supporting antral carcinogenesis because Gast mice are known to develop antral tumors; in contrast, increased gastrin levels promote corpus carcinogenesis [33]. Gkn3, in contrast to n>an class="Gene">Gkn1 and Gkn2, is mainly expressed in the antrum. This is in line with a previous report [34]. Gkn3 is known to be mainly co-expressed with Tff2 and Muc6 in antral glands, and little Gkn3 is expressed in a subpopulation of mucus neck cells in the corpus [34,35]. In Tff1 animals, Gkn3 expression is significantly upregulated in the antrum; whereas Gkn1 and Gkn2 expression is not altered in these animals. This might be a sign for beginning tumorigenesis because a characteristic Gkn3 upregulation has been reported in a murine antral tumorigenesis model (gp130) [35]. Thus, the specific upregulation of Gkn3 expression in the antrum of Tff1 mice could reflect the amplification of the proliferating gland progenitor cells observed in these animals [27]. These proliferating progenitors probably become the invasive cells of the gastric adenocarcinomas [27]. Expression of Cxcl1 and Cxcl5 is significantly increased in the antrum of Tff1 animals, but not in the corpus. This is in agreement with a previous report indicating that loss of Tff1 is associated with activation of NF-κB-mediated inflammation [14]. Furthermore, expression of the transcription factor Mist1 is significantly increased in the antrum of n>an class="Gene">Tff1 animals. This is most interesting because Mist1 is a marker for the differentiation of chief cells and for a discrete population of stem cells in fundic units on the one hand and long-lived precursor cells in antral units on the other hand [36]. The latter are located at the position +5 within a Cxcl12(Sdf1)/Cxcr4 perivascular niche and they have been shown to be capable of acting as an origin of antral tumors [36]. Thus, the increased expression of Mist1 in Tff1 animals specifically in the antrum might be a sign for the expansion of these precursor cells, which is an early step during antral carcinogenesis [36]. Deletion of Cxcl12 in endothelial cells or pharmacological blockage of Cxcr4 is known to inhibit antral tumor growth [36]. Thus, it would be highly interesting to test whether AMD3100, a specific inhibitor of CXCR4, would also reduce the number and/or size of the antral tumors in Tff1 animals. Expression of the gastrin recepn>tor n>an class="Gene">Cckbr mainly occurs in enterochromaffine-like (ECL) and parietal cells of the gastric corpus, but also in a long-lived stem cell population at position +4 in the gastric antrum [37]. The significantly upregulated expression of Cckbr specifically in the antrum of Tff1 animals might be an indication for first neoplastic changes. Irx3 (together with n>an class="Gene">Irx2 and Irx5) has been described as a transcription factor typical of the embryonic gastric fundus [38]. Thus, the predominant expression in the corpus of wild-type animals might be expected. However, the significantly upregulated expression of Irx3 in the antrum of Tff1 animals is surprising and could be a sign for neoplastic changes. Additionally, expression of ependymin-related protein 1 (Epdr1; previously termed Merp2) was monitored, because it was downregulated in a murine asthma model; whereas Tff1 was upregulated in this model [39]. Thus, it was tested whether Epdr1 expression was related to an inflammatory process in the stomach of Tff1 mice. However, in Tff1 animals Epdr1 is significantly downregulated in the corpus only. The reason for this is not clear currently because NF-κB-mediated inflammation is detectable in the antrum, but not the corpus, as shown by increased Cxcl1 and Cxcl5 expression.

3.2. A Large Portion of Murine Tff1 Occurs in a Monomeric Form: A Possible Protective Role

In wild-type animals, a relatively large portion of Tff1 is present as a monomer (Figure 2C). In contrast, a homodimeric form of n>an class="Gene">Tff1 (expected to be in the 18–24k range [30]) is hardly detectable (asterisk in Figure 2C). Thus, we eluted the corresponding region 2 (16–24k) and could indeed detect significant amounts of Tff1 (Figure 2F). This is indicative that in region 2 probably homodimeric Tff1 is present and maybe also another heterodimeric Tff1-X form with an unknown partner protein (the two bands are indicated by asterisks in Figure 2C). Furthermore, when monomeric Tff1 (region 1) was eluted and analyzed again, a double band was detected (Figure 2F). Thus, Tff1 also exists in a shortened form maybe similar as shown for human TFF3 recently [31]. This shortened form is also visible in Figure 2A. Theoretically, this form could originate from alternative cleavage sites by signal peptidase. From cDNA cloning, an unusual N-terminal sequence was predicted for Tff1 (QAQAQAQAQEE), which would allow multiple cleavages by signal peptidase and cyclisation of an N-terminal Gln residue [2]. The robust occurrence of monomeric Tff1 is unusual because n>an class="Gene">Tff1 contains an odd number of seven cysteine residues, which should form disulfide-linked homo- or heterodimers. Generally, the oxidation machinery of the endoplasmic reticulum enforces disulfide bond formation [40]; whereas exposed unpaired thiols act as intracellular retention signals for unassembled secretory proteins, which are then subject to degradation [41]. However, there are proteins known, which are secreted in spite of an unpaired cysteine residue, such as Ig light chains [41]. Here, a flanking acidic residue masks the retention signal and allows transport to the Golgi [41]. Such a case probably also occurs in murine Tff1 where the C-terminal 7th Cys residue is flanked upstream by even three glutamic acid residues [2]. The negative charges of the flanking glutamic acid residues might be the reason why probably little homodimerization of Tff1 was observed (Figure 2C). Furthermore, also human TFF1 when produced in Pichia pastoris was secreted as a monomer [42] as well as the Xenopus laevis ortholog of TFF1, i.e., xP1, occurs as a monomer [43]. In both, human TFF1 and frog xP1 the 7th cysteine residue is flanked by four or a single glutamic acid residue, respectively [44,45]. Thus, the occurrence of acid amino acid residues flanking the 7th cysteine residue and the secretion as a monomer seem to be evolutionary conserved features of TFF1/Tff1/xP1. These flanking acid residues would also explain why the intermolecular disulfide bridge in human recombinant TFF1 dimer (through Cys-58) is more susceptible to reduction than the intramolecular disulfide bridges [46]. Of note, the cluster of acid amino acid residues was reported to bind Cu2+ in vitro [47]. The question arises on the molecular function of this unpaired 7th cysteine residue in monomeric n>an class="Gene">Tff1. A plausible hypothesis would be that this 7th cysteine residue could have a scavenger function, e.g., for extracellular reactive oxygen/nitrogen species (ROS/RNS). Generally, such modifications preferentially occur on a subset of reactive cysteine residues [48]. Activation of these cysteine residues occurs via flanking amino acid residues, which change the pKa favoring the existence of thiolate anions [48,49,50]. The cluster of three flanking acid residues is highly unusual and is present only in TFF1/Tff1 [3]. The apical surface of gastric epithelial cells is well known to be target for great oxidative stress because, e.g., of the release of extracellular ROS by dual oxidase (DUOX) particularly during bacterial infections and chronic inflammatory diseases [51,52]. Thus, effective protection of the gastric surface is essential to prevent stomach disorders [53]. Monomeric Tff1 would be perfectly designed to fulfill such a protective function and its loss could well explain the occurrence of adenomas in the antrum of Tff1 animals because the antrum is the preferred region for bacterial colonization, e.g., H. pylori [54]; whereas the fundic region is mainly protected from infection by its acidic pH. For the future, it would be interesting to test the ROS/RNS scavenger hypothesis for Tff1 experimentally. For example, it could be investigated whether oral application of short synthetic peptides mimicking the activated 7th cysteine residue of Tff1 could prevent carcinogenesis in Tff1 animals and whether this is superior when compared with N-acetylcysteine. A ROS/RNS scavenger function of Tff1 would also explain why certain probiotics have beneficial effects on their hosts. For example, the probiotic mixture VSL#3 has been shown to raise the production of Tff1 and Tff2 in mice [55]. Furthermore, a role for Tff1 as a scavenger for ROS/RNS could also be the reason why Tff1 is ectopically expressed during various inflammatory conditions in mice, such as encephalitis, asthma, pancreatitis, and in the murine spleen after Toxoplasma gondii infection [39,56,57,58]. Here, the reactive thiol of Tff1 could protect the tissue from damage by the oxidative burst. In addition, the unpaired 7th cysteine residue in Tff1 might also have a transient function for the correct intracellular folding of the mucin Muc5ac, which is synthesized and secreted by just the same cells. Such a function during the secretory pathway would explain why in antropyloric tumors of Tff1 animals the unfolded protein response is activated [59]. Remarkably, the expression of the disulfide isomerases Pdia3 and Agr2 is significantly upregulated in Tff1 animals (Figure 1), which might be a further indication for a folding function of Tff1 (and possibly also of Tff2).

3.3. Tff1 Forms a Complex with Fcgbp in the Antrum

Here, we report for the first time that minor amounts of Tff1 can serve as a heteropn>artner for Fcgbp (Figure 3). This result is in agreement with the observation that Fcgbp is mainly expressed in the antrum (Figure 1 and Figure 3). A similar observation has been reported for the human stomach, where FCGBP is mainly expressed in surface mucous cells of the antrum together with TFF1 [60]. Consequently, our results imply that the expression profiles of surface mucous cells in the murine corpus and antrum differ, just as has been documented for human [60]. One reason might be that the antrum is the preferred site for bacterial infection [54]. This is in line with the observation that FCGBP is the highest upregulated early defense gene in fish skin after microbial infection [61]. The formation of a Tff1-Fcgbp heterodimer in the gastric mucosa is not really surprising because the overall structures of Tff1 and Tff3 are similar; the latter is already known to form disulfide-linked TFF3-FCGBP heterodimers in the human intestine and saliva [30,31]. The molecular functions of Fcgbp and the n>an class="Gene">Tff1-Fcgbp heterodimer are not understood thus far. Generally, FCGBP is considered as a component of the first line innate immune defense, e.g., it is a typical early response gene after microbial infection probably regulating pathogen attachment and disease progression at mucosal surfaces [61,62] including a viral trap for HIV-antibody complexes [63]. FCGBP is ubiquitous in vertebrates and cephalochordates [64]. Of note, even a number of bacterial proteins have N-terminal domains homologous to the N-terminal domain of FCGBP [64]. The modular structure of FCGBP (cysteine-rich domains) could well support a function for the clearing of microorganisms. This would also explain why Fcgbp is mainly expressed in the antrum (Figure 1 and Figure 3) because here bacterial colonization preferentially occurs [54]. The heterodimerization with Tff1 could synergistically support the binding of bacteria by Fcgbp, in particular by its known lectin activity [28]. Furthermore, FCGBP has also been reported to be part of a net-like scaffold within mucosal barriers [65].

3.4. Tff1KO and Wild-Type Mice Synthesize Different Gkn2 Forms, Particularly in the Antrum

In wild-type animals, relatively large proportions of Gkn2 exist as a n>an class="Gene">Tff1-Gkn2 heterodimer (Figure 2C) and the remaining Gkn2 appears as a monomer (Figure 2C). Heterodimeric interaction between TFF1 and GKN2 has been reported to entail synergistic anti-proliferative and pro-apoptotic effects on gastric cancer cells [66]. A hallmark of Tff1 animals is the formation of a 37k-Gkn2 entity, probably a Gkn2 homodimer (asterisk in Figure 2C). This form is particularly present in the antrum and is nearly missing in wild-type animals (Figure 2D). The existence of this Gkn2 form is highly interesting because it is a primary consequence of the Tff1 deficiency. Generally, GKN2 is downregulated in gastric cancers and has anti-inflammatory and tumor suppressor roles [35,67,68]. Currently, the biological function of GKN2 is not known and it is also a matter of speculation how GKN2 exerts a biological activity. GKN2 might be a ligand for a receptor, either as a classical peptide ligand or a lectin. Such a hypothesis might be supported by a report that a synthetic peptide corresponding to the 21 C-terminal amino acid residues of the related peptide GKN1 has relatively weak mitogenic and motogenic properties [69]. Additionally, anti-proliferative activities have been reported for GKN1 [35]. Of note, GKN1 is not expected to form disulfide-linked dimers because it contains an even number of cysteine residues. Thus, it cannot be excluded that the 37k-form of Gkn2 has different biological effects when compared with the Tff1-Gkn2 heterodimer and this might influence the inflammatory process particularly in the antrum.

3.5. Tff1KO Mice Show Strongly Reduced Tff2 Levels

In wild-type animals, the Tff2 protein level is much higher in the antrum when compn>ared with the corpn>us (Figure 4B). This is in line with its expn>ression in mucous neck and antral gland cells, the latter being more numerous. On the transcripn>t level, the difference between corpn>us and antrum is also significant, but not that pronounced (Figure 1). A possible expn>lanation could be that in the corpn>us n>an class="Gene">Tff2 transcripts are found in precursor cells, whereas in the antrum Tff2 is transcribed in the mature cells [32,60]. This could lower the translational efficiency of Tff2 in the corpus. A similar situation, that transcript and protein levels are not completely parallel, has also been observed for human gastric TFF3 [70]. Clearly, after non-reducing SDS-PAGE Tff2 appears as the expected monomer (about 14k-band), but also as an additional double band at about 16k/17k (Figure 4C). However, we did not detect clear signals indicating the existence of a potential Tff2 homodimer. The specificity of the 16k/17k entities was confirmed by elution from a non-reducing gel and shift of these bands to the monomeric band after reducing SDS-PAGE (Figure 4D). A similar situation has been described recently for human TFF2 [71]. These bands could represent different circular Tff2 forms because Cys-6 and Cys-104 probably form a disulfide bridge similar as porcine TFF2 [72]. The disulfide bridge between Cys-6 and Cys-104 connecting the N- with the C-terminal end of porcine TFF2 has been shown to be particularly sensitive to reduction with glutathione [73]. Well conserved pairs of acidic residues flanking Cys-104 as well as Cys-78 and Cys-58 could be responsible for such isomerization reactions (intramolecular disulfide exchange reactions), because flanking acid amino acids are known to change the pKa of cysteine residues [49,50]. As a hallmark in Tff1 animals, the n>an class="Gene">Tff2 protein levels are significantly reduced when compared with the wild-type animals (Figure 4B). In addition, also the Tff2 transcript levels are significantly downregulated in Tff1 animals, particularly in the corpus (Figure 1). The Tff2 downregulation is in line with previous reports [10,26,74]. It could be a direct consequence of the disruption of the Tff1 gene, because all three Tff genes are clustered on chromosome 17q and there are indications for coordinated expression of the Tff genes [75,76]. In addition, the reduced gastrin expression in Tff1 mice (Figure 1) could also account for the reduced Tff2 expression because gastrin regulates the TFF2 promoter [77]. Tff2 is a lectin stabilizing the inner gastric mucus barrier layer keeping bacteria at a distance [71,78]. Thus, a reduction of the mucus barrier function by a reduced Tff2 level could favor permeation of microorganisms and chronic inflammation leading to adenomas in the antrum because this is the preferred region for microbial colonization in the stomach [54]. Furthermore, Tff2 downregulation would also explain another phenotype of Tff1 animals well, i.e., they react more sensitive to H. pylori infection [79]. About 30% of the H. pylori-infected Tff1 animals developed invasive adenocarcinoma (and only 10% of uninfected Tff1 mice), whereas wild-type mice did not develop any dysplastic or invasive gastric lesions [79]. The significantly reduced Tff2 protein level could allow permeation of the bacteria leading to chronic inflammation and carcinogenesis. Taken together, the loss of Tff1 and the accompanied reduction of Tff2 probably act synergistically favoring chronic inflammation and carcinogenesis in the antrum.

4. Materials and Methods

4.1. Animals

As described previously, a stable line has been established by back-crossing two male mice heterozygous for Tff1 [10] (obtained from Dr. M.-C. Rio and Dr. C. Tomasetto, Institut de Génétique et de Biologie Moléculaire et Cellulaire [IGBMC], Illkirch, France) with 129/Svj mice [56]. Subsequently, this line was stabilized by back-crossing with C57BL/6J Rj mice (Janvier Labs, Saint-Berthevin Cedex, France) leading to a mixed background. Regions of the gastric corpus and antrum of 20 weeks old homozygous offspring (i.e., wild-type and Tff1 animals) were investigated here.

4.2. DNA and RNA Extraction, PCR Analysis

Genotyping of Tff1 n>an class="Species">mice has been reported in detail previously [80]. The primer pairs used for PCR analysis have been reported [56]. Isolation and purification of total gastric RNA (using TRIzolTM Reagent; ambion by life technologies, Carlsbad/CA, USA) as well as RT-PCR analysis (reverse transcriptase: Takara Bio Europe, Saint Germain en Laye, France) and semi-quantitative evaluation of the relative expression levels of selected genes including statistical analysis was as described in detail previously [80]. Relative intensities were normalized against the corresponding relative β-actin intensities. Error bars represent ± SEM. The specific primer pairs used in this RT-PCR study have been published previously (Epdr1, MB1890/1891; Fcgbp, MB1516/1517; Gkn3, MB2656/2657; Tff1, MD7/MD8; Tff3, MB1847/MB1848; [56,58,80]) or are listed in Table 1 (Actb, Agr2, Cckbr. Cxcl1, Cxcl5, Gast, Gkn1, Gkn2, Irx3, Mist1/Bhlha15, Muc5ac, Muc6, Pdia3, Pdx1, Tff2, Troy/Tnfrsf19).
Table 1

Oligonucleotides used for RT-PCR analysis and calculated size of the products.

GenesAccession No.Primer No.Primer PairsNucleotide PositionsTmSize (bp)Intron Spanning
ActbNM_007393.5MB2658 MB2659CACTGTCGAGTCGCGTCCA TGACCCATTCCCACCATCAC29–47255–23660 °C227yes
Agr2NM_011783.2MB2778 MB2779ACGAATGCCCACACAGTCAA GCGTAGAGCCGGTTTGAGTA288–307504–48560 °C 217yes
CckbrNM_007627.5MB2674 MB2675GCTGAGTGGGACTTCACAGG TTGGTGACCGTTCTTAGGCG271–290563–54460 °C 293yes
Cxcl1NM_008176.3MB2628 MB2629GGCTGGGATTCACCTCAAGAA GTGTTGTCAGAAGCCAGCGT183–203420–40160 °C238yes
Cxcl5NM_009141.3MB2636 MB2637CAGTCATAGCCGCAACGGAG AGAAAATCCGTGGGTGGAGA276–295617–59860 °C342yes
GastNM_010257.4MB2450 MB2451CGCCACAACAGCCAACTATT TTCGATGGTGAGAGGCTGAG19–38229–21060 °C211yes
Gkn1NM_025466.1MB2454 MB2455CCGCCATGAAGCTCACAATG CCAGGCCCTTTACCCTTCTG39–58372–35360 °C334yes
Gkn2NM_025467.1MB2456 MB2457AACATCCACTCAGGCTCGTG CTGTCGAATAGGCGACCCAA185–204454–43560 °C270yes
Irx3NM_001253822.1MB2708 MB2709AGCCGGAGAGTGGAACAGG GACATGCTTGCAACTCGTCAC1799–1817 2041–202160 °C243yes
Mist1/Bhlha15NM_010800.4MB2536 MB2537GTGGCTAAAGCTACGTGTCC CTCCAGGCTGGTTTTCCCAG8–27122–10360 °C115yes
Muc5acNM_010844.3MB2700 MB2701CCGCGTCAATGGAAAGTTGT CTGGAGGGTTGCATTGAGGT3739–3758 4059–404060 °C321yes
Muc6NM_001330001.2MB2718 MB2719GTTCCAGATGCAGCCTGTCT CATAGCTGAACGTGCGGTTG1612–1631 2105–208660 °C494yes
Pdia3NM_007952.2MB2744 MB2745CTAGTCGAGTTCTTCGCCCC AAAAACCCACCACTGAGGCA282–301615–59660 °C334yes
Pdx1NM_008814.4MB2464 MB2465ATCTCCCCATACGAAGTGCC GTTCCGCTGTGTAAGCACCT335–354572–55360 °C238yes
Tff2NM_009363.3MB2306 MB2307CTGGTAGAGGGCGAGAAACC TCTTGCGAGCTGACACTTCC92–111302–28360 °C211yes
Troy/Tnfrsf19NM_013869.5MB2684 MB2685TCTCCTAGTTCGCCTGCCTT AAGAGCACCGTCCTGTGTAG572–591806–78760 °C235yes

4.3. SDS-PAGE, Agarose Gel Electrophoresis, Western Blot Analysis, Antisera

Proteins were extracted using TRIzolTM Reagent (ambion by life technologies, Carlsbad/CA, USA). The pellets were resuspended in sterile Milli-Q water containing 1% SDS, and a protease inhibitor mix (cOmpleteTM, EDTA-free; Roche, Penzberg, Germany). The protein concentration was determined using the PierceTM BCA protein assay kit (Thermo ScientificTM, Rockford/IL, USA) according to the manufacturer’s instructions. For gel electrophoresis, 30 µg protein was loaded per lane except otherwise indicated. Denaturing SDS-PAGE under reducing or non-reducing conditions, non-reducing agarose gel electrophoresis, and Western blot analysis have been described in detail previously [7,30,81]. Gels after non-reducing SDS-PAGE analyzed for Tff2 immunoreactivity were subjected to post-in-gel reduction with 1% mercaptoethanol at 50 °C for 2 min before blotting as described previously [82] followed by washing with Milli-Q water. Murine Tff1 and Tff2 were detected with the affinity-purified polyclonal antisera anti-mTff1-1 (1:2000 dilution) [19] and anti-hTFF2-2 (1:1000 dilution), respectively; the latter being generated against the same antigen as anti-hTFF2-1 [83]. For detection of murine Gkn2, the polyclonal antiserum anti-hGKN2-1 was used (1:3000 dilution) [7]. Fcgbp was detected with a polyclonal antiserum (1:1000 dilution) against a 115k fragment of rat Fcgbp kindly provided by Prof. Jürgen Seitz (Philipps University, Marburg, Germany) [84]. Reactivity with a polyclonal anti-β-actin antiserum (1:500 dilution; code STJ97713, St. John’s Laboratory, London, UK) was used as loading control. Bands were visualized with the enhanced chemiluminescence (ECL) detection system (using a secondary antibody coupled to horseradish peroxidase and n>an class="Chemical">luminol/p-Coumaric acid/H2O2) and the intensity of the signals was semi-quantitatively analyzed as reported in detail previously [71]. The semi-quantitative analysis of the reactivity for Gkn2 and Tff2, respectively, was normalized after staining the blots with Amidoblack (Roth, Karlsruhe, Germany); here, the optical density was measured in equally sized boxes around the immunoreactive bands.

5. Conclusions

In wild-type animals, Tff1 occurs to large extent as a monomer. This is unusual and the unpn>aired thiol group of Tff1 might have a scavenger function for ROS reducing oxidative stress. Furthermore, relatively large amounts of Tff1-Gkn2 heterodimer were detected in the corpus and antrum of wild-type mice. In the antrum, little Tff1 also forms a heteromer with Fcgbp, analogous to human TFF3. There are indications that Tff1-Fcgbp has probably a function for clearing microorganisms, particularly in the antrum. As a direct consequence of Tff1 deficiency, in Tff1 animals a significant increase in a Gkn2 form was observed particularly in the antrum, which is likely homodimeric Gkn2. Currently, the biological function of this Gkn2 form is not known. Maybe, this Gkn2 entity has mitogenic or motogenic activities by analogy with Gkn1. Furthermore, Tff2 transcript and protein levels are strongly downregulated. This weakens the inner gastric mucus barrier and makes it presumably more permeable for microorganisms. Both the lack of protective Tff1 and the weakened gastric mucus barrier by downregulation of Tff2 are probably the major drivers for chronic damage of the gastric mucosa particularly in the antrum, because here microbial colonization occurs preferentially. As a secondary effect, chronic inflammation develops, which is then the base for carcinogenesis.
  83 in total

1.  Good fences make good neighbors: Gastrointestinal mucosal structure.

Authors:  Hannah L Turner; Jerrold R Turner
Journal:  Gut Microbes       Date:  2010-01

2.  Induction of TFF1 gene expression in pancreas overexpressing transforming growth factor alpha.

Authors:  M P Ebert; J Hoffmann; C Haeckel; K Rutkowski; R M Schmid; M Wagner; G Adler; H U Schulz; A Roessner; W Hoffmann; P Malfertheiner
Journal:  Gut       Date:  1999-07       Impact factor: 23.059

3.  Homodimerization and hetero-oligomerization of the single-domain trefoil protein pNR-2/pS2 through cysteine 58.

Authors:  M P Chadwick; B R Westley; F E May
Journal:  Biochem J       Date:  1997-10-01       Impact factor: 3.857

4.  Biosynthesis of gastrokine-2 in the human gastric mucosa: restricted spatial expression along the antral gland axis and differential interaction with TFF1, TFF2 and mucins.

Authors:  Irina Kouznetsova; Werner Laubinger; Hubert Kalbacher; Thomas Kalinski; Frank Meyer; Albert Roessner; Werner Hoffmann
Journal:  Cell Physiol Biochem       Date:  2007

5.  Loss of gastrokine-2 drives premalignant gastric inflammation and tumor progression.

Authors:  Trevelyan R Menheniott; Louise O'Connor; Yok Teng Chionh; Jan Däbritz; Michelle Scurr; Benjamin N Rollo; Garrett Z Ng; Shelley Jacobs; Angelique Catubig; Bayzar Kurklu; Stephen Mercer; Toshinari Minamoto; David E Ong; Richard L Ferrero; James G Fox; Timothy C Wang; Philip Sutton; Louise M Judd; Andrew S Giraud
Journal:  J Clin Invest       Date:  2016-03-14       Impact factor: 14.808

6.  A gradient of TFF3 (trefoil factor family 3) peptide synthesis within the normal human gastric mucosa.

Authors:  Irina Kouznetsova; Ulrich Peitz; Michael Vieth; Frank Meyer; Else Marie Vestergaard; Peter Malfertheiner; Albert Roessner; Hans Lippert; Werner Hoffmann
Journal:  Cell Tissue Res       Date:  2004-02-14       Impact factor: 5.249

7.  Effects of pancreatic spasmolytic Polypeptide (PSP) on epithelial cell function.

Authors:  W R Otto; J Rao; H M Cox; E Kotzian; C Y Lee; R A Goodlad; A Lane; M Gorman; P A Freemont; H F Hansen; D Pappin; N A Wright
Journal:  Eur J Biochem       Date:  1996-01-15

8.  Bacteria penetrate the inner mucus layer before inflammation in the dextran sulfate colitis model.

Authors:  Malin E V Johansson; Jenny K Gustafsson; Karolina E Sjöberg; Joel Petersson; Lena Holm; Henrik Sjövall; Gunnar C Hansson
Journal:  PLoS One       Date:  2010-08-18       Impact factor: 3.240

9.  Probiotics Upregulate Trefoil Factors and Downregulate Pepsinogen in the Mouse Stomach.

Authors:  Ghalia Khoder; Farah Al-Yassir; Asma Al Menhali; Prashanth Saseedharan; Subi Sugathan; Catherine Tomasetto; Sherif M Karam
Journal:  Int J Mol Sci       Date:  2019-08-10       Impact factor: 5.923

10.  TFF Peptides Play a Role in the Immune Response Following Oral Infection of Mice with Toxoplasma Gondii.

Authors:  Ting Fu; Eva B Znalesniak; Thomas Kalinski; Luisa Möhle; Aindrila Biswas; Franz Salm; Ildiko Rita Dunay; Werner Hoffmann
Journal:  Eur J Microbiol Immunol (Bp)       Date:  2015-09-18
View more
  8 in total

Review 1.  The immune microenvironment in gastric adenocarcinoma.

Authors:  Yana Zavros; Juanita L Merchant
Journal:  Nat Rev Gastroenterol Hepatol       Date:  2022-03-14       Impact factor: 73.082

Review 2.  Self-Renewal and Cancers of the Gastric Epithelium: An Update and the Role of the Lectin TFF1 as an Antral Tumor Suppressor.

Authors:  Werner Hoffmann
Journal:  Int J Mol Sci       Date:  2022-05-11       Impact factor: 6.208

Review 3.  Trefoil Factor Family (TFF) Peptides and Their Diverse Molecular Functions in Mucus Barrier Protection and More: Changing the Paradigm.

Authors:  Werner Hoffmann
Journal:  Int J Mol Sci       Date:  2020-06-25       Impact factor: 5.923

Review 4.  Salivary Trefoil Factor Family (TFF) Peptides and Their Roles in Oral and Esophageal Protection: Therapeutic Potential.

Authors:  Werner Hoffmann
Journal:  Int J Mol Sci       Date:  2021-11-12       Impact factor: 5.923

5.  Profiling of the Bacterial Microbiota along the Murine Alimentary Tract.

Authors:  Ramiro Vilchez-Vargas; Franz Salm; Eva B Znalesniak; Katharina Haupenthal; Denny Schanze; Martin Zenker; Alexander Link; Werner Hoffmann
Journal:  Int J Mol Sci       Date:  2022-02-04       Impact factor: 5.923

6.  Integrated Bioinformatics Analysis for the Screening of Hub Genes and Therapeutic Drugs in Androgen Receptor-Positive TNBC.

Authors:  Qiaonan Guo; Pengjun Qiu; Qingzhi Yao; Jianpeng Chen; Jianqing Lin
Journal:  Dis Markers       Date:  2022-09-14       Impact factor: 3.464

Review 7.  Trefoil Factor Family (TFF) Peptides and Their Links to Inflammation: A Re-evaluation and New Medical Perspectives.

Authors:  Werner Hoffmann
Journal:  Int J Mol Sci       Date:  2021-05-06       Impact factor: 5.923

8.  The Tumor Suppressor TFF1 Occurs in Different Forms and Interacts with Multiple Partners in the Human Gastric Mucus Barrier: Indications for Diverse Protective Functions.

Authors:  Jörn Heuer; Franziska Heuer; René Stürmer; Sönke Harder; Hartmut Schlüter; Nayara Braga Emidio; Markus Muttenthaler; Dörthe Jechorek; Frank Meyer; Werner Hoffmann
Journal:  Int J Mol Sci       Date:  2020-04-04       Impact factor: 5.923

  8 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.