| Literature DB >> 31848219 |
Xintao Fan1, Sasha De Henau2, Julia Feinstein1, Stephanie I Miller1, Bingjie Han1, Christian Frøkjær-Jensen3, Erik E Griffin4.
Abstract
The Mos1-mediated Single-Copy Insertion (MosSCI) method is widely used to establish stable Caenorhabditis elegans transgenic strains. Cloning MosSCI targeting plasmids can be cumbersome because it requires assembling multiple genetic elements including a promoter, a 3'UTR and gene fragments. Recently, Schwartz and Jorgensen developed the SapTrap method for the one-step assembly of plasmids containing components of the CRISPR/Cas9 system for C. elegans Here, we report on the adaptation of the SapTrap method for the efficient and modular assembly of a promoter, 3'UTR and either 2 or 3 gene fragments in a MosSCI targeting vector in a single reaction. We generated a toolkit that includes several fluorescent tags, components of the ePDZ/LOV optogenetic system and regulatory elements that control gene expression in the C. elegans germline. As a proof of principle, we generated a collection of strains that fluorescently label the endoplasmic reticulum and mitochondria in the hermaphrodite germline and that enable the light-stimulated recruitment of mitochondria to centrosomes in the one-cell worm embryo. The method described here offers a flexible and efficient method for assembly of custom MosSCI targeting vectors.Entities:
Keywords: C. elegans; MosSCI; SapTrap; endoplasmic reticulum; mitochondria
Year: 2020 PMID: 31848219 PMCID: PMC7003106 DOI: 10.1534/g3.119.400822
Source DB: PubMed Journal: G3 (Bethesda) ISSN: 2160-1836 Impact factor: 3.154
Strains used in this study
| Strain | Genotype | Construction | Reference: |
|---|---|---|---|
| EG8078 | |||
| EG8079 | |||
| EGD329 | Injected pJF13 into EG8078 | This study | |
| EGD412 | Injected pJF17 into EG8079 | This study | |
| EGD496 | Injected pXF253 into EG8078 | This study | |
| EGD497 | Injected pXF255 into EG8079 | This study | |
| EGD549 | Injected pXF266 into EG8079 | This study | |
| EGD565 | Injected pJF13 into EG8079 | This study | |
| EGD623 | Injected pSM16 into EG8079 | This study | |
| EGD629 | Injected pSM20 into EG8079 | This study | |
| EGD631 | Injected pSM17 into EG8079 | This study | |
| EGD633 | Injected pSM22 into EG8079 | This study | |
| EGD615 | Crossed EGD412 and JJ2586 | This study | |
| JJ2586 | |||
| TBD307 | Injected pSDH68 into EG8079. Crossed to SV2095. | This study | |
| SV2095 |
Donor cassette plasmids used in this study
| Name | Description |
|---|---|
| pXF121 | |
| pSDH60 | |
| pXF89 | |
| pJF5 | |
| pXF222 | |
| pSDH61 | |
| pSM10 | |
| pSM12 | |
| pJF7 | |
| pSDH50 | |
| pXF262 | |
| pXF250 | |
| pXF88 | |
| pJF6 | |
| pXF130 | |
| pSM08 | |
| pSM03 | |
| pXF90 | |
| pSDH51 | |
| pSM04 | |
| pSDH57 | |
| pXF276 | |
| pSDH52 | |
| pSM05 | |
| pXF85 | |
| pSDH54 | |
| pSDH66 | |
Primers used in this study
| Name | Description | Sequence ( | Corresponding plasmid |
|---|---|---|---|
| XF32F | GCA | pXF121 | |
| XF32R | GCA | ||
| JF5F | GCA | pJF7 | |
| JF5R | GCA | ||
| JF1F | GCA | pJF5 | |
| JF1R | GCA | ||
| JF2F | GCA | pJF6 | |
| JF2R | GCA | ||
| XF17F | |||
| XF17R | |||
| spe-11(SAP C1) F | GCA | pSDH60 | |
| spe-11(SAP C1) R | GCA | ||
| XF24F | GCA | pXF89 | |
| XF24R | GCA | ||
| XF63F | GCA | pXF222 | |
| XF63R | GCA | ||
| ePDZ (SAP C2) F | GCA | pSDH61 | |
| ePDZ (SAP C2) R | GCA | ||
| XF79F | GCA | pXF262 | |
| XF79R | GCA | ||
| XF76F | GCA | pXF250 | |
| XF76R | GCA | ||
| XF23F | GCA | pXF88 | |
| XF23R | GCA | ||
| XF53F | GCA | pXF130 | |
| XF53R | GCA | ||
| XF22F | GCA | pXF90 | |
| XF22R | GCA | ||
| SIM8F | GCA | pSM10 | |
| SIM8R | GCA | ||
| SIM10F | GCA | pSM12 | |
| SIM10R | GCA | ||
| SIM1F | GCA | pSM03 | |
| SIM1R | GCA | ||
| SIM2F | GCA | pSM04 | |
| SIM2R | GCA | ||
| SIM3F | GCA | pSM05 | |
| SIM3R | GCA | ||
| SIM6F | GCA | pSM08 | |
| SIM6R | GCA | ||
| mScarlet (SAPC3)F | GCA | pSDH57 | |
| mScarlet (SAPC3)R | GCA | ||
| XF84F | GCA | pXF276 | |
| XF84R | GCA | ||
| XF12F | GCA | pXF85 | |
| XF12R | GCA | ||
| tbb2 3′UTR (SAPC5)F | GCA | pSDH54 | |
| tbb2 3′UTR (SAPC5)R | GCA | ||
| Halo (SAP C3)F | GCA | pSDH51 | |
| Halo (SAP C3)R | GCA | ||
| ePDZ (SAP C4)F | GCA | pSDH52 | |
| ePDZ (SAP C4)R | GCA | ||
| unc-54 (SAPC5)F | GCA | pSDH66 | |
| unc-54 (SAPC5)R | GCA | ||
| Eg717 | Replace pCFJ350 MCS (F) | TCGAGTGGCGAAGAGCCCATGGATCCCATATGGAATTCTGCAGGCCTGCTCTTCGGTAA | pXF87 |
| Eg718 | Replace pCFJ350 MCS (R) | CTAGTTACCGAAGAGCAGGCCTGCAGAATTCCATATGGGATCCATGGGCTCTTCGCCAC | |
| XF30F | Mutate SapI site in pCFJ350 | GATTATGGGCACTTCTTTTATCC | pXF87 |
| XF30R | Mutate SapI site in pCFJ350 | CGACAAGCAACTTTTCTATAC | |
| XF31F | Mutate SapI site in pCFJ350 | AATGGCGAAGtGCAAAGCAGAG | pXF87 |
| XF31R | Mutate SapI site in pCFJ350 | GTTTCCTGAAAATAATGTAACTTGAATTG |
Note: For the expression plasmid pJF13 annealed oligos were used to generate HSP-3(aa 1-19) in cassette 2.
Additional oligo sequences used to generate pSDH50:
TOMM-20 short forward. GCAGCTCTTCGATGTCGGACACAATTCTTGGTTTCAAcaaatcaaacgtcgttttggctgctggaattgctggagccgctttcctcggctactgcatttacttcgatcataagagaatcaacgctccagactacaaggacaagattaggcaaagtcagtgttttaacaacatatttccttcggatttttatctaaaaacaacttattttctttcagagagaCGTGCCCAGGCTGGAGCAggagctggtgcaggcgctggagccggagccGGTCGAAGAGCtgc.
TOMM-20 short reverse GCAGCTCTTCGACCggctccggctccagcgcctgcaccagctccTGCTCCAGCCTGGGCACGtctctctgaaagaaaataagttgtttttagataaaaatccgaaggaaatatgttgttaaaacactgactttgcctaatcttgtccttgtagtctggagcgttgattctcttatgatcgaagtaaatgcagtagccgaggaaagcggctccagcaattccagcagccaaaacgacgtttgatttgTTGAAACCAAGAATTGTGTCCGACATCGAAGAGCtgc.
MosSCI targeting vectors used in this study
| Name | Comments | Assembly | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| pXF87 | MosSCI backbone | Derived from pCFJ350 | |||||||||
| pJF13 | ER lumen, Halotag | pXF121 | XF17F/R | pXF90 | pXF85 | 4/5 | 2/2 | ||||
| pJF17 | Mitochondrial OM, Halotag | pXF121 | pJF7 | pXF88 | pXF85 | 4/5 | 1/2 | ||||
| pXF253 | ERES + nuclear pores (NPP-20), GFP | pXF121 | pXF 250 | pJF6 | pXF85 | 4/6 | 2/2 | ||||
| pXF255 | ERES + nuclear pores (NPP-20), Halotag | pXF121 | pXF 250 | pXF88 | pXF85 | 5/6 | 2/2 | ||||
| pXF266 | Mitochondrial matrix, Halotag | pXF121 | pXF 262 | pXF88 | pXF85 | 1/4 | 1/1 | ||||
| pSM20 | Mitochondrial OM, mKate2 | pXF121 | pJF7 | pXF130 | pXF85 | 4/5 | 2/2 | ||||
| pSM22 | Mitochondrial OM, mScarlet | pXF121 | pJF7 | pSM08 | pXF85 | 4/5 | 2/2 | ||||
| pSM17 | Mitochondrial OM, Dendra2 | pXF121 | pJF7 | pSM03 | pXF85 | 4/5 | 2/2 | ||||
| pSM16 | Mitochondrial OM, GFP | pXF121 | pJF7 | pJF6 | pXF85 | 2/5 | 2/2 | ||||
| pSDH68 | Mitochondrial OM, Halotag, LOV | pXF121 | pSDH50 | pSDH51 | PCR fragment | pSDH54 | 11/15 | 2/2 | |||
Annealed oligos.
Figure 4Optogenetic control of mitochondrial distribution in the 1-cell embryo. A. Control embryo stained with Mitotracker DeepRed and imaged with 488 nm and 640 nm illumination (640 nm channel shown). B. 1-cell epdz::mcherry::dhc-1; tomm-20::halotag::lov embryo stained with Mitotracker DeepRed and imaged with 488 nm and 640 nm illumination (640 nm channel shown). The 488 nm illumination was used to stimulate the interaction between the ePDZ and LOV domains.
Figure 1SapTrap assembly of MosSCI targeting vectors using the four-cassette system. A. The MosSCI targeting vector pXF87 was derived from pCFJ350 by mutating two SapI restriction sites (indicated by arrowheads in the “Left” (L) and “Right” (R) homology arms) and introducing two SapI sites (blue text) between the XhoI and SpeI sites (green text). SapI cleavage sites are in red text. The SapI recognition sites are oriented such that upon digestion they are removed from the vector backbone. The cbr-unc-119 gene is used as a positive selection marker to facilitate the identification of transgenic animals. B. Design of the donor cassette vectors used for the 4-cassette cloning strategy. C. The curved dotted lines indicate the overhangs that anneal during the ligation reaction. D. Overview of the assembly protocol. For a detailed protocol, see the Materials and Methods section. E. Summary of available promoter, gene tag and 3′UTR donor cassette plasmids.
Figure 3SapTrap assembly of MosSCI targeting vectors using the five-cassette system. A. Schematic of pXF87 and the donor cassettes following SapI digestion. The dotted lines indicate the overhangs that anneal during ligation. B. Summary of available promoter, gene tag and 3′UTR donor cassette plasmids for the five-cassette system.
Figure 2Images of transgenic strains. A. Images of TOMM-20::HaloTag labeled with JF646 HaloTag ligand in the adult gonad (outlined with curved dotted line), including an inset of the region in the stippled box. B. Images of embryos expressing TOMM-20::HaloTag labeled with JF646 HaloTag ligand at the 1-cell, 4 cell and ∼100 cell stages. C. Images of a 4 cell embryo expressing TOMM-20::HaloTag labeled with JF646 HaloTag ligand (magenta) and COX-4::GFP (green) (Raiders ). D – F. Images of embryos expressing the indicated transgenes at the 4-cell stage. G – I. Images of a 4 cell embryo expressing TOMM-20::Dendra2 before and after photoconversion (PC). Dendra2 switches from green to red fluorescence upon photoconversion. J – M. Images of embryos expressing the indicated transgenes at the 1-cell, 4 cell and ∼100 cell stages.