Literature DB >> 31848219

SapTrap Assembly of Caenorhabditis elegans MosSCI Transgene Vectors.

Xintao Fan1, Sasha De Henau2, Julia Feinstein1, Stephanie I Miller1, Bingjie Han1, Christian Frøkjær-Jensen3, Erik E Griffin4.   

Abstract

The Mos1-mediated Single-Copy Insertion (MosSCI) method is widely used to establish stable Caenorhabditis elegans transgenic strains. Cloning MosSCI targeting plasmids can be cumbersome because it requires assembling multiple genetic elements including a promoter, a 3'UTR and gene fragments. Recently, Schwartz and Jorgensen developed the SapTrap method for the one-step assembly of plasmids containing components of the CRISPR/Cas9 system for C. elegans Here, we report on the adaptation of the SapTrap method for the efficient and modular assembly of a promoter, 3'UTR and either 2 or 3 gene fragments in a MosSCI targeting vector in a single reaction. We generated a toolkit that includes several fluorescent tags, components of the ePDZ/LOV optogenetic system and regulatory elements that control gene expression in the C. elegans germline. As a proof of principle, we generated a collection of strains that fluorescently label the endoplasmic reticulum and mitochondria in the hermaphrodite germline and that enable the light-stimulated recruitment of mitochondria to centrosomes in the one-cell worm embryo. The method described here offers a flexible and efficient method for assembly of custom MosSCI targeting vectors.
Copyright © 2020 Fan et al.

Entities:  

Keywords:  C. elegans; MosSCI; SapTrap; endoplasmic reticulum; mitochondria

Year:  2020        PMID: 31848219      PMCID: PMC7003106          DOI: 10.1534/g3.119.400822

Source DB:  PubMed          Journal:  G3 (Bethesda)        ISSN: 2160-1836            Impact factor:   3.154


The rich toolbox of techniques available to manipulate gene expression in C. elegans is a major attraction of this model organism. Several approaches have been developed to introduce transgenes and to induce efficient CRISPR/Cas9 mediated gene editing (Nance and Frøkjær-Jensen 2019). The Mos1-mediated Single-Copy Insertion (MosSCI) method has been widely adopted to introduce transgenes in C. elegans because single-copy transgenes are integrated at defined chromosomal positions, thereby mitigating potential concerns of transgene integration at random positions (Frøkjær-Jensen ; Frøkjær-Jensen ; Frøkjær-Jensen ). MosSCI transgene integration results from homologous recombination between a MosSCI targeting vector containing the transgene construct and one of the safe-harbor integration sites that have been engineered at defined positions in the genome. Transgenes typically include multiple genetic elements including a promoter, one or more gene fragments and a 3′UTR. A number of strategies can be used to assemble these elements together including traditional restriction enzyme cloning, Gateway cloning (Hartley ), in vivo recombineering (Philip ) or Gibson cloning (Gibson ). Each of these strategies has both advantages and disadvantages. For example, Gateway cloning allows the efficient modular “mix and match” cloning of large collections of promoter, ORF and 3′UTR cassettes (Brasch ; Dupuy ; Mangone ; Zeiser ). However, Gateway cloning can be expensive due to the required use of proprietary enzyme mixes and leaves ∼25 base pair att recombination site “scars” at each cassette junction. In contrast, Gibson cloning allows the efficient, “scar-free” assembly of multiple gene fragments but does not allow the “mix and match” cloning of existing cassettes, making this approach laborious if many constructs are needed. Schwartz and Jorgensen recently developed the SapTrap method for efficient, modular and single step assembly of CRISPR/Cas9 vectors for C. elegans (Schwartz and Jorgensen 2016). The SapTrap method is based on the Golden Gate cloning technique (Engler ) and takes advantage of the SapI type II restriction enzyme, which cuts DNA at defined positions adjacent to its recognition sequence to generate three-base 5′ overhangs. By designing SapI restriction fragments with complementary overhangs, multiple fragments can be assembled together in a defined order in a single digestion and ligation reaction. In this study, we report on the adaptation of the SapTrap system for the efficient, inexpensive, modular, and “scar-free” assembly of transgenes in a MosSCI targeting vector. We have developed a toolkit for expression of transgenes in the C. elegans germline, including a collection of cassettes containing tags for fluorescence imaging and for the ePDZ/LOV optogenetic system (Strickland ; Fielmich ). As a proof of principle, we have used this system to generate a collection of mitochondrial and endoplasmic reticulum reporter strains and a strain in which light induces the transport of mitochondria to centrosomes in the one-cell worm embryo.

Materials and Methods

C. elegans

C. elegans hermaphrodite strains were maintained at either 20° or 25° on Nematode Growth Medium (NGM) plates containing 3 g/L NaCl, 2.5 g/L peptone and 17 g/L agar supplemented with 1 mM CaCl2, 1 mM MgSO4, 1 mM KPO4 and 5 mg/L cholesterol with E. coli OP50 as a source of food. All strains used in this study are listed in Table 1.
Table 1

Strains used in this study

StrainGenotypeConstructionReference:
EG8078oxTi185 I; unc-119(ed3) IIIFrøkjær-Jensen et al. (2014)
EG8079oxTi179 II; unc-119(ed3) IIIFrøkjær-Jensen et al. (2014)
EGD329egxSi126 [mex-5p::hsp-3(aa 1-19)::halotag::hdel::pie-1 3′UTR + unc119(+)] I; unc-119(ed3) IIIInjected pJF13 into EG8078This study
EGD412egxSi136 [mex-5p::tomm-20::halotag::pie-1 3′UTR + unc119(+)] II; unc-119(ed3) IIIInjected pJF17 into EG8079This study
EGD496egxSi117 [pmex-5p::npp-20::gfp;;pie-1 3′UTR + unc119(+)] I; unc-119(ed3) IIIInjected pXF253 into EG8078This study
EGD497egxSi118 [mex-5p::npp-20::halotag::pie-1 3′UTR + unc119(+)] II; unc-119 (ed3) IIIInjected pXF255 into EG8079This study
EGD549egxSi144 [mex-5p::cox-4::halotag::pie-1 3′UTR + unc119(+)] II; unc-119 (ed3) IIIInjected pXF266 into EG8079This study
EGD565egxSi145 [mex-5p::hsp-3(aa 1-19)::halotag::hdel::pie-1 3′UTR + unc119(+)] II; unc-119 (ed3) IIIInjected pJF13 into EG8079This study
EGD623egxSi152 [mex-5p::tomm-20::gfp::pie-1 3′UTR + unc119(+)] II; unc-119(ed3) IIIInjected pSM16 into EG8079This study
EGD629egxSi155 [mex-5p::tomm-20::mkate2::pie-1 3′UTR + unc119(+)] II; unc-119(ed3) IIIInjected pSM20 into EG8079This study
EGD631egxSi157 [mex-5p::tomm-20::dendra2::pie-1 3′UTR + unc119(+)] II; unc-119(ed3) IIIInjected pSM17 into EG8079This study
EGD633egxSi159 [mex-5p::tomm-20::mscarlet::pie-1 3′UTR + unc119(+)] II; unc-119(ed3) IIIInjected pSM22 into EG8079This study
EGD615cox-4(zu476[cox-4::eGFP::3XFLAG]) I; egxSi136 [mex-5p::tomm-20::halotag::pie-1 3′UTR + unc119(+)] II; unc-119(ed3?) IIICrossed EGD412 and JJ2586This study
JJ2586cox-4(zu476[cox-4::eGFP::3XFLAG]) IRaiders et al. 2018
TBD307dhc-1(he255[epdz::mcherry::dhc-1]) I; utdSi51(mex-5p::tomm-20(aa 1-55)::halotag::lov::tbb-2 3′UTR + unc119(+)) IIInjected pSDH68 into EG8079. Crossed to SV2095.This study
SV2095dhc-1(he255[epdz::mcherry::dhc-1]) I; ruls57[pie-1p::gfp::tbb-2 + unc119(+)] VFielmich et al. 2018

Cloning

To generate the expression vector pXF87, the two SapI restriction sites in pCFJ350 (Frøkjær-Jensen ) were mutated using Q5 Site-Directed Mutagenesis (New England Biolabs (NEB)) with the oligo pairs XF30F/XF30R and XF31F/XF31R. In addition, the annealed oligos Eg717 and Eg718 were cloned between the XhoI and SpeI sites of pCFJ350. HaloTag and ceGFP containing PATC-rich endogenous introns were generated in several steps. First, genes were designed in silico to minimize germline silencing and increase expression by codon adaptation (Redemann ), removal of homology to piRNAs (Batista ), and inclusion of a short endogenous intron from and four synthetic introns (Okkema ) using the freely available gene editor ApE (M. Wayne Davis, https://jorgensen.biology.utah.edu/wayned/ape/). Second, the synthetic genes were synthesized as gBlocks (IDT), cloned into a plasmid, and sequence verified. Third, PATC-rich introns from a gene that is resistant to germline silencing, (Spike ), were introduced into the synthetic genes by Golden Gate cloning as described previously (Frøkjær-Jensen ). Finally, correct splicing and expression was verified by expression of the synthetic genes with and without PATC-rich introns using an eft-3 promoter and 3′UTR. Donor cassette plasmids numbered pXF, pJF and pSM were generated by cloning PCR products into the pCR BluntII vector backbone using the Zero Blunt Topo system (Thermo Fisher Scientific). pSDH donor cassette plasmids were cloned by ligating PCR products into pSDH76, a derivative of pCR BluntII containing two XcmI sites that generate T-overhangs following digestion with XcmI. pXF87 and all donor plasmids were sequence verified. To assemble HSP-3 (aa 1-19) into the second cassette of the expression vector pJF13, 10 μM of oligos XF17F and XF17R were gradually cooled from 95° to 25° in a BioRad T1000 thermocycler. Annealed oligos were phosphorylated by T4 polynucleotide kinase (NEB) for two hours at 37°, followed by an enzyme inactivation step at 65° for 20 min. The donor plasmids and primers are listed in Tables 2 and 3, respectively.
Table 2

Donor cassette plasmids used in this study

NameDescription
Cassette 1 for 4-cassette or 5 cassette system (5′-TGG ...... 3′-TAC)
pXF121mex-5 promoter
pSDH60spe-11 promoter
Cassette 2 for 4-cassette or 5-cassette system (5′-ATG-3′ ...... 3′-CCA-5′)
Tags
pXF89halotag (no STOP codon, PATC introns)
pJF5gfp (no STOP codon, PATC introns)
pXF222mkate2 (no STOP codon)
pSDH61epdz (no STOP codon)
pSM10mscarlet (no STOP codon)
pSM12dendra2 (no STOP codon)
Genes
pJF7tomm-20 (no STOP codon)
pSDH50tomm-20 (aa 1-55) (no STOP codon)
pXF262cox-4 (no STOP codon)
pXF250npp-20 (no STOP codon)
Cassette 3 for 4-cassette system (5′-GGT-3′ ...... 3′-ATT-5′)
Tags
pXF88halotag (includes STOP codon, PATC introns)
pJF6gfp (includes STOP codon, PATC introns)
pXF130mkate2 (includes STOP codon)
pSM08mscarlet (includes STOP codon)
pSM03dendra2 (includes STOP codon)
ORFs
pXF90halotag::hdel (includes STOP codon, PATC introns)
Cassette 3A for 5-cassette system (5′-GGT-3′ ...... 3′-TGC-5′)
Tags
pSDH51halotag (no STOP codon, PATC introns)
pSM04mkate2 (no STOP codon)
pSDH57mscarlet (no STOP codon)
Cassette 3B for 5-cassette system (5′-ACG-3′ ...... 3′-ATT-5′)
Tags
pXF276lov domain (includes STOP codon)
pSDH52epdz (includes STOP codon)
pSM05mkate2 (includes STOP codon)
Cassette 4 for 4-cassette or 5-cassette system (5′-TAA-3′ ...... 3′-CAT-5′)
pXF85pie-1 3′UTR
pSDH54tbb-2 3′UTR
pSDH66unc-54 3′UTR
Table 3

Primers used in this study

NameDescriptionSequence (SAP1 site and Overhang)Corresponding plasmid
XF32Fmex-5 promoter (F)GCAGCTCTTCGTGGATATCAGTTTTTAAAAAATTApXF121
XF32Rmex-5 promoter (R)GCAGCTCTTCGCATTCTCTGTCTGAAACA
JF5Ftomm-20 (F)GCAGCTCTTCGATGTCGGACACAATTCTTGGpJF7
JF5Rtomm-20 (R)GCAGCTCTTCGACCCTCCAAGTCGTCGGTGTC
JF1Fgfp (F)GCAGCTCTTCGATGTCCAAGGTAACACTTAGTTTpJF5
JF1Rgfp (R)GCAGCTCTTCGACCGCCGCTTCCCTTGTAGAGCTCGTCCAT
JF2Fgfp (F)GCAGCTCTTCGGGTGGAAGCGGCTCCAAGAACACTTAGTTTpJF6
JF2Rgfp (R)GCAGCTCTTCGTTACTTGTAGAGCTCGTCCAT
XF17Fhsp-3 (1-19aa) (F)ATGAAGACCTTATTCTTGTTGGGCTTGATCGCCCTATCCGCCGTCAGTGTCTACTGC
XF17Rhsp-3 (1-19aa) (R)ACCGCAGTAGACACTGACGGCGGATAGGGCGATCAAGCCCAACAAGAATAAGGTCTT
spe-11(SAP C1) Fspe-11 promoter (F)GCAGCTCTTCGTGGGTCGACAGAACATTTTTCCGTpSDH60
spe-11(SAP C1) Rspe-11 promoter (R)GCAGCTCTTCGCATTTTATCTAGTCGGTTTGCGA
XF24Fhalotag (F)GCAGCTCTTCGATGGCCGAGGTAACACTTAGTTTTTGTpXF89
XF24Rhalotag (R)GCAGCTCTTCGACCGCCGCTTCCTCCGGAGATCTCGAGGGT
XF63Fmkate2 (F)GCAGCTCTTCGATGGTCTCCGAGCTCATTAAAGAAAACApXF222
XF63Rmkate2 (R)GCAGCTCTTCGACCACCTCCACCTCCACGGTGTCCGAGCTTGG
ePDZ (SAP C2) Fepdz (F)GCAGCTCTTCGATGCCAGAGCTCGGATTCTCGATpSDH61
ePDZ (SAP C2) Repdz (R)GCAGCTCTTCGACCAGCTCCCGTCGCGACGGGTGGATCAC
XF79Fcox-4 (F)GCAGCTCTTCGATGATGCTGCCACGTTTGpXF262
XF79Rcox-4 (R)GCAGCTCTTCGACCCTTCCACTTCTTGTTCTCGTAATC
XF76Fnpp-20 (F)GCAGCTCTTCGATGACCACGGTCCGCCAGpXF250
XF76Rnpp-20 (R)GCAGCTCTTCGACCTCTCTGAGCTCCCGGAGCT
XF23Fhalotag (F)GCAGCTCTTCGGGTGGAAGCGGCGCCGAGGTAACACTTAGTTTTTGTpXF88
XF23Rhalotag (R)GCAGCTCTTCGTTATCCGGAGATCTCGAGGGT
XF53Fmkate2 (F)GCAGCTCTTCGGGTGGAGGTGGAGGTGTCTCCGAGCTCATTAAAGAAAACpXF130
XF53Rmkate2 (R)GCAGCTCTTCGTTAACGGTGTCCGAGCTTGGA
XF22Fhalotag::hdel (F)GCAGCTCTTCGGGTGGAAGCGGCGCCGAGGTAACACTTAGTTTTTGTpXF90
XF22Rhalotag::hdel (R)GCAGCTCTTCGTTAGAGTTCGTCATGTCCGGAGATCTCGAGGGT
SIM8Fmscarlet (F)GCAGCTCTTCGATGGTCTCCAAGGGCGAGGCApSM10
SIM8Rmscarlet (R)GCAGCTCTTCGACCACCTCCACCTCCCTTGTACAGCTCGTCCATTCCT
SIM10Fdendra2 (F)GCAGCTCTTCGATGAACCTTATTAAGGAAGATATGpSM12
SIM10Rdendra2 (R)GCAGCTCTTCGACCGCCGCTTCCCCATACTTGACTTGGTAG
SIM1Fdendra2 (F)GCAGCTCTTCGGGTGGAAGCGGCAACCTTATTAAGGAAGATATGpSM03
SIM1Rdendra2 (R)GCAGCTCTTCGTTACCATACTTGACTTGGTAG
SIM2Fmkate2 (F)GCAGCTCTTCGGGTGGAGGTGGAGGTGTCTCCGAGCTCATTAAAGAAAACApSM04
SIM2Rmkate2 (R)GCAGCTCTTCGCGTACCTCCACCTCCACGGTGTCCGAGCTTGGA
SIM3Fmkate2 (F)GCAGCTCTTCGACGGGAGGTGGAGGTGTCTCCGAGCTCATTAAAGAAAACApSM05
SIM3Rmkate2 (R)GCAGCTCTTCGTTAACGGTGTCCGAGCTTGGA
SIM6Fmscarlet (F)GCAGCTCTTCGGGTGGAGGTGGAGGTGTCTCCAAGGGCGAGGCApSM08
SIM6Rmscarlet (R)GCAGCTCTTCGTTACTTGTACAGCTCGTCCATTCCT
mScarlet (SAPC3)Fmscarlet (F)GCAGCTCTTCGGGTGTCTCCAAGGGCGAGGCAGTCATpSDH57
mScarlet (SAPC3)Rmscarlet (R)GCAGCTCTTCGCGTGGCCGCGGCTTTTGCAGCGG
XF84Flov (F)GCAGCTCTTCGACGCCTCGTCTTGCTGCTpXF276
XF84Rlov (R)GCAGCTCTTCGTTAGACCCAAGTGTCGACGGC
XF12Fpie-1 3′UTR (F)GCAGCTCTTCGTAATTTTGCCGTATTTTCCATpXF85
XF12Rpie-1 3′UTR (R)GCAGCTCTTCGTACATCATCGTTCACTTTTCAC
tbb2 3′UTR (SAPC5)Ftbb-2 3′UTR (F)GCAGCTCTTCGTAAATGCAAGATCCTTTCAAGCATTCpSDH54
tbb2 3′UTR (SAPC5)Rtbb-2 3′UTR (R)GCAGCTCTTCGTACGACTTTTTTCTTGGCGGCAC
Halo (SAP C3)Fhalotag (F)GCAGCTCTTCGGGTGGAAGCpSDH51
Halo (SAP C3)Rhalotag (R)GCAGCTCTTCGCGTTCCGGAGATCTCGAGGGTGG
ePDZ (SAP C4)Fepdz (F)GCAGCTCTTCGACGGGAGGTTCCGGAGGATCTGGCpSDH52
ePDZ (SAP C4)Repdz (R)GCAGCTCTTCGTTACGTCGCGACGGGTGGAT
unc-54 (SAPC5)Func-54 3′UTR (F)GCAGCTGTTCGTAAGAGCTCCGCATCGGCCGCTGpSDH66
unc-54 (SAPC5)Runc-54 3′UTR (R)GCAGCTCTTCGTACAAACAGTTATGTTTGGTATATTGGGA
Eg717Replace pCFJ350 MCS (F)TCGAGTGGCGAAGAGCCCATGGATCCCATATGGAATTCTGCAGGCCTGCTCTTCGGTAApXF87
Eg718Replace pCFJ350 MCS (R)CTAGTTACCGAAGAGCAGGCCTGCAGAATTCCATATGGGATCCATGGGCTCTTCGCCAC
XF30FMutate SapI site in pCFJ350GATTATGGGCACTTCTTTTATCCpXF87
XF30RMutate SapI site in pCFJ350CGACAAGCAACTTTTCTATAC
XF31FMutate SapI site in pCFJ350AATGGCGAAGtGCAAAGCAGAGpXF87
XF31RMutate SapI site in pCFJ350GTTTCCTGAAAATAATGTAACTTGAATTG

Note: For the expression plasmid pJF13 annealed oligos were used to generate HSP-3(aa 1-19) in cassette 2.

Additional oligo sequences used to generate pSDH50:

TOMM-20 short forward. GCAGCTCTTCGATGTCGGACACAATTCTTGGTTTCAAcaaatcaaacgtcgttttggctgctggaattgctggagccgctttcctcggctactgcatttacttcgatcataagagaatcaacgctccagactacaaggacaagattaggcaaagtcagtgttttaacaacatatttccttcggatttttatctaaaaacaacttattttctttcagagagaCGTGCCCAGGCTGGAGCAggagctggtgcaggcgctggagccggagccGGTCGAAGAGCtgc.

TOMM-20 short reverse GCAGCTCTTCGACCggctccggctccagcgcctgcaccagctccTGCTCCAGCCTGGGCACGtctctctgaaagaaaataagttgtttttagataaaaatccgaaggaaatatgttgttaaaacactgactttgcctaatcttgtccttgtagtctggagcgttgattctcttatgatcgaagtaaatgcagtagccgaggaaagcggctccagcaattccagcagccaaaacgacgtttgatttgTTGAAACCAAGAATTGTGTCCGACATCGAAGAGCtgc.

Note: For the expression plasmid pJF13 annealed oligos were used to generate HSP-3(aa 1-19) in cassette 2. Additional oligo sequences used to generate pSDH50: TOMM-20 short forward. GCAGCTCTTCGATGTCGGACACAATTCTTGGTTTCAAcaaatcaaacgtcgttttggctgctggaattgctggagccgctttcctcggctactgcatttacttcgatcataagagaatcaacgctccagactacaaggacaagattaggcaaagtcagtgttttaacaacatatttccttcggatttttatctaaaaacaacttattttctttcagagagaCGTGCCCAGGCTGGAGCAggagctggtgcaggcgctggagccggagccGGTCGAAGAGCtgc. TOMM-20 short reverse GCAGCTCTTCGACCggctccggctccagcgcctgcaccagctccTGCTCCAGCCTGGGCACGtctctctgaaagaaaataagttgtttttagataaaaatccgaaggaaatatgttgttaaaacactgactttgcctaatcttgtccttgtagtctggagcgttgattctcttatgatcgaagtaaatgcagtagccgaggaaagcggctccagcaattccagcagccaaaacgacgtttgatttgTTGAAACCAAGAATTGTGTCCGACATCGAAGAGCtgc.

Assembly reaction

Assembly reactions (total final volume of 50 μL) included 1 nM of pXF87 and of each donor cassette plasmid, 400 units of T4 DNA ligase (NEB), 10 units of SapI enzyme (NEB), 1x NEB CutSmart buffer and 1 mM ATP. For assemblies including annealed oligos, phosphorylated annealed oligos were used at a final concentration of 3 nM in the assembly reaction. Reactions were incubated for 22-24 hr at 25°, and transformed into Stellar Competent cells (Clontech). Four to six plasmid clones were first screened by restriction digest with XhoI and SpeI. Plasmids with the correct restriction digest pattern were sequenced across each cassette boundary. MosSCI targeting vector assembly reactions are listed in Table 4. Note that because the background of unassembled vectors in our assembly reactions was typically low, our protocol omits the counterselection restriction enzyme step described in the original SapTrap protocol (Schwartz and Jorgensen 2016).
Table 4

MosSCI targeting vectors used in this study

NameCommentsAssembly
pXF87MosSCI backboneDerived from pCFJ350
Donor vectors used for assemblyAssembly efficiency
CassettesDigestionSequencing
1234
pJF13ER lumen, HalotagpXF121XF17F/RapXF90pXF854/52/2
pJF17Mitochondrial OM, HalotagpXF121pJF7pXF88pXF854/51/2
pXF253ERES + nuclear pores (NPP-20), GFPpXF121pXF 250pJF6pXF854/62/2
pXF255ERES + nuclear pores (NPP-20), HalotagpXF121pXF 250pXF88pXF855/62/2
pXF266Mitochondrial matrix, HalotagpXF121pXF 262pXF88pXF851/41/1
pSM20Mitochondrial OM, mKate2pXF121pJF7pXF130pXF854/52/2
pSM22Mitochondrial OM, mScarletpXF121pJF7pSM08pXF854/52/2
pSM17Mitochondrial OM, Dendra2pXF121pJF7pSM03pXF854/52/2
pSM16Mitochondrial OM, GFPpXF121pJF7pJF6pXF852/52/2
123A3B4
pSDH68Mitochondrial OM, Halotag, LOVpXF121pSDH50pSDH51PCR fragmentpSDH5411/152/2

Annealed oligos.

Annealed oligos.

Transgenesis

Double-stranded breaks at Mos1 landing sites were generated using CRISPR/Cas9. With the exception of strains EGD623, EGD629, EGD631 and EGD633, injection mixes contained 50 ng/μL of each of the following vectors: an assembled MosSCI targeting vector, pXW7.01 and pXW7.02 sgRNA/Cas9 vectors (gifts from Katya Voronina, University of Montana), which direct Cas9 to generate double-stranded breaks at the universal MosSCI insertion site. For strains EGD623, EGD629, EGD631 and EGD633, injection mixes contained 0.25 μg/μL Cas9 protein, 0.1 μg/μL tracrRNA, 0.028 μg/μL crRNA BH0278 (GCGUCUUCGUACCUUUUUGGGUUUUAGAGCUAUGCUGUUUUG), 0.028 μg/μL crRNA BH0279 (GUCCCAUCGAAGCGAAUAGGGUUUUAGAGCUAUGCUGUUUUG) (Dharmacon) and 0.1 μg/μL assembled MosSCI targeting plasmid. The universal MosSCI strains EG8078 or EG8079 (Frøkjær-Jensen ) were injected, singled and incubated for 10 days at 20°. ∼10 worms from plates containing non-Unc animals were transferred to new plates. Plates that stably gave rise to non-unc progeny were visually screened for fluorescent transgene expression.

HaloTag staining

20 to 30 L4 worms were stained in 25 μL S medium containing concentrated OP50 bacteria and 2.5 μM of either JF549 HaloTag ligand or JF646 HaloTag ligand (Grimm ) in a darkened 96-well plate shaking at 150 rpm for 19 hr at 23°. Water was placed in the neighboring wells to help prevent evaporation. Animals were recovered on NGM plates for up to two hours before imaging.

MitoTracker deep red staining

L4 worms were fed overnight on an NGM plate that had been seeded with 100 μL concentrated OP50 bacteria mixed with 1 μL of 1 mM MitoTracker Deep Red FM dye (Cell Signaling Technology, Cat #8778S).

Imaging

With the exceptions of the TOMM-20::Dendra2 strain and optogenetic strains (Figure 4), all images were collected on a spinning-disk microscope built on a Nikon Eclipse Ti base and equipped with an Andor CSU-W1 two camera spinning disk module, Zyla sCMOS cameras, an Andor ILE laser module and a Nikon 100X Plan Apo 1.45 NA oil immersion objective (Micro Video Instruments, Avon, MA).
Figure 4

Optogenetic control of mitochondrial distribution in the 1-cell embryo. A. Control embryo stained with Mitotracker DeepRed and imaged with 488 nm and 640 nm illumination (640 nm channel shown). B. 1-cell epdz::mcherry::dhc-1; tomm-20::halotag::lov embryo stained with Mitotracker DeepRed and imaged with 488 nm and 640 nm illumination (640 nm channel shown). The 488 nm illumination was used to stimulate the interaction between the ePDZ and LOV domains.

TOMM-20::Dendra2 was imaged on a Marianas spinning disk microscope (Intelligent Imaging Innovations) built around a Zeiss Axio Observer Z.1 equipped with a Photometrics Evolve EMCCD camera, 50 mW 488 and 561 nm solid state lasers, a CSU-X1 spinning disk (Yokogawa, Tokyo Japan) and a Zeiss 100X Plan-Apochromat objective. Photoconversion was performed by 5 sec illumination with a 405 epifluorescent light source. To stimulate the relocalization of mitochondria (Figure 4), embryos were illuminated with a 50 mW 640 nm solid-state laser used to excite MitoTracker DeepRed (20% laser power, 100 msec exposure, camera gain of 1) and a 50 mW 488 nm solid-state laser used to stimulate the interaction between ePDZ and LOV domains (80% laser power and 100 msec exposure). A Plan-Apochromat 100x/1.4 NA oil immersion DIC objective (Zeiss) was used and Z-stacks (one micrometer step size, 11 steps) were collected at 60-second intervals. The images displayed in Figure 4 are maximum intensity projections of three Z planes from the cell midplane.

Data availability

With the exception of EGD633, the C. elegans strains generated in this study have been deposited at the Caenorhabditis Genetics Center (CGC; https://cgc.umn.edu). The plasmids listed in Figures 1 and 3 have been deposited at Addgene (http://www.addgene.org). Other donor plasmids, assembled expression plasmids and EGD633 are available upon request. Supplemental materials describing the sequence of tag donor cassettes are available through the GSA figshare portal: https://doi.org/10.25387/g3.9978611.
Figure 1

SapTrap assembly of MosSCI targeting vectors using the four-cassette system. A. The MosSCI targeting vector pXF87 was derived from pCFJ350 by mutating two SapI restriction sites (indicated by arrowheads in the “Left” (L) and “Right” (R) homology arms) and introducing two SapI sites (blue text) between the XhoI and SpeI sites (green text). SapI cleavage sites are in red text. The SapI recognition sites are oriented such that upon digestion they are removed from the vector backbone. The cbr-unc-119 gene is used as a positive selection marker to facilitate the identification of transgenic animals. B. Design of the donor cassette vectors used for the 4-cassette cloning strategy. C. The curved dotted lines indicate the overhangs that anneal during the ligation reaction. D. Overview of the assembly protocol. For a detailed protocol, see the Materials and Methods section. E. Summary of available promoter, gene tag and 3′UTR donor cassette plasmids.

Figure 3

SapTrap assembly of MosSCI targeting vectors using the five-cassette system. A. Schematic of pXF87 and the donor cassettes following SapI digestion. The dotted lines indicate the overhangs that anneal during ligation. B. Summary of available promoter, gene tag and 3′UTR donor cassette plasmids for the five-cassette system.

SapTrap assembly of MosSCI targeting vectors using the four-cassette system. A. The MosSCI targeting vector pXF87 was derived from pCFJ350 by mutating two SapI restriction sites (indicated by arrowheads in the “Left” (L) and “Right” (R) homology arms) and introducing two SapI sites (blue text) between the XhoI and SpeI sites (green text). SapI cleavage sites are in red text. The SapI recognition sites are oriented such that upon digestion they are removed from the vector backbone. The cbr-unc-119 gene is used as a positive selection marker to facilitate the identification of transgenic animals. B. Design of the donor cassette vectors used for the 4-cassette cloning strategy. C. The curved dotted lines indicate the overhangs that anneal during the ligation reaction. D. Overview of the assembly protocol. For a detailed protocol, see the Materials and Methods section. E. Summary of available promoter, gene tag and 3′UTR donor cassette plasmids.

Results

Adaptation of the SapTrap system for cloning MosSCI targeting vectors

To adapt the SapTrap approach (Schwartz and Jorgensen 2016) for the assembly of MosSCI targeting vectors, we started by making two changes to the universal MosSCI targeting vector pCFJ350 (Frøkjær-Jensen ), which targets transgenes for insertion at the commonly used site (Frøkjær-Jensen ). First, we introduced single base pair changes to disrupt the two SapI restriction sites located in the “Left” and “Right” homology arms of pCFJ350. Second, we inserted two SapI sites into the multiple cloning site that were oriented such that they are removed from the vector backbone by digestion with SapI. The resulting MosSCI targeting vector was named pXF87 (Figure 1A). Although pXF87 is compatible with the standard Mos1-mediated transgenesis protocol, the transgenic strains described in this study were isolated using CRISPR/Cas9 to generate double-stranded breaks in MosSCI integration sites (described in the Methods section). We next cloned a series of plasmids that contain donor cassettes flanked by SapI restriction sites (Figure 1B). Following digestion with SapI, the cassettes are liberated from the vector backbone and are flanked by 5′ overhangs that direct their order of assembly in pXF87 (Figure 1C). A four-insert cassette system was designed with a promoter in cassette 1, gene fragments in cassettes 2 and 3 (typically a gene and a tag) and a 3′UTR in cassette 4 (Figure 1B). To minimize the inclusion of extraneous sequences, the junction between the first and second cassettes is the translation start (ATG), between second and third cassettes is glycine (GGT) and between the third and fourth cassettes is the ochre translation stop codon (TAA) (Figure 1C). Donor cassettes encoding tags (such as fluorescent proteins) include short flexible linkers at the protein fusion site (the carboxy terminus of cassette 2 and the amino terminus of cassette 3) (Supplemental Figure S1- S7). The currently available promoter, tag and 3′UTR donor cassette plasmids are listed in Figure 1E and Table 2. The C. elegans germline is a notoriously difficult tissue in which to achieve stable transgene expression due to silencing of multi-copy extra-chromosomal arrays (Kelly ), single-copy insertions generated by MosSCI (e.g., (Shirayama ; Frøkjær-Jensen )) or endogenous genes tagged using CRISPR/Cas9 gene editing (e.g., (Fielmich )). Each of our tag donor cassettes encoding gene tags incorporates at least one modification that buffers against silencing, including the inclusion of PATC introns in HaloTag and ceGFP (Frøkjær-Jensen ), the elimination of piRNA binding sites in mScarlet, mKate2 and Dendra2 (Seth ; Zhang ) and the use of sequence motifs found in native germline genes in ePDZ and the LOV domain (Fielmich ). Similar to the SapTrap method developed by Schwartz and Jorgensen (Schwartz and Jorgensen 2016), MosSCI targeting vectors were assembled in a single tube by incubating pXF87, four donor cassette plasmids, SapI enzyme, ATP and T4 DNA ligase at 25° for 22 - 24 hr (Figure 1D and Materials and Methods). This reaction was then transformed into E. coli and plasmid clones were screened by restriction enzyme digestion followed by sequencing. We assembled nine vectors using the 4-cassette system and 32 of 46 (69.6%) of the plasmids screened had the correct restriction digest pattern (Table 4). Of the vectors with the correct restriction digest pattern, 22 of 23 were correct based on Sanger sequencing analysis of the cassette junctions. Therefore, the SapTrap method provides an efficient method for the assembly of MosSCI targeting vectors.

A collection of fluorescent ER and mitochondria strains

We used SapTrap-assembled MosSCI targeting vectors to generate a collection of transgenic strains for analysis of endoplasmic reticulum and mitochondrial dynamics. We first targeted GFP, mKate2, mScarlet, Dendra2 and HaloTag to the cytoplasmic face of the mitochondrial outer membrane by fusing them to the carboxy terminus of TOMM-20. The expression of these transgenes was controlled by the promoter and by the 3′UTR, which results in germline expression that increases around the bend of the adult hermaphrodite gonad (Merritt ) (Figure 2A). Strains expressing TOMM-20 fused to HaloTag were labeled with the fluorescent JF646 HaloTag ligand (Grimm ) by feeding hermaphrodites bacteria mixed with the ligand. Each TOMM-20 fusion protein exhibited the expected tubular localization pattern in the early embryo (Figure 2B-I). We confirmed that TOMM-20::HaloTag colocalized to the same organelle as the mitochondrial matrix protein COX-4::GFP (Raiders ) (Figure 2C). We additionally generated strains in which the HaloTag was targeted to the mitochondrial matrix (COX-4::HaloTag) (Figure 2J) and the lumen of the endoplasmic reticulum (HSP-3(aa 1-19)::HaloTag::HDEL) (Figure 2K) (Lee ). We fused both GFP and HaloTag to NPP-20, the worm homolog of SEC13, which is both a component of the COPII coat that concentrates to ER exit sites (ERES) (D’Arcangelo ) and a component of nuclear pore complexes (Siniossoglou ) (Figure 2L, M).
Figure 2

Images of transgenic strains. A. Images of TOMM-20::HaloTag labeled with JF646 HaloTag ligand in the adult gonad (outlined with curved dotted line), including an inset of the region in the stippled box. B. Images of embryos expressing TOMM-20::HaloTag labeled with JF646 HaloTag ligand at the 1-cell, 4 cell and ∼100 cell stages. C. Images of a 4 cell embryo expressing TOMM-20::HaloTag labeled with JF646 HaloTag ligand (magenta) and COX-4::GFP (green) (Raiders ). D – F. Images of embryos expressing the indicated transgenes at the 4-cell stage. G – I. Images of a 4 cell embryo expressing TOMM-20::Dendra2 before and after photoconversion (PC). Dendra2 switches from green to red fluorescence upon photoconversion. J – M. Images of embryos expressing the indicated transgenes at the 1-cell, 4 cell and ∼100 cell stages.

Images of transgenic strains. A. Images of TOMM-20::HaloTag labeled with JF646 HaloTag ligand in the adult gonad (outlined with curved dotted line), including an inset of the region in the stippled box. B. Images of embryos expressing TOMM-20::HaloTag labeled with JF646 HaloTag ligand at the 1-cell, 4 cell and ∼100 cell stages. C. Images of a 4 cell embryo expressing TOMM-20::HaloTag labeled with JF646 HaloTag ligand (magenta) and COX-4::GFP (green) (Raiders ). D – F. Images of embryos expressing the indicated transgenes at the 4-cell stage. G – I. Images of a 4 cell embryo expressing TOMM-20::Dendra2 before and after photoconversion (PC). Dendra2 switches from green to red fluorescence upon photoconversion. J – M. Images of embryos expressing the indicated transgenes at the 1-cell, 4 cell and ∼100 cell stages.

Five-cassette system

One of the advantages of the SapTrap approach is that it can be easily expanded to include additional insert fragments to create more complex transgenes. To establish a five-cassette system, we used the cassettes 1, 2 and 4 from the four-cassette system and replaced cassette 3 with cassettes 3A and 3B (Figure 3A and 3B). We used this approach to generate an optogenetic system to control the localization of mitochondria in the early embryo based on the light induced interaction between the ePDZ and LOV domains (Strickland ; Fielmich ). We assembled a MosSCI targeting vector that directed expression of TOMM-20::HaloTag::LOV, which targets the LOV domain to the mitochondrial outer membrane. 11 of 15 assembled plasmids had the corrected restriction digest pattern and 2 of 2 of these plasmids were correct by Sanger sequence analysis of the cassette junctions. A TOMM-20::HaloTag::LOV strain was crossed with a strain in which the dynein heavy chain DHC-1 was fused to ePDZ (Fielmich ). Whereas mitochondria in wild-type embryos are dispersed through the cytoplasm (Figure 4A), upon the recruitment of ePDZ::mCherry::DHC-1 to mitochondria by stimulation with 488 nm light, mitochondria were transported onto centrosomes, leaving the peripheral cytoplasm largely devoid of mitochondria (Figure 4B). SapTrap assembly of MosSCI targeting vectors using the five-cassette system. A. Schematic of pXF87 and the donor cassettes following SapI digestion. The dotted lines indicate the overhangs that anneal during ligation. B. Summary of available promoter, gene tag and 3′UTR donor cassette plasmids for the five-cassette system. Optogenetic control of mitochondrial distribution in the 1-cell embryo. A. Control embryo stained with Mitotracker DeepRed and imaged with 488 nm and 640 nm illumination (640 nm channel shown). B. 1-cell epdz::mcherry::dhc-1; tomm-20::halotag::lov embryo stained with Mitotracker DeepRed and imaged with 488 nm and 640 nm illumination (640 nm channel shown). The 488 nm illumination was used to stimulate the interaction between the ePDZ and LOV domains.

Discussion

The SapTrap system described here provides an efficient and simple method for the assembly of MosSCI targeting vectors. This approach is similar to the Gateway assembly system (ThermoFisher Scientific) in that once donor cassette plasmids are cloned, they can be assembled in any modular combination. The Gateway system has been widely used to generate MosSCI transgenes and is attractive because there are large collections of promoter, ORF, and 3′UTR donor plasmids available (Brasch ; Dupuy ; Mangone ; Zeiser ). However, the Gateway system has disadvantages, including i) ∼25 bp att recombination sites present between each cassette after assembly, ii) the cost of proprietary enzyme mixes, and iii) the difficulty in assembling more than four cassettes together. In contrast, the SapTrap system i) uses three-base pair junctions, two of which are designed to encode the translation start and STOP codons, ii) is relatively inexpensive, and iii) can efficiently assemble at least 5 cassettes. In principle, the number of cassettes could be increased if desired. The most significant consideration in generating new donor cassette plasmids for SapTrap assembly is that internal SapI sites cannot be present within the donor cassette sequence. Gibson cloning also allows the “scar-free” cloning of transgene vectors, but the specific cloning strategies must be designed for each unique vector. While we have focused on generating transgenes expressed in the hermaphrodite germline, the MosSCI targeting vector pXF87, the gene tag donor cassettes and cloning approach described here should be readily adaptable to expressing transgenes in other tissues. The advantages of tagging and fluorescently labeling proteins with the HaloTag include increased brightness and photostability (especially compared to red fluorescent proteins) and excellent optical pairing with green fluorescent proteins for 2-color imaging. Additionally, HaloTag labeling offers the flexibility to label a single strain with either JF549 HaloTag ligand or JF646 HaloTag ligand (Grimm ). The disadvantages of HaloTag labeling include the need to introduce the fluorescent ligand (for example, using small scale liquid culture) and the cost of the ligand. Additionally, care should be taken to optimize labeling procedures for each protein to maximize labeling efficiency and minimize background from free ligand. In practice, we find that HaloTag labeling is particularly useful when photobleaching of conventional fluorescent proteins is limiting and/or when imaging in far red is advantageous.
  30 in total

1.  Codon adaptation-based control of protein expression in C. elegans.

Authors:  Stefanie Redemann; Siegfried Schloissnig; Susanne Ernst; Andrey Pozniakowsky; Swathi Ayloo; Antony A Hyman; Henrik Bringmann
Journal:  Nat Methods       Date:  2011-01-30       Impact factor: 28.547

Review 2.  ORFeome cloning and systems biology: standardized mass production of the parts from the parts-list.

Authors:  Michael A Brasch; James L Hartley; Marc Vidal
Journal:  Genome Res       Date:  2004-10       Impact factor: 9.043

3.  The landscape of C. elegans 3'UTRs.

Authors:  Marco Mangone; Arun Prasad Manoharan; Danielle Thierry-Mieg; Jean Thierry-Mieg; Ting Han; Sebastian D Mackowiak; Emily Mis; Charles Zegar; Michelle R Gutwein; Vishal Khivansara; Oliver Attie; Kevin Chen; Kourosh Salehi-Ashtiani; Marc Vidal; Timothy T Harkins; Pascal Bouffard; Yutaka Suzuki; Sumio Sugano; Yuji Kohara; Nikolaus Rajewsky; Fabio Piano; Kristin C Gunsalus; John K Kim
Journal:  Science       Date:  2010-06-03       Impact factor: 47.728

4.  The piRNA targeting rules and the resistance to piRNA silencing in endogenous genes.

Authors:  Donglei Zhang; Shikui Tu; Michael Stubna; Wei-Sheng Wu; Wei-Che Huang; Zhiping Weng; Heng-Chi Lee
Journal:  Science       Date:  2018-02-01       Impact factor: 47.728

5.  Sequence requirements for myosin gene expression and regulation in Caenorhabditis elegans.

Authors:  P G Okkema; S W Harrison; V Plunger; A Aryana; A Fire
Journal:  Genetics       Date:  1993-10       Impact factor: 4.562

6.  piRNAs initiate an epigenetic memory of nonself RNA in the C. elegans germline.

Authors:  Masaki Shirayama; Meetu Seth; Heng-Chi Lee; Weifeng Gu; Takao Ishidate; Darryl Conte; Craig C Mello
Journal:  Cell       Date:  2012-06-25       Impact factor: 41.582

7.  PRG-1 and 21U-RNAs interact to form the piRNA complex required for fertility in C. elegans.

Authors:  Pedro J Batista; J Graham Ruby; Julie M Claycomb; Rosaria Chiang; Noah Fahlgren; Kristin D Kasschau; Daniel A Chaves; Weifeng Gu; Jessica J Vasale; Shenghua Duan; Darryl Conte; Shujun Luo; Gary P Schroth; James C Carrington; David P Bartel; Craig C Mello
Journal:  Mol Cell       Date:  2008-06-19       Impact factor: 17.970

8.  MosSCI and gateway compatible plasmid toolkit for constitutive and inducible expression of transgenes in the C. elegans germline.

Authors:  Eva Zeiser; Christian Frøkjær-Jensen; Erik Jorgensen; Julie Ahringer
Journal:  PLoS One       Date:  2011-05-26       Impact factor: 3.240

9.  A general method to improve fluorophores for live-cell and single-molecule microscopy.

Authors:  Jonathan B Grimm; Brian P English; Jiji Chen; Joel P Slaughter; Zhengjian Zhang; Andrey Revyakin; Ronak Patel; John J Macklin; Davide Normanno; Robert H Singer; Timothée Lionnet; Luke D Lavis
Journal:  Nat Methods       Date:  2015-01-19       Impact factor: 28.547

10.  Random and targeted transgene insertion in Caenorhabditis elegans using a modified Mos1 transposon.

Authors:  Christian Frøkjær-Jensen; M Wayne Davis; Mihail Sarov; Jon Taylor; Stephane Flibotte; Matthew LaBella; Andrei Pozniakovsky; Donald G Moerman; Erik M Jorgensen
Journal:  Nat Methods       Date:  2014-03-16       Impact factor: 28.547

View more
  3 in total

1.  Rapid extraction and kinetic analysis of protein complexes from single cells.

Authors:  Sena Sarıkaya; Daniel J Dickinson
Journal:  Biophys J       Date:  2021-10-13       Impact factor: 4.033

2.  phiC31 integrase for recombination-mediated single-copy insertion and genome manipulation in Caenorhabditis elegans.

Authors:  Fang-Jung Yang; Chiao-Nung Chen; Tiffany Chang; Ting-Wei Cheng; Ni-Chen Chang; Chia-Yi Kao; Chih-Chi Lee; Yu-Ching Huang; Jung-Chen Hsu; Jengyi Li; Meiyeh J Lu; Shih-Peng Chan; John Wang
Journal:  Genetics       Date:  2022-02-04       Impact factor: 4.402

3.  Modulating organelle distribution using light-inducible heterodimerization in C. elegans.

Authors:  Tobias B Dansen; Sasha De Henau
Journal:  STAR Protoc       Date:  2021-01-13
  3 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.