Literature DB >> 31579114

Downregulation of long noncoding RNA LINC01419 inhibits cell migration, invasion, and tumor growth and promotes autophagy via inactivation of the PI3K/Akt1/mTOR pathway in gastric cancer.

Lin-Lin Wang1, Lei Zhang2, Xiao-Feng Cui3.   

Abstract

BACKGROUND: Accumulating evidence has highlighted the crucial role of long noncoding RNAs (lncRNAs) in the tumorigenesis of gastric cancer (GC), which is the most common gastrointestinal malignancy. The present study aimed to identify the capacity of lncRNA LINC01419 (LINC01419) in GC progression, with the potential mechanism explored.
METHODS: Highly expressed lncRNAs were identified by in silico analysis, with the LINC01419 expression in GC tissues measured using reverse transcription-quantitative PCR (RT-qPCR). The GC cells were subsequently transfected with siRNA against LINC01419 or Rapamycin (the inhibitor of the mTOR pathway), or both, in order to measure cell migration and invasion in vitro as well as tumor growth and metastasis in vivo. Moreover, the expression of PI3K/Akt1/mTOR pathway-associated factors was determined.
RESULTS: LINC01419, highly expressed in GC samples of the Gene Expression Omnibus database, was observed to be markedly upregulated in GC tissues. Moreover, LINC01419 silencing, or PI3K/Akt1/mTOR pathway inhibition, exhibited an inhibitory role in GC cell migration and invasion in vitro, coupled with promoted cell autophagy in vitro, and inhibited tumor growth and metastasis in vivo. It was also revealed that LINC01419 silencing blocked the PI3K/Akt1/mTOR pathway, as proved by decreased extents of Akt1 and mTOR phosphorylation.
CONCLUSIONS: In conclusion, LINC01419 inhibition may suppress GC cell invasion and migration, and promote autophagy via inhibition of the PI3K/Akt1/mTOR pathway. This provides significant theoretical basis and possibilities for further elucidation of the molecular mechanism of GC and finding new molecular-targeted therapeutic regimens.
© The Author(s), 2019.

Entities:  

Keywords:  LINC01419; RNA; autophagy; gastric cancer; invasion and migration; long noncoding PI3K/Akt1/mTOR pathway

Year:  2019        PMID: 31579114      PMCID: PMC6759708          DOI: 10.1177/1758835919874651

Source DB:  PubMed          Journal:  Ther Adv Med Oncol        ISSN: 1758-8340            Impact factor:   8.168


Introduction

As a major cause of cancer-related deaths worldwide, gastric cancer (GC) continues to be a clinical stumbling block for both patients and health care providers.[1] The risk factors for GC include, smoking, male gender, and atrophic gastritis, all of which have been noted to contribute to the incidence of GC.[2] Most GC patients are diagnosed at more advanced stages, characterized by malignant proliferation, extensive invasion, and lymphatic metastasis, all of which are commonly accompanied with high mortality.[3] In recent times, the foremost therapeutic approach for GC has revolved primarily around gastrectomy procedures.[4] However, in regard to patients suffering with inoperable or metastatic disease, resection may be an impracticable approach. Although GC is curative in its early stages, in patients with advanced-stage GC, the 5-year survival rate remains well below 5% after receiving systemic treatment and placement on other therapeutic regimens.[5] Therefore, it is of great importance that clarity is provided in regard to the mechanism by which GC metastasis operates, in order to discover effective tumor markers in an attempt to improve the overall therapeutic outcomes of patients suffering from this disease. Previous studies have indicated the key role played by long noncoding RNAs (lncRNAs) as primary regulators in biological processes involved with cancer, such as that of H19 and HOTAIR.[6-8] The noncoding transcripts of lncRNA are greater than 200 nucleotides.[9,10] It has been widely investigated in recent years that certain lncRNAs may be involved in a variety of biological processes, including proliferation, invasion, and differentiation.[11,12] Particular lncRNAs exhibit aberrant expression levels in the event of disease, which may lead to carcinogenesis.[13] The upregulation of some lncRNAs has oncogenic effects, while some lncRNAs showed aberrant low expression and exert a tumor suppressive effect.[14] A previous study demonstrated that lncRNA was highly upregulated in liver cancer (HULC) as well as being found in GC, while knockdown of HULC has been shown to contribute to cell apoptosis and inhibition of tumor metastasis.[15] In hepatocellular carcinoma (HCC), the diagnostic value of LINC01419 had been emphasized in previous studies, highlighting the overexpression of LINC01419 as a potential strategic target for the treatment of cancer, in accordance with its early diagnostic and prognostic criteria for HCC.[16] However, the mechanism of action of LINC01419 in GC remains to be investigated. Protein mutations involved in the PI3K/Akt/mTOR pathway may occur as a result of dysregulation of cell growth, proliferation, survival, and angiogenesis.[17] The PI3K/Akt/mTOR pathway is activated in GC, and may represent a possible prognostic target as well as predictor of GC, as reported by Tapia and colleagues.[18] Furthermore, Wang and colleagues asserted the existence of a relationship between the PI3K/Akt/mTOR pathway and GC cell autophagy,[19] while Oshima and Masuda identified a correlation between the upregulation of the PI3k/Akt/mTOR downstream pathway and a worse prognosis, possibly contributing to resistance to chemotherapy.[20] In addition, knockdown of lncRNA antisense noncoding RNA in the INK4 locus inhibits osteosarcoma cell proliferation and invasion, while inducing apoptosis by inactivating the PI3K/Akt/mTOR pathway, in which levels of phosphorylated PI3K and Akt were decreased.[21] Previous evidence and bioinformatics prediction analyses indicated that LINC01419 is upregulated in GC. Thus, we subsequently presented the hypothesis that LINC01419 influences cell migration, invasion, and autophagy in GC, and the underlying mechanism may be related to the PI3K/Akt1/mTOR pathway.

Materials and methods

Ethics statement

All experimental procedures and animal protocols were approved by the Animal Ethics Committee of China-Japan Union Hospital of Jilin University (No. 201702003), and all efforts were made to minimize the suffering of the included animals. All experimental procedures were conducted in strict accordance with the recommendations from the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health. All patients in this study signed an informed consent, which was in accordance with the Helsinki Declaration and approved by the ethics committee of China-Japan Union Hospital of Jilin University (No. 201412005).

Bioinformatics prediction

GC-related lncRNA expression profile data (GSE19826) and annotation probe files were obtained from the Gene Expression Omnibus (GEO) database (http://www.ncbi.nlm.nih.gov/geo), with the datasets detected using the Affymetrix Human Genome U133 plus 2.0 Array. The Affy installation R software package was employed in order to conduct background correction and normalization of each dataset.[22] Next, a linear modeling approach and the empirical Bayes statistics as implemented in the Limma package of the R software as well as the traditional t test forms were employed for the differential analysis of lncRNAs.[23]

Human studies

The current study comprised 43 patients who had undergone GC treatment at the Department of Oncology of China-Japan Union Hospital of Jilin University from January 2015 to February 2018. Among them, 17 patients presented with tumor metastasis whereas 26 patients were free of metastasis. The inclusion criteria of the patients were as follows: all patients were diagnosed by pathology, including clinical symptoms, signs and medical imaging tests; patients had not undergone radiotherapy and chemotherapy prior to the study; clinical and follow-up data were complete; and the patients actively sought treatment. Patients were excluded as follows: patients with surgical contraindications; lack of full understanding of the trial procedure; and those whom other researchers considered unsuitable for sampling. Tumor and paracancerous tissues were obtained from all patients during operations for follow-up studies.

Cell grouping and culture

The GC cells MGC-803, HCG-27, AGS, and SCG-7901, and gastric epithelial cell line CES-1, purchased from American Type Culture Collection (Manassas, VA, USA), were cultured in Roswell Park Memorial Institute (RPMI)-1640 medium containing 10% fetal bovine serum, in a humidified incubator with 5% CO2 in air at 37°C. The adherent cells were passaged and detached using 0.25% trypsin (Hyclone Laboratories, Logan, UT, USA), with cells at the logarithmic phase of growth selected for further experimentation. The experimental cell line MGC-803 was assigned into the following groups: control (without any treatment), negative control (NC) (transfected with empty vector), LINC01419 siRNA (transfected with LINC01419 siRNA vector), Rapamycin (purchased from Selleck, Houston, TX, USA) (treated with 50 nmol/l mTOR inhibitor Rapamycin for 8 h, at 24 h after transfection), and LINC01419 siRNA + Rapamycin (transfected with LINC01419 siRNA vector + 50 nmol/l Rapamycin).

Cell transfection

RNA silencing sequences were designed as siRNA1, siRNA2, siRNA3, and a control sequence si-NC (Table 1). The siRNA exhibiting the highest transfection efficiency was selected by reverse transcription-quantitative PCR (RT-qPCR) experimentation for silencing expression. The cells were seeded into 50 ml culture flasks, and were allowed to grow to a density of 30–50% in a complete medium. Lipofectamine 2000 (Gibco Invitrogen Corporation, Carlsbad, CA, USA) and untransfected RNA or DNA were prepared in sterile Eppendorf (EP) tubes as follows: 5 μl of lipofectamine 2000 and 100 μl of serum-free medium were added and allowed to stand for 5 min at room temperature; untransfected RNA (50 nmol) or DNA (2 μg) and 100 μl of serum-free medium were cultured at room temperature for 20 min in order to allow the liposomes to form a complex with either RNA or DNA. Next, the cells were washed with serum-free medium. Serum-free medium (without antibiotics) was then added to the complex, mixed gently, followed by addition of the complex into a 50 ml culture flask. The cells were incubated with 5% CO2 at 37°C for 6–8 h, and then the medium was replaced with complete medium.
Table 1.

siRNA primer sequence.

SS sequenceAS sequence
siRNA-1GAAAGGUACGCUACUUUAAAGUUAAAGUAGCGUACCUUUCUG
siRNA-2GCGAAGAUCUGCAGCUUCACUUGAAGCUGCAGAUCUUCGCGG
siRNA-3UGCAGAUAAUUCACAGCAAUGUUGCUGUGAAUUAUCUGCACG
siRNA-NCACGCACGGGUUCCCUUCUGAUCAGACCGGAAACCUUGCAAGC

NC, negative control.

siRNA primer sequence. NC, negative control.

Western blot analysis

The previously treated cells were collected from the flasks, and the culture medium was removed. Next, the cells were lysed with prepared radio-immunoprecipitation assay (RIPA) lysis buffer (purchased from Beyotime Co., Shanghai, China) and centrifuged at 14,000 × g for 10 min, followed by collection of the supernatant. Subsequently, the protein concentration was measured using a bicinchoninic acid (BCA) quantitative kit (Solarbio Co., Shanghai, China). After measurement, the protein was separated by 10% separation gel and 5% concentrated gel using a sulfate polyacrylamide gel electrophoresis (SDS-PAGE) gel kit, and transferred to a nitrocellulose membrane by the wet method. The membrane was then blocked with 5% bovine serum albumin (BSA) at room temperature for 1 h, and incubated at 4°C overnight with diluted rabbit polyclonal antibodies to p-Akt1 (ab18206, 1 μg/ml), Akt1 (ab8805, dilution ratio of 1:500), p-mTOR (ab84400, 1 μg/ml), mTOR (ab2732, dilution ratio of 1:2000), LC3B (ab48394, 1 μg/ ml), Beclin1 (ab62557, 1 μg/ml), CatB (ab58802, 1 μg/ml), CatD (ab6313, 1 μg/ml), and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (ab37168, 1 μg/ml). All aforementioned antibodies were purchased from Abcam (Cambridge, MA, USA). The following day, the membrane was further incubated with 5% skim-milk-diluted goat anti-rabbit polyclonal antibody to IgG (ab7312, Abcam, Cambridge, MA, USA). Finally, the membrane was developed using a Bio-Rad gel imaging system (MG8600, Thmorgan Co., Beijing, China) with the IPP7.0 software (Media Cybernetics, Singapore) for quantitative analysis. The ratio of grey values of the p-Akt1, p-mTOR, LC3B, Beclin1, CatB, CatD, Akt1, and mTOR to GAPDH (internal reference) represented the respective protein expression.

Reverse transcription quantitative polymerase chain reaction

Total RNA content from each group was extracted using a miRNeasy Mini Kit (Qiagen, Shanghai, China). A volume of 5 μl RNA was diluted 20-fold with RNase-free ultrapure water. The ratio of optical density (OD) 260 nm/OD 280 nm was measured using an ultraviolet spectrophotometer. A ratio of OD260/OD280 between 1.7 and 2.1 indicated high sample purity, hence used for further experimentation. Based on the instructions of the reverse transcription kit (TransGen Biotech Co., Beijing, China), cDNA was synthesized by reverse transcription reaction using a PCR amplification instrument. Primers of mTOR, Akt1, U6, GAPDH, Beclin1, LC3B, and LINC01419 were designed and synthesized by Sangon Biotech (Shanghai, China) (Table 2). The reverse transcription system comprised 20 μl, and was conducted in accordance with the EasyScript First-Strand cDNA Synthesis Supermix instructions (CA NO. AE301-02, TransGen Biotech Co., Beijing, China). After centrifugation, the mixture was placed in a PCR machine (Model 9700, Beijing Ding Guo Changsheng Biotech Co., Beijing, China) for reverse transcription purposes. Next, fluorescence quantitative PCR was performed using the reaction solution, and was carried out in accordance with the instructions of the SYBR®Premix Ex TaqTM II Kit (TaKaRa, Dalian, Liaoning, China). RT-qPCR was performed using Applied Biosystems ABI 7500 quantitative real-time PCR (ABI Company, Oyster Bay, NY, USA). GAPDH and U6 were used as internal references. The expression levels of Akt1, mTOR, U6, GAPDH, Beclinl, LC3B, and LINC01419 were subsequently evaluated. ΔCt was indicative of the ratio of the target gene expression between the experimental and control group. Ct was representative of the amplification cycles when the real-time fluorescence intensity reached the threshold value, and the amplification was noted to have exhibited logarithmic growth.
Table 2.

Primer sequences of RT-qPCR.

NameSequence
U6F: 5′-AAAGCAAATCATCGGACGACC-3′
R: 5′- GTACAACACATTGTTTCCTCGGA-3′
GAPDHF: 5′-TGTGGGCATCAATGGATTTGG-3′
R: 5′-ACACCATGTATTCCGGGTCAAT-3′
LC3BF: 5′-GGTTTCCCGTCACCAATTTTCC-3′
F: 5′-TGTGGTTTCCAACGTAGAGGA-3′
LINC01419F: 5′-AGCCAAACCTAATAAAACCAGC-3′
F: 5′-ACAGTCTCCCCTTTGTGATTT-3′
Beclin1F: 5′-CAAGATCCTGGACCGTGTCA-3′
R: 5′-TGGCACTTTCTGTGGACATCA-3′
Akt1F: 5′-CCTCCACGACATCGCACTG-3′
R: 5′-TCACAAAGAGCCCTCCATTATCA-3′
mTORF: 5′-GCTAGGTGCATTGACATACAACA-3′
R: 5′-AGTGCTAGTTCACAGATAATGGC-3′

Akt (PKB), protein kinase B; Beclin1, BECN 1; F, forward; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; LC3B, Light chain 3B; mTOR, mechanistic target of rapamycin; R, reverse; RT-qPCR, reverse transcription quantitative polymerase chain reaction; U6, small nuclear ribonucleic acid 6.

Primer sequences of RT-qPCR. Akt (PKB), protein kinase B; Beclin1, BECN 1; F, forward; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; LC3B, Light chain 3B; mTOR, mechanistic target of rapamycin; R, reverse; RT-qPCR, reverse transcription quantitative polymerase chain reaction; U6, small nuclear ribonucleic acid 6.

Flow cytometry

The GC cell line MGC-803 was treated with 50 nmol/l Rapamycin at 24 h after transfection. The cells were detached with trypsin after 8 h, followed by termination of detachment with 10% complete medium. Next, the mixture was centrifuged at 178 × g for 5 min. The collected cells were rinsed with precooled phosphate buffer saline (PBS), fixed with 75% alcohol, and incubated at 4°C overnight. The cells (1 × 106) were counted and incubated for 30 min at 37°C with 50 mg/ml of RNase, and 4 μg/ml of Hoechst33342 was added to the suspension. The suspension was transferred to flow cytometry tubes and placed in a flow cytometer for detection on cell cycle distribution. A total of 20,000 cells were counted, with the proportion of cells at the G0/G1, S, G2/M cycles analyzed.

Scratch test

MGC-803 cells were seeded into a 6-well plate at a density of 5 × 105 cells/well. At 24 h after transfection, 50 nmol/l Rapamycin was added to the plate, and a scratch line drawn using a sterile micropipette tip. The cells were then cultured and photographed at 0 h and 48 h timepoints using an inverted microscope (×100, Olympus CX23, Olympus Optical Co., Tokyo, Japan). Subsequently, the wound healing rate was measured and recorded.

Transwell assay

MGC-803 cells at the logarithmic phase of growth were transfected and treated with 50 nmol/l Rapamycin at 24 h after transfection, followed by collection of cells after 8 h. Matrigel (Becton, Dickinson and Company, Franklin Lakes, NJ, USA) was diluted with precooled serum-free Dulbecco’s Modified Eagle’s Medium (DMEM) medium at a ratio of 1:10, and thoroughly mixed. A volume of 100 μl diluted Matrigel was added to each apical chamber and allowed to stand at room temperature for 2 h. The chambers were then rinsed with 200 μl of serum-free 1640 medium. After being detached, the cells were resuspended in serum-free DMEM medium, counted, and diluted to a density of 3 × 105 cell/ml. Subsequently, 100 μl of suspension was added to the apical chamber of Transwell chamber (Corning Glass Works, Corning, NY, USA). Simultaneously, 600 μl of 1640 medium containing 10% serum (as a chemokine) was added to the basolateral chamber. The number of cells passing through the membrane was counted after eosin staining, in accordance with Transwell chamber instructions.

Immunofluorescence assay

MGC-803 cells at the logarithmic phase of growth were transferred on the coverslip for transfection and treated with 50 nmol/l Rapamycin after 48 h. After 8 h, the coverslip was fixed with 4% paraformaldehyde for 15 min, and subsequently permeabilized with 0.5% Triton X-100 at room temperature for 20 min. Next, normal goat serum was added to the coverslip and blocked at room temperature for 30 min. The coverslip then received a sufficient amount of primary antibody to LC3B (ab48394, 1 μg/ml), and was placed in a wet box and incubated at 4°C overnight. The following day, the fluorescent secondary antibody (Invitrogen, Carlsbad, CA, USA) was added and incubated in a wet box at room temperature for 1 h, followed by the addition of 4’,6-diamidino-2-phenylindole (DAPI) (MultiSciences Biotech Co., Hangzhou, Jiangsu, China) and incubation for 5 min in the dark. Finally, the coverslip was sealed with liquid containing antifluorescence quencher, and observed under a fluorescence microscope (OLYMPUS CX41, Olympus Optical Co., Tokyo, Japan) followed by image collection. Quantitative analysis of fluorescence intensity (the ratio of the number of LC3B puncta to the cell area) was conducted using Image-Pro Plus software.

Electron microscopy examination

MGC-803 cells at the logarithmic phase of growth were transfected and treated with 50 nmol/l Rapamycin at 24 h after transfection. After 8 h, the cells were centrifuged at 178 × g for 10 min and fixed with glutaraldehyde fixation solution for 2–4 h. Next, the cells were rinsed with 0.1 mol/l PBS for 1 h at 4°C, and the buffer was changed three times during the thorough rinsing process. The cells were then soaked in osmic acid fixation solution for 1–2 h at 0–4°C, treated sequentially with 30%, 70%, and 90% acetone for 10 min each in a successive manner, and finally soaked three times (10 min each) in pure acetone. The cells that were fully soaked were then placed in the capsule of the embedding agent, and polymerized in an oven at 37°C for 12 h. The cells were then placed in an oven again at 60°C for 24 h, with the capsule further sliced into semi-thin sections using an ultrathin section machine. After examination using light microscopy, ultrathin sections (40–50 nm) were prepared. The sections were then observed under a transmission electron microscope (JEOL, Japan, Model: JEM-1011) and photographed.

Xenograft tumor model

A total of 25 BALB/C nude mice (undetermined gender, weighing 18–25 g, aged 4 weeks, purchased from Hunan SLAC JingDa Laboratory Animal Co., Changsha, Hunan, China), were raised under specific pathogen-free (SPF) conditions. Next, the nude mice were subcutaneously inoculated with 1 × 106 MGC-803 cells. At5 days after inoculation, the nude mice were randomly assigned into five groups of five mice each: control (blank control); NC (treated with empty vector); LINC01419 siRNA (treated with LINC01419 siRNA vector); Rapamycin (treated with 1.5 mg/kg mTOR inhibitor); and LINC01419 siRNA + Rapamycin (treated with LINC01419 siRNA vector + 1.5 mg/kg mTOR inhibitor). All aforementioned groups were treated once each day as noted. Both inhibitor and siRNA were administered via the tail vein. The tumor volume was monitored once a week, and was calculated using the following formula: V = π/6 (height × length × width). The nude mice were euthanized on the third weekend, with their respective tumors excised. Subsequently, the metastasis of lymph nodes, liver, lungs, and abdominal cavity were observed.

Immunohistochemistry

After the animals were euthanized, the tumor and paracancerous tissues were obtained for routine fixation, embedding, dewaxing, and dehydration. H2O2 was used to eliminate endogenous peroxidase. After microwave antigen-repair, the tissues were blocked with 10% normal goat serum for 20 min, and added with antibodies to VEGF (ab37150, 1 μg/ml) and MMP2 (ab32152,1 μg/ml), and tissues in the NC group were incubated with Tris-buffered saline for 60 min. Following PBS buffer rinsing, the tissues were then incubated with human antibody, secondary antibody (ab6728, 1 μg/ml) for 30 min and rinsed with PBS. After diaminobenzidine development, the tissues were counterstained with hematoxylin and sealed with neutral gum. Subsequently, five high-power visual fields (200 ×) were randomly selected to observe 200 cells in each field. The percentage of positive cells in each field was counted, and the final average value was calculated.

Statistical analysis

Statistical analyses were performed using the SPSS 21.0 software (IBM Corp. Armonk, NY, USA). Measurement data were presented as mean ± standard deviation (SD). The t test was applied for comparisons between two groups, while comparisons among multiple groups were performed using one-way analysis of variance (ANOVA); p < 0.05 was indicative of statistical significance.

Results

LINC01419 expression is upregulated in GC cells

Firstly, bioinformatics analyses were conducted in order to screen a suitable lncRNA for our experiment. Evaluation of the gene expression profile (GSE19826) of GC revealed that LINC01419 was the most markedly upregulated lncRNA in GC (Figure 1a). In order to verify whether LINC01419 was involved in the progression of GC, we collected 43 cases of GC tissues and paracancerous tissues. After collection, the expression of LINC01419 among the tissues was tested using RT-qPCR. The results revealed that the expression of LINC01419 was significantly enriched in GC tissues (Figure 1b), which was consistent with the results of the dataset. Simultaneously, we continued to analyze the expression of LINC01419 in all patients presenting with and without metastasis. The results demonstrated that the expression of LINC01419 in metastatic GC was significantly higher than that in patients without metastasis, suggesting the presence of high expression of LINC01419 in advanced tumor tissues (Figure 1c). Furthermore, by evaluating the expression of LINC01419 in gastric epithelial cell line CES-1, GC cell lines HGC-27, MGC-803, SCG-7901, and AGS, we found that, compared with normal gastric epithelial cell line CES-1, the expression of LINC01419 was significantly increased in other GC cell lines, and the enhancement was most significant in the MGC-803 cell line (Figure 1d). Hence, we selected the MGC-803 cell line for further experimentation. The above results demonstrated that LINC01419 was expressed at a high level in GC tissues and cells.
Figure 1.

Highly expressed LINC01419 is involved in GC identified by bioinformatics prediction and RT-qPCR. (a) Heatmap of differentially expressed lncRNAs in GSE45001 dataset. (b) Expression of LINC01419 in tumor and paracancerous tissues of patients with GC; *p < 0.05 versus the paracancerous tissues. (c) Expression of LINC01419 in metastatic and nonmetastatic tissues of patients with GC; *p < 0.05 versus nonmetastatic tissues. (d) Expression of LINC01419 in gastric epithelial and GC cell lines; *p < 0.05 versus the CES-1 cell line; statistical data were measurement data, and described as mean ± standard deviation; the paired t test was used for comparison between the two groups, and the one-way ANOVA was used for comparison among multiple groups followed by Tukey’s post hoc test.

ANOVA, one-way analysis of variance; GC, gastric cancer; RT-qPCR, reverse transcription quantitative polymerase chain reaction.

Highly expressed LINC01419 is involved in GC identified by bioinformatics prediction and RT-qPCR. (a) Heatmap of differentially expressed lncRNAs in GSE45001 dataset. (b) Expression of LINC01419 in tumor and paracancerous tissues of patients with GC; *p < 0.05 versus the paracancerous tissues. (c) Expression of LINC01419 in metastatic and nonmetastatic tissues of patients with GC; *p < 0.05 versus nonmetastatic tissues. (d) Expression of LINC01419 in gastric epithelial and GC cell lines; *p < 0.05 versus the CES-1 cell line; statistical data were measurement data, and described as mean ± standard deviation; the paired t test was used for comparison between the two groups, and the one-way ANOVA was used for comparison among multiple groups followed by Tukey’s post hoc test. ANOVA, one-way analysis of variance; GC, gastric cancer; RT-qPCR, reverse transcription quantitative polymerase chain reaction.

Silencing of LINC01419 inhibits activation of the PI3K/Akt1/mTOR pathway and promotes autophagic cell death

As the results above suggested that LINC01419 was highly expressed in GC, in order to elucidate the effect of LINC01419 on the biological function of GC cell lines, we aimed to reduce expression of LINC01419 by constructing specific interfering sequences of LINC01419, and measured the changes in related biological functions. Subsequently, we designed three siRNA sequences for LINC01419, and one NC sequence. The results of RT-qPCR screening showed that, compared with the interference efficiency of NC, that of siRNA-1 and siRNA-2 was significantly lower (over 70%). The interference efficiency of siRNA-2 was found to be highest, so LINC01419 siRNA-2 was chosen for further experimentation (Figure 2a).
Figure 2.

The PI3K/Akt1/mTOR pathway is blocked through LINC01419 gene silencing. (a) LINC01419 expression in siRNA-NC, siRNA1, siRNA2, and siRNA3; *p < 0.05 versus siRNA-NC. (b) Grey value of Akt1, p-Akt1, mTOR, p-mTOR, Beclin1, LC3BI, and LC3BII protein bands in the MGC-803 cells transfected with LINC01419 siRNA, Rapamycin and LINC01419 siRNA + Rapamycin. (c) Protein expression of Beclin1, LC3BII/I, as well as the extents of Akt1 and mTOR phosphorylation in the MGC-803 cells transfected with LINC01419 siRNA, Rapamycin and LINC01419 siRNA + Rapamycin evaluated by Western blot analysis. (d) LINC01419 expression and mRNA expressions of Beclin1, LC3B, Akt1, and mTOR in the MGC-803 cells transfected with LINC01419 siRNA, Rapamycin and LINC01419 siRNA + Rapamycin determined by RT-qPCR; *p < 0.05 versus the control and NC groups; #p < 0.05 versus the Rapamycin group; PI3K/Akt1/mTOR, phosphatidylinositol 3-kinase/Akt1/mammalian target of rapamycin; measurement data were presented as mean ± standard deviation and compared by one-way ANOVA followed by Tukey’s post hoc test; the experiment was repeated three times to obtain the mean value.

ANOVA, one-way analysis of variance; NC, negative control.

The PI3K/Akt1/mTOR pathway is blocked through LINC01419 gene silencing. (a) LINC01419 expression in siRNA-NC, siRNA1, siRNA2, and siRNA3; *p < 0.05 versus siRNA-NC. (b) Grey value of Akt1, p-Akt1, mTOR, p-mTOR, Beclin1, LC3BI, and LC3BII protein bands in the MGC-803 cells transfected with LINC01419 siRNA, Rapamycin and LINC01419 siRNA + Rapamycin. (c) Protein expression of Beclin1, LC3BII/I, as well as the extents of Akt1 and mTOR phosphorylation in the MGC-803 cells transfected with LINC01419 siRNA, Rapamycin and LINC01419 siRNA + Rapamycin evaluated by Western blot analysis. (d) LINC01419 expression and mRNA expressions of Beclin1, LC3B, Akt1, and mTOR in the MGC-803 cells transfected with LINC01419 siRNA, Rapamycin and LINC01419 siRNA + Rapamycin determined by RT-qPCR; *p < 0.05 versus the control and NC groups; #p < 0.05 versus the Rapamycin group; PI3K/Akt1/mTOR, phosphatidylinositol 3-kinase/Akt1/mammalian target of rapamycin; measurement data were presented as mean ± standard deviation and compared by one-way ANOVA followed by Tukey’s post hoc test; the experiment was repeated three times to obtain the mean value. ANOVA, one-way analysis of variance; NC, negative control. Firstly, we determined the changes in expression of related proteins using Western blot analysis. The results demonstrated no significant change between the blank and NC groups (p > 0.05), while the protein expressions of Beclin1 and LC3BII/I were increased, and the extent of Akt1 and mTOR phosphorylation was decreased in the LINC01419 siRNA group and the Rapamycin group relative to the NC group (p < 0.05). Furthermore, the LINC01419 siRNA + Rapamycin group presented with the highest levels of LC3BII/I and Beclin1, while the extent of Akt1and mTOR phosphorylation was downregulated in comparison with the Rapamycin group (all p < 0.05). The protein expression levels of mTOR and Akt1 were essentially the same in all groups (Figure 2b,c). Meanwhile, the results of RT-qPCR showed that there were no significant changes in mRNA expressions of related genes between the control group and the NC group. Compared with the NC group, the mRNA expressions of Beclin1 and LC3B were found to be increased in the LINC01419 siRNA group and Rapamycin groups, and reached peak values in the LINC01419 siRNA + Rapamycin group (all p < 0.05). The expression of LINC01419 in the control, NC, and Rapamycin groups showed no distinct differences (p > 0.05); however, it was significantly reduced in the LINC01419 siRNA + Rapamycin and LINC01419 siRNA groups (p < 0.05). The expression of mTOR and Akt1 mRNA showed no significant differences among all groups (p > 0.05). In comparison with the Rapamycin group, the LINC01419 expression of the LINC01419 siRNA and LINC01419 siRNA + Rapamycin groups decreased significantly, and the mRNA expressions of Bechin1 and LC3B were significantly increased (p < 0.05) (Figure 2d). These results demonstrated that the PI3K/Akt1/mTOR pathway was suppressed as a result of LINC01419 silencing, which may further promote the expression of autophagy-related proteins in GC cells.

LINC01419 silencing decreases MGC-803 cell migration ability

A Scratch test was performed in order to determine the inhibitory effect associated with downregulation of LINC01419 on cell migration, the results of which are illustrated in Figure 3. No significant differences were detected between the control group and the NC group (p > 0.05). However, the cell migration ability in the LINC01419 siRNA and Rapamycin groups presented significant decreases in relation to cell migration ability, with the LINC01419 siRNA + Rapamycin group exhibiting the weakest ability compared with the control and NC groups (p < 0.05). The cell migration ability of the LINC01419 siRNA + Rapamycin group was significantly reduced in comparison with the Rapamycin group (p < 0.05). These findings indicated that MGC-803 cell migration could be prevented by LINC01419 silencing or mTOR signaling pathway inhibition.
Figure 3.

MGC-803 cell migration ability is inhibited by LINC01419 silencing and mTOR inhibition. (a) Wound healing images of MGC-803 cell through the scratch test. (b) Statistical chart of cell migration rate; *p < 0.05 versus the control and NC groups; #p < 0.05 versus the Rapamycin group; mTOR, mammalian target of rapamycin; measurement data were presented as mean ± standard deviation and compared by one-way ANOVA followed by Tukey’s post hoc test; the experiment was repeated three times to obtain the mean value.

ANOVA, one-way analysis of variance; NC, negative control.

MGC-803 cell migration ability is inhibited by LINC01419 silencing and mTOR inhibition. (a) Wound healing images of MGC-803 cell through the scratch test. (b) Statistical chart of cell migration rate; *p < 0.05 versus the control and NC groups; #p < 0.05 versus the Rapamycin group; mTOR, mammalian target of rapamycin; measurement data were presented as mean ± standard deviation and compared by one-way ANOVA followed by Tukey’s post hoc test; the experiment was repeated three times to obtain the mean value. ANOVA, one-way analysis of variance; NC, negative control.

LINC01419 silencing inhibits MGC-803 cell invasion ability

Additionally, a Transwell assay was adopted in order to determine the effect of LINC01419 downregulation on GC cell invasion, the results of which indicated that cell invasion abilities were not significantly different among the control group and the NC group (p > 0.05). However, the cell invasion ability in the LINC01419 siRNA and Rapamycin groups exhibited marked decreases, with the cell invasion ability of the LINC01419 siRNA + Rapamycin group determined to be the weakest (p < 0.05). The invasive ability of the LINC01419 siRNA + Rapamycin group was found to be significantly diminished compared with the Rapamycin group (p < 0.05) (Figure 4). These findings revealed that MGC-803 cell invasion could be prevented by LINC01419 silencing and or mTOR signaling pathway inhibition.
Figure 4.

MGC-803 cell invasion ability is prevented by LINC01419 silencing and mTOR inhibition. (a) Cells passing through the bottom chamber were stained with crystal violet. (b) Statistical results of the number of the cells passing through the bottom chamber; *p < 0.05 versus the control and NC groups; #p < 0.05 versus the Rapamycin group; measurement data were presented as mean ± standard deviation and compared by one-way ANOVA followed by Tukey’s post hoc test; the experiment was repeated three times to obtain the mean value.

ANOVA, one-way analysis of variance; mTOR, mammalian target of rapamycin; NC, negative control.

MGC-803 cell invasion ability is prevented by LINC01419 silencing and mTOR inhibition. (a) Cells passing through the bottom chamber were stained with crystal violet. (b) Statistical results of the number of the cells passing through the bottom chamber; *p < 0.05 versus the control and NC groups; #p < 0.05 versus the Rapamycin group; measurement data were presented as mean ± standard deviation and compared by one-way ANOVA followed by Tukey’s post hoc test; the experiment was repeated three times to obtain the mean value. ANOVA, one-way analysis of variance; mTOR, mammalian target of rapamycin; NC, negative control.

LINC01419 silencing and inhibition of the PI3K/Akt1/mTOR pathway promote MGC-803 cell autophagy

In order to observe the changes of autophagy after treatment, we first observed the aggregation of autophagy marker LC3B using immunofluorescence. LC3B was represented by a dot-like aggregation in the cytoplasm. A significant elevation of LC3B expression was observed in the LINC01419 siRNA and Rapamycin groups, with the expression of LC3B noted to be the highest in the LINC01419 siRNA + Rapamycin group (p < 0.05). Relative to the Rapamycin group, LC3B aggregation was relatively denser in the LINC01419 siRNA + Rapamycin group (Figure 5a,b). Observations of autophagosomes and other autophagic structures under transmission electron microscopy served as the most optimal approach to verify the occurrence of autophagy. A few vesicle-like structures were observed surrounding the cytoplasm and autophagy lysosome structure in the control group. No significant differences were noted among the cells of control group and the NC group (p > 0.05), while a greater amount of vesicle-like structures surrounding the cytoplasm were observed in the LINC01419 siRNA group and the Rapamycin group, in addition to the autophagic lysosomal structure formed by their fusion with lysosomes. The vesicle-like structures, as well as autophagic lysosomal structure, presented the highest number in the LINC01419 siRNA + Rapamycin group in comparison with the Rapamycin treatment alone (Figure 5c).
Figure 5.

LINC01419 siRNA and Rapamycin treatment promotes MGC-803 cell autophagy. (a) Immunofluorescence staining, where LC3B indicates the localization of LC3B in the cells, DAPI indicates nuclear localization, and Merge indicates localization of both. (b) Fluorescence intensity of LC3B in cells transfected with LINC01419 siRNA, Rapamycin, and LINC01419 siRNA + Rapamycin. (c) Observation of autophagic structure of GC cells in each group by transmission electron microscope, where arrows indicate autophagy lysosomes. (d) Gray value of CatB and CatD protein bands in response to LINC01419 siRNA, Rapamycin, and LINC01419 siRNA + Rapamycin treatment assessed by Western blot analysis. (e) Protein expression of CatB and CatD in response to LINC01419 siRNA, Rapamycin, and LINC01419 siRNA + Rapamycin treatment assessed by Western blot analysis; measurement data were presented as mean ± standard deviation and compared by one-way ANOVA followed by Tukey’s post hoc test; *p < 0.05 versus the NC group; #p < 0.05 versus the Rapamycin group; the experiment was repeated three times.

ANOVA, one-way analysis of variance; Cat, cathepsins; DAPI, 4’,6-diamidino-2-phenylindole; LC3B, light chain 3B; mTOR, mammalian target of rapamycin; NC, negative control.

LINC01419 siRNA and Rapamycin treatment promotes MGC-803 cell autophagy. (a) Immunofluorescence staining, where LC3B indicates the localization of LC3B in the cells, DAPI indicates nuclear localization, and Merge indicates localization of both. (b) Fluorescence intensity of LC3B in cells transfected with LINC01419 siRNA, Rapamycin, and LINC01419 siRNA + Rapamycin. (c) Observation of autophagic structure of GC cells in each group by transmission electron microscope, where arrows indicate autophagy lysosomes. (d) Gray value of CatB and CatD protein bands in response to LINC01419 siRNA, Rapamycin, and LINC01419 siRNA + Rapamycin treatment assessed by Western blot analysis. (e) Protein expression of CatB and CatD in response to LINC01419 siRNA, Rapamycin, and LINC01419 siRNA + Rapamycin treatment assessed by Western blot analysis; measurement data were presented as mean ± standard deviation and compared by one-way ANOVA followed by Tukey’s post hoc test; *p < 0.05 versus the NC group; #p < 0.05 versus the Rapamycin group; the experiment was repeated three times. ANOVA, one-way analysis of variance; Cat, cathepsins; DAPI, 4’,6-diamidino-2-phenylindole; LC3B, light chain 3B; mTOR, mammalian target of rapamycin; NC, negative control. After transfection, Western blot analysis was employed in order to determine the changes in the expressions of CatB and CatD (Figure 5d,e). There were no significant differences between the control and NC groups in CatB and CatD expressions (p > 0.05). Nevertheless, the CatB and CatD expressions in the LINC01419 siRNA and Rapamycin groups were found to be significantly higher than those in the NC group (p < 0.05). Compared with the Rapamycin group, the expressions of CatB and CatD in the LINC01419 siRNA + Rapamycin group were significantly elevated (p < 0.05), indicating that LINC01419 siRNA and Rapamycin treatment significantly increased the lysosomal activity of autophagy. Taken together, the findings suggested that MGC-803 cell autophagy could be enhanced by LINC01419 silencing and mTOR signaling pathway inhibition.

LINC01419 silencing and disruption of the PI3K/Akt1/mTOR pathway suppress GC growth

The tumor formation ability in nude mice after transfection with a serial of inhibitors and siRNAs was determined by means of the application of a xenograft tumor model in nude mice. The results indicated that tumor volume gradually increased with the passage of time. Initial findings indicated there were no significant difference in terms of tumor volume among each group (p > 0.05). At weeks 1, 2 and 3, in contrast to the control group, the tumor volume in the NC group showed no distinct differences, but significant declines were noted in the LINC01419 siRNA and Rapamycin groups. In addition, the smallest tumor was identified in the LINC01419 siRNA + Rapamycin group (Figure 6a,b). Finally, the tumor weight of mice in each group was calculated after the mice were euthanized. The results showed that there were no significant differences in tumor weight between the control and NC groups, but the tumor weight of the LINC01419 siRNA group and the Rapamycin group was significantly lower than that of the control and NC groups. Cotreatment of LINC01419 siRNA and Rapamycin significantly reduced the tumor weight relative to individual Rapamycin treatment (Figure 6c). These findings demonstrated that LINC01419 silencing and mTOR signaling pathway inhibition functioned as GC suppressors.
Figure 6.

GC growth is suppressed by LINC01419 silencing and mTOR inhibition. (a) GC volumes in mice treated with LINC01419 siRNA, Rapamycin and LINC01419 siRNA + Rapamycin. (b) Statistical chart of tumor volume. (c) Tumor weight in mice treated with LINC01419 siRNA, Rapamycin, and LINC01419 siRNA + Rapamycin; *p < 0.05 versus the NC group; #p < 0.05 versus the Rapamycin group; mTOR, mammalian target of rapamycin; siRNAs, small interfering RNAs; GC, gastric cancer; measurement data were presented as mean ± standard deviation and compared by one-way ANOVA followed by Tukey’s post hoc test; the experiment was repeated three times to obtain the mean value.

ANOVA, one-way analysis of variance; GC, gastric cancer; mTOR, mammalian target of rapamycin.

GC growth is suppressed by LINC01419 silencing and mTOR inhibition. (a) GC volumes in mice treated with LINC01419 siRNA, Rapamycin and LINC01419 siRNA + Rapamycin. (b) Statistical chart of tumor volume. (c) Tumor weight in mice treated with LINC01419 siRNA, Rapamycin, and LINC01419 siRNA + Rapamycin; *p < 0.05 versus the NC group; #p < 0.05 versus the Rapamycin group; mTOR, mammalian target of rapamycin; siRNAs, small interfering RNAs; GC, gastric cancer; measurement data were presented as mean ± standard deviation and compared by one-way ANOVA followed by Tukey’s post hoc test; the experiment was repeated three times to obtain the mean value. ANOVA, one-way analysis of variance; GC, gastric cancer; mTOR, mammalian target of rapamycin.

LINC01419 silencing and suppression of the PI3K/Akt1/mTOR pathway prevent GC from metastasis

Table 3 shows that, compared with the control and NC groups, the number of nude mice with tumor metastasis was decreased in the LINC01419 siRNA and Rapamycin groups, while that in the LINC01419 siRNA + Rapamycin group was the least, with only one nude mouse presenting with tumor metastasis. Subsequently, the expressions of MMP2 and VEGF in tumor tissues of nude mice were tested using immunohistochemistry. Compared with the control and NC groups, the positive rate of MMP2 and VEGF in the LINC01419 siRNA and Rapamycin groups was found to be lowered, and MMP2 and VEGF expression levels were lowest in the LINC01419 siRNA + Rapamycin group (Figure 7). The results showed that both LINC01419 siRNA and Rapamycin could delay tumor metastasis, and the combined effect yielded better results.
Table 3.

Blocked LINC01419 and PI3K/Akt/mTOR pathway repress metastatic status of xenografts in nude mice.

GroupsLiverLungLymph nodesAbdominal cavityTotal
Control40% (2/5)60% (3/5)40% (2/5)60% (3/5)80% (4/5)
NC40% (2/5)60% (3/5)40% (2/5)60% (3/5)80% (4/5)
LINC01419 siRNA20% (1/5)40% (2/5)20% (1/5)40% (2/5)40% (2/5)
Rapamycin20% (1/5)40% (2/5)20% (1/5)40% (2/5)40% (2/5)
LINC01419 siRNA + Rapamycin20% (1/5)20% (1/5)0020% (1/5)

Liver, intra-abdominal, lymph node, and lung metastasis were calculated according to the number of metastatic nude mice, and the total metastasis was also calculated according to the number of metastatic nude mice, some of which had multiple organ metastasis at the same time.

Figure 7.

LINC01419 combined with Rapamycin downregulates the expressions of MMP2 and VEGF. (a) Expression of MMP2 in the presence of LINC01419 siRNA, Rapamycin, or both. (b) Expression of VEGF in the presence of LINC01419 siRNA, Rapamycin, or both; *p < 0.05 versus the NC group; #p < 0.05 versus the Rapamycin group; measurement data were presented as mean ± standard deviation and compared by one-way ANOVA followed by Tukey’s post hoc test; the experiment was repeated three times.

ANOVA, one-way analysis of variance; GC, gastric cancer; mTOR, mammalian target of rapamycin; NC, negative control; siRNAs, small interfering RNAs.

Blocked LINC01419 and PI3K/Akt/mTOR pathway repress metastatic status of xenografts in nude mice. Liver, intra-abdominal, lymph node, and lung metastasis were calculated according to the number of metastatic nude mice, and the total metastasis was also calculated according to the number of metastatic nude mice, some of which had multiple organ metastasis at the same time. LINC01419 combined with Rapamycin downregulates the expressions of MMP2 and VEGF. (a) Expression of MMP2 in the presence of LINC01419 siRNA, Rapamycin, or both. (b) Expression of VEGF in the presence of LINC01419 siRNA, Rapamycin, or both; *p < 0.05 versus the NC group; #p < 0.05 versus the Rapamycin group; measurement data were presented as mean ± standard deviation and compared by one-way ANOVA followed by Tukey’s post hoc test; the experiment was repeated three times. ANOVA, one-way analysis of variance; GC, gastric cancer; mTOR, mammalian target of rapamycin; NC, negative control; siRNAs, small interfering RNAs.

Supplementary result

LINC01419 silencing could arrest GC cell cycle

The effect of LINC01419 downregulation on GC cell cycle arrest was determined by means of flow cytometry. The results revealed that GC cell cycle with different treatment was as follows: at G0/G1 phase, proportions of control cells, NC, LINC01419 siRNA, Rapamycin, and LINC01419 siRNA + Rapamycin groups were (30.6% ± 3.96%), (29.6% ± 3.01%), (39.7% ± 2.64%), (40.23% ± 3.22%), and (45.16% ± 4.12%), respectively. In S phase, the cell proportions of control cells, NC, LINC01419 siRNA, Rapamycin, and LINC01419 siRNA + Rapamycin groups were (54.53% ± 4.27%), (55.76% ± 4.32%), (45.8% ± 1.76%), (45.31% ± 2.95%), and (40.29% ± 2.76%), respectively. In G2/M phase, the cell proportions of control cells, NC, LINC01419 siRNA, Rapamycin, and LINC01419 siRNA + Rapamycin groups were (14.87% ± 3.86%), (14.64% ± 3.42%), (14.5% ± 2.95%), (14.46% ± 2.78%), and (14.55% ± 3.13%), respectively. These findings suggested that the MGC-803 cell cycle could be arrested at G0/G1 phase, whilst not completely entering into S phase, which was achieved through LINC01419 silencing or Rapamycin treatment (p < 0.05) (online Supplementary Figure 1a,b). This highlighted that LINC01419 silencing or mTOR signaling pathway inhibition blocked cell cycle entry of MGC-803 cells.

Discussion

GC is a disease that affects millions of people worldwide, and represents one of the most prevalent diseases in East Asia, with high rates of recurrence and metastasis rendering the disease difficult to treat.[24] Interestingly, previous reports have demonstrated that the deregulation of lncRNAs may affect the development, progression, and metastasis of GC[14,25]; however, the exact mechanism by which LINC01419 influences GC remains largely unknown. Therefore, the current study aimed to investigate the effect of LINC01419 on GC through the PI3K/Akt1/mTOR pathway. On the whole, our findings indicated that LINC01419 silencing could inhibit the activation the PI3K/Akt1/mTOR pathway, leading to inhibition of the invasion and migration of GC cells as well as the promotion of autophagy. Firstly, LINC01419 was observed to exhibit high expression in GC according to the results of RT-qPCR. In addition, the findings of the current study revealed that downregulation of LINC01419 could inhibit cell invasion, migration, metastasis, and tumor growth, as well as promote autophagy in GC, thus playing a protective role against the progression of GC. In addition, LINC01419 was silenced in GC cells after they were treated with Rapamycin (a kind of mTOR protein inhibitor), demonstrating more distinct inhibitory effects of LINC01419 silencing on GC proliferation and migration, and a promoting influence on cell autophagy. LncRNAs, including many different types, play crucial roles in numerous developmental and differentiation processes.[26] In addition, significant evidence has indicated that lncRNA deregulation may influence the development, progression, and metastasis of GC.[14,25] Particularly, LINC01419 was reported to be overexpressed in HCC,[12] lung squamous cell carcinoma, and lung adenocarcinoma,[13] suggesting a role for lncRNAs in cancer. Furthermore, LINC01419 could be employed as an auxiliary diagnostic index for HCC.[16] Additionally, Akt1 has been reported to decrease the expression of p27 and elevate that of cyclin D1, thus positively modulating G1/S cell cycle progression.[27] Our findings indicate that the extent of mTOR and Akt1 phosphorylation was decreased after downregulation of LINC01419, indicating disruption of the PI3K/Akt1/mTOR pathway. Moreover, increased protein and mRNA expressions of LC3B and Beclin1 were observed to be correlated with silencing of LINC01419. Similarly, overactivation of the PI3K/Akt/mTOR pathway was recently implicated in the pathogenesis of endometrial cancer, with reports suggesting that inhibition of the PI3K/Akt/mTOR pathway could serve as an optimistic treatment target.[28] Another study also revealed that upregulation of survivin by Akt and HIF-1a contributes to cisplatin (CDDP) resistance, and inhibition of these pathways may be a potential therapeutic target allowing for alleviated levels of CDDP resistance in the treatment of GC.[29] Furthermore, studies have demonstrated that the ability of neurons to clear abnormal protein aggregates and survive could be enhanced by induction of autophagy.[30] The process of recycling or clearing of obsolete cellular constituents, damaged organelles, and protein aggregates is commonly referred to as autophagy.[31] In addition, a previous study reported that induced Akt directly activates downstream mTORC1 and ultimately contributes to the inhibition of autophagy.[32] Lee and colleagues reported that the autophagy-inducing effect was indicated by enhanced protein expression of LC3-II conversion through the downregulation of PI3K/Akt/mTOR pathway the in GC cell lines AGS and MKN28 cells.[33] Evidence has been provided revealing that the loss expression of autophagy-related genes may be associated with tumorigenesis of conditions such as colorectal adenocarcinoma, amongst which Beclin1 and LC3B have been discussed.[34] Beclin1 and LC3B are two commonly investigated autophagy-markers, with the upregulation of LC3B thought to be of great prognostic value for GC than Beclin1 as reported by He and colleagues.[35] Moreover, the absence of LC3B linked with downregulated expressions of Beclin-1 could contribute to the unsatisfied prognostic results of GC.[36] Specifically, an enhancement in the extent of PI3K, Akt, and mTOR phosphorylation was reported to be involved in the decline of LC3B-II in HCC.[37] However, in this study, the potential association between LINC01419 and the PI3K/Akt/mTOR signaling pathway requires further exploration, verifying specific molecular targets verified by more experiments, such as RNA immunoprecipitation (RIP), cross-linking immunoprecipitation (CLIP), chromatin immunoprecipitation (CHIP), and fluorescence in situ hybridization (FISH). In conclusion, the current study demonstrated that downregulation of LINC01419 leads to the inhibition of the invasion and migration as well as the promotion of autophagy in human GC cell line MGC-803. The consequent inhibition of PI3K/Akt1/mTOR pathway might be closely involved in the aforementioned effects. These findings provide a better understanding of the pro-tumor effects and the underlying mechanisms of lncRNAs in the field of GC therapy. The data in our study suggest that LINC01419-mediated PI3K/Akt1/mTOR axis may be a promising therapeutic target in GC treatment. However, we were not able to investigate the role of LINC01419 in a tubule-specific LINC01419 transgenic mouse, which may yield more convincing evidence. Moreover, the precise sites mediating the association between FEZF1-AS1 and PI3K/Akt1/mTOR were not identified. Thus, more detailed studies will be needed to completely elucidate the molecular cross-talk involved. Click here for additional data file. Supplemental material, TAM874651_supp_fig for Downregulation of long noncoding RNA LINC01419 inhibits cell migration, invasion, and tumor growth and promotes autophagy via inactivation of the PI3K/Akt1/mTOR pathway in gastric cancer by Lin-Lin Wang, Lei Zhang and Xiao-Feng Cui in Therapeutic Advances in Medical Oncology
  37 in total

1.  Up-regulated long non-coding RNA H19 contributes to proliferation of gastric cancer cells.

Authors:  Feng Yang; Jianwei Bi; Xuchao Xue; Luming Zheng; Kangkang Zhi; Jide Hua; Guoen Fang
Journal:  FEBS J       Date:  2012-07-31       Impact factor: 5.542

2.  Gastric cancer: ESMO-ESSO-ESTRO Clinical Practice Guidelines for diagnosis, treatment and follow-up.

Authors:  T Waddell; M Verheij; W Allum; D Cunningham; A Cervantes; D Arnold
Journal:  Ann Oncol       Date:  2013-10       Impact factor: 32.976

3.  The PI3K/AKT/mTOR pathway is activated in gastric cancer with potential prognostic and predictive significance.

Authors:  Oscar Tapia; Ismael Riquelme; Pamela Leal; Alejandra Sandoval; Susana Aedo; Helga Weber; Pablo Letelier; Enrique Bellolio; Miguel Villaseca; Patricia Garcia; Juan Carlos Roa
Journal:  Virchows Arch       Date:  2014-05-21       Impact factor: 4.064

4.  M4IDP, a zoledronic acid derivative, induces G1 arrest, apoptosis and autophagy in HCT116 colon carcinoma cells via blocking PI3K/Akt/mTOR pathway.

Authors:  Ying Peng; Ling Qiu; Dong Xu; Li Zhang; Huixin Yu; Yuedi Ding; Lili Deng; Jianguo Lin
Journal:  Life Sci       Date:  2017-07-24       Impact factor: 5.037

Review 5.  [PI3K-AKT-mTOR pathway and cancer].

Authors:  Laetitia Coutte; Chantal Dreyer; Marie-Paule Sablin; Sandrine Faivre; Eric Raymond
Journal:  Bull Cancer       Date:  2012-02-01       Impact factor: 1.276

6.  Long non-coding RNA SNHG1 regulates zinc finger E-box binding homeobox 1 expression by interacting with TAp63 and promotes cell metastasis and invasion in Lung squamous cell carcinoma.

Authors:  Hong-Yan Zhang; Wei Yang; Fu-Shuang Zheng; Yi-Bei Wang; Ji-Bin Lu
Journal:  Biomed Pharmacother       Date:  2017-04-14       Impact factor: 6.529

Review 7.  Long non-coding RNAs: new players in cell differentiation and development.

Authors:  Alessandro Fatica; Irene Bozzoni
Journal:  Nat Rev Genet       Date:  2013-12-03       Impact factor: 53.242

8.  A central role for long non-coding RNA in cancer.

Authors:  Sheetal A Mitra; Anirban P Mitra; Timothy J Triche
Journal:  Front Genet       Date:  2012-02-15       Impact factor: 4.599

9.  Pectolinarigenin Induced Cell Cycle Arrest, Autophagy, and Apoptosis in Gastric Cancer Cell via PI3K/AKT/mTOR Signaling Pathway.

Authors:  Ho Jeong Lee; Venu Venkatarame Gowda Saralamma; Seong Min Kim; Sang Eun Ha; Suchismita Raha; Won Sup Lee; Eun Hee Kim; Sang Joon Lee; Jeong Doo Heo; Gon Sup Kim
Journal:  Nutrients       Date:  2018-08-08       Impact factor: 5.717

10.  Long non-coding RNA expression profiles of hepatitis C virus-related dysplasia and hepatocellular carcinoma.

Authors:  Haohai Zhang; Chengpei Zhu; Yi Zhao; Ming Li; Liangcai Wu; Xiaobo Yang; Xueshuai Wan; Anqiang Wang; Michael Q Zhang; Xinting Sang; Haitao Zhao
Journal:  Oncotarget       Date:  2015-12-22
View more
  22 in total

1.  KIFC3 Promotes Proliferation, Migration, and Invasion in Colorectal Cancer via PI3K/AKT/mTOR Signaling Pathway.

Authors:  Huiling Liao; Lan Zhang; Shimin Lu; Wei Li; Weiguo Dong
Journal:  Front Genet       Date:  2022-06-22       Impact factor: 4.772

2.  Downregulation of lncRNA HCP5 has inhibitory effects on gastric cancer cells by regulating DDX21 expression.

Authors:  Kehao Wang; Xiaoyu Yu; Bilin Tao; Jiamu Qu
Journal:  Cytotechnology       Date:  2021-01-01       Impact factor: 2.058

3.  Cancer Susceptibility Candidate 9 (CASC9) Promotes Colorectal Cancer Carcinogenesis via mTOR-Dependent Autophagy and Epithelial-Mesenchymal Transition Pathways.

Authors:  Md Zahirul Islam Khan; Helen Ka Wai Law
Journal:  Front Mol Biosci       Date:  2021-05-04

4.  LINC01419 facilitates hepatocellular carcinoma growth and metastasis through targeting EZH2-regulated RECK.

Authors:  Gong Zhang; Ximin Chen; Lei Ma; Rui Ding; Lihong Zhao; Feng Ma; Xubin Deng
Journal:  Aging (Albany NY)       Date:  2020-06-10       Impact factor: 5.682

5.  Forkhead box K1 regulates the malignant behavior of gastric cancer by inhibiting autophagy.

Authors:  Yixuan Wang; Wensheng Qiu; Ning Liu; Libin Sun; Zhao Liu; Shasha Wang; Peng Wang; Shihai Liu; Jing Lv
Journal:  Ann Transl Med       Date:  2020-02

6.  Analysis of ceRNA networks and identification of potential drug targets for drug-resistant leukemia cell K562/ADR.

Authors:  Zhaoping Liu; Yanyan Wang; Zhenru Xu; Shunling Yuan; Yanglin Ou; Zeyu Luo; Feng Wen; Jing Liu; Ji Zhang
Journal:  PeerJ       Date:  2021-05-25       Impact factor: 2.984

Review 7.  Long noncoding RNAs in gastric cancer: From molecular dissection to clinical application.

Authors:  Yue Gao; Jun-Wei Wang; Jia-Yi Ren; Mian Guo; Cheng-Wang Guo; Shang-Wei Ning; Shan Yu
Journal:  World J Gastroenterol       Date:  2020-06-28       Impact factor: 5.742

Review 8.  Long non-coding RNAs in gastric cancer: New emerging biological functions and therapeutic implications.

Authors:  Huidan Tan; Shouyue Zhang; Jin Zhang; Lingjuan Zhu; Yanmei Chen; Hongmei Yang; Yi Chen; Yang An; Bo Liu
Journal:  Theranostics       Date:  2020-07-11       Impact factor: 11.556

9.  A Risk Signature with Autophagy-Related Long Noncoding RNAs for Predicting the Prognosis of Clear Cell Renal Cell Carcinoma: Based on the TCGA Database and Bioinformatics.

Authors:  Yundong Xuan; Weihao Chen; Kan Liu; Yu Gao; Shidong Zuo; Baojun Wang; Xin Ma; Xu Zhang
Journal:  Dis Markers       Date:  2021-05-07       Impact factor: 3.434

10.  Fatty Acid-Binding Protein 4 (FABP4) Suppresses Proliferation and Migration of Endometrial Cancer Cells via PI3K/Akt Pathway.

Authors:  Zimeng Wu; Ji-Hak Jeong; Chenchen Ren; Li Yang; Leilei Ding; Feiyan Li; Dongyuan Jiang; Yuanhang Zhu; Jie Lu
Journal:  Onco Targets Ther       Date:  2021-06-29       Impact factor: 4.147

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.