Literature DB >> 31216332

Comparative analysis of the complete chloroplast genomes of seven Populus species: Insights into alternative female parents of Populus tomentosa.

Dan Zong1,2, Peihua Gan1,2, Anpei Zhou1,2, Jinyu Li1,2, Zhongli Xie1,2, Anan Duan1,2,3, Chengzhong He1,2,3.   

Abstract

Populus tomentosa, of section Populus, is distributed mainly in northern China. This species has high resistance to many diseases and insects, and it plays key roles in shelterbelts and urban afforestation in northern China. It has long been suspected to be a hybrid, but its parents remain unknown. In the present study, we report four newly sequenced complete cp genomes from section Populus and comparative genomic analyses of these new sequences and three published cp genome sequences. The seven cp genomes ranged from 155,853 bp (P. tremula var. davidiana) to 156,746 bp (P. adenopoda) in length, and their gene orders, gene numbers and GC contents were similar. We analyzed SNPs, indels, SSRs and repeats among the seven cp genomes, and eight small inversions were detected in the ndhC-trnV, rbcL-accD, petA-psbJ, trnW-trnP, rpl16-rps3, trnL-ycf15, ycf15-trnL, and ndhF-trnL intergenic regions. Furthermore, seven divergent regions (trnH-psbA, matK, psbM-psbD, ndhC-trnV, ycf1, ndhF-ccsA and ccsA-ndhD) were found in more highly variable regions. The phylogenetic tree reveals that P. tomentosa is closely related to P. alba and P. alba var. pyramidalis. Hence, P. alba was involved in the formation of P. tomentosa.

Entities:  

Mesh:

Year:  2019        PMID: 31216332      PMCID: PMC6583991          DOI: 10.1371/journal.pone.0218455

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

Species of the genus Populus, family Salicaceae, are collectively known as poplars and cottonwoods and play important economic and ecological roles due to their rapid growth rates, easy vegetative propagation, small genome size, importance as a timber source and other features [1, 2]. The genus Populus is classified into 29 species belonging to six sections (Abaso, Aigeiros, Leucoides, Populus, Tacamahaca and Turanga), and it is the most widely distributed genus of woody plants in the world [3, 4]. However, because poplars readily undergo interspecific hybridization and exhibit high levels of morphological variation, the number of Populus species currently described in the literature varies from 22 to 85, and hundreds of Populus hybrids and cultivars exist [3, 5–9]. Populus tomentosa Carrière, known as Chinese white poplar, belongs to section Populus. This species is mainly distributed in northern China and has strong resistance to many diseases and insects. It also plays key roles in shelterbelts and urban afforestation in northern China. These useful features have attracted considerable attention from taxonomists and geneticists [10]. However, it is difficult to generate a large segregating population of intraspecific hybrids due to the high rate of seed abortion [11]. P. tomentosa has long been suspected to be a hybrid, but its exact parents remain unknown [12]. Based on its morphological similarity and genetic to P. × hopeiensis, P. tomentosa was thought by Wang et al [13] to have been domesticated from P. × hopeiensis, which is a sympatric with P. tomentosa in China. Additionally, because the morphological characteristics of P. tomentosa are similar to those of P. canescens, a natural hybrid of P. alba and P. tremula, Bartkowiak [14] speculated that P. tomentosa was a natural hybrid between P. alba as the female parent and P. tremula as the male parent. In addition, Zhang [15] inferred that P. tomentosa was a natural hybrid of P. alba and P. tremula var. davidiana based on floral characteristics. Li et al [16] analyzed the genetic relationships among five varieties of P. tomentosa with their putative parents (P. adenopoda, P. alba, P. tremula var. davidiana and P. tremula) using RAPD molecular markers. They found that P. tomentosa had closer relationships with P. alba and P. adenopoda than with P. tremula var. davidiana and P. tremula and concluded that P. tomentosa is a natural hybrid of P. alba and P. adenopoda. However, P. adenopoda and P. tomentosa clustered in two different clades within section Populus in a plastid phylogeny [13]. Zhang et al [17] suggested that P. tremula var. davidiana and P. alba var. pyramidalis may have participated in the formation of some natural types of P. tomentosa based on a comparison of five related species (P. adenopoda, P. alba, P. alba var. pyramidalis, P. tremula var. davidiana and P. × hopeiensis). In addition, Kang et al [18] speculated that P. alba and P. alba var. pyramidalis were probably involved in the origin of P. tomentosa based on chromosomal behaviors during meiosis and pollen fertility. Chloroplasts (cp) are inherited in a maternal manner in the majority of plants, and each of these organelles contains a quadripartite circular molecule of double-stranded DNA that comprises two inverted repeats (IRs) and two single copy regions: the large and small single copy regions (LSC and SSC) [19]. Because of their relatively small size, simple structure and conserved gene content, cpDNA sequences have been widely used for phylogenetic studies, and complete cp genome sequences could provide valuable datasets for resolving complex evolutionary relationships [20, 21]. In addition, the cp genomes have proven to be more informative than cp DNA fragments in revealing the phylogeny of land plants [20, 22–25]. In the present paper, we report four newly sequenced complete cp genomes from section Populus [P. adenopoda (GenBank accession number: MK341062), P. alba var. pyramidalis (GenBank accession number: MK341061), P. × hopeiensis (GenBank accession number: MK341060) and P. tomentosa (GenBank accession number: MK341063)] and comparative genomic analyses of the new sequences and three published cp genome sequences (P. alba (AP008956) [26], P. tremula var. davidiana (KX306825) [27] and P. tremula (KP861984)) [28]. The aims of our study were: (I) to reveal cp genome structure variations in Populus and (II) to analyze the relationships of one of the varieties of P. tomentosa with its putative female parents (P. adenopoda, P. alba, P. alba var. pyramidalis, P. tremula var. davidiana, P. × hopeiensis, and P. tremula).

Materials and methods

Plant material, DNA extraction, sequencing and annotation

Four accessions representing section Populus, comprising P. adenopoda, P. alba var. pyramidalis, P. × hopeiensis and P. tomentosa, were collected from Hunan (110°28'12"E, 29°07'48"N), Gansu (103°4'48"E, 38°37'12"N), Shanxi (108°4'27.95"E, 34°16'56.24"N) and Beijing (116°18'08"E, 39°57'22"N) Provinces, respectively. Chinese legislation does not forbid access to study poplar in nature reserves, so permits were not needed for samples collections, and we confirm that the samples collection did not involve endangered or protected species. Total genomic DNA was extracted from silica-dried leaves with the Ezup Plant Genomic DNA Prep Kit (Sangon Biotech, Shanghai, China). Based on the five known Populus cp genome sequences (of P. alba, P. balsamifera, P. euphratica, P. tremula and P. trichocarpa) [29-31], the cp genomes of four Populus species were amplified with 33 primers (Table 1) using LA-PCR with Takara PrimeSTAR GXL DNA polymerase (TAKARA BIO INC., Dalian, China) following the method described by Yang [32]. A different 16 bp barcode sequences (Pacific Biosciences) was added to the primers of each of the four accessions P. adenopoda, P. alba var. pyramidalis, P. × hopeiensis and P. tomentosa (Table 2). The PCR products were subjected to next-generation sequencing at Nextomics Biosciences, and gaps were filled by PCR amplification and Sanger sequencing. The assembled genome sequences were preliminarily annotated in Geneious R8, and the start and stop codons were manually adjusted. The tRNA genes were further confirmed through the online tRNAscan-SE web server [33]. The gene map of the annotated Populus cp genome was drawn by OGdraw online [34].
Table 1

The 33 primers used to amplify the complete cp genome of the Populus.

PrimerF sequencesPrimerR sequencesLength/Kb
CP1-1-FGGCTGAATGGTTAAAGCGCCCACP1-1-RGATTAGTGCCTAGTGCGGGAAAAGC6.0
CP1-2-FACCCTCTATCCTCTCTTTTTTCCATCP1-2-RTTGCGTCCAATAGGATTTGAACCTATACC6.0
CP2-1-FGGTTCGATTCCCGCTACCCGCCP2-1-RTTTTGTTTCTAATTGGTCAGGGGCG5.5
CP2-2-FCGAAACTTAGTCAATGGTGTCCCTCCP2-2-RAAAGGATGGCTAGTCCAAGATGCTG5.9
CP2-3-FTGTACTTGAGATGCATTTCCCCTAGCP2-3-RGGATATGGGCTCGTGTGAGTAGGAA6.2
CP2-4-FTTCCTTATCGCTCAGGAAAGACAAGCP2-4-RTGGTTCAAATCCAGCTCGGCCC5.5
CP3-1-FCCCCAGTTCAAATCCGGGTGTCGCP3-1-RTTGTGCTTCAGGACCCCATAGTAAT6.0
CP3-2-FAGGGACCGTTTCGTTTTTGTGGGCP3-2-RACTAACTTCGGGATTGGGCACAG6.0
CP3-3-FTTGTGCTATAAACGCATAAGCAGGCP3-3-RCGCCTTCAACCACTCGGCCA6.5
CP4-1-FTGTAGGAGAGATGGCCGAGTGGCP4-1-RAATGGGCGATGCTTGGTTACAATTT5.0
CP4-2-FTACGGATACCCCCAATACATCGAAACP4-2-RCTTGGATACCATGAGGTGGGCCTTG6.0
CP4-3-FCATGGACAACTGTGTGGACCGACCP4-3-RCCATTGCAATTGCCGGAAATACTAAGC4.0
CP5-1-FACGGCGGGAGTCATTGGTTCACP5-1-RTGAATGGCCTCGGTTAATCCTGTC6.0
CP5-2-FGAACTTTCGATTGATCCAGGCACTCP5-2-RGCATCCCCGTCGAATCAGACAGA5.7
CP5-3-FGCGAATCCATCAAACTCGATCAACCCP5-3-RAGTTCGGTAGAACATGGGTCTCCA4.0
CP6-1-FTGAACCTACGACATTGGGTTTTGGAGACP6-1-RAAATCCAAATCGGGCAGATCTTTAC5.5
CP6-2-FGATCAAATTCTATCCCTTAGGAACCGTCP6-2-RATTCTTTAGATCCCTTGTTTCACTCCG6.0
CP6-3-FGGCCGTGCAGATATATGCCTTTAATCP6-3-RGCGGTGGAAAAATATGGGTACG5.0
CP6-4-FTTCTACCCGGTTTAACGACAGCTACP6-4-RATGTACGAGGATCCCCGCTAAGCATC5.5
CP7-1-FGTTTGAGCTGTACGAGATGAAATTCTCP7-1-RTGGGTACGTATCTTTCCCGACAA6.0
CP7-2-FTCTGGCTATATTTTCTGCTACCCCGCP7-2-RAAGATACAGGAGCGAAACAATCAACC6.0
CP7-3-FGCAATTCACAGGGTTCAACAAGCACP7-3-RAGAGCGTGGAGGTTCGAGTCC8.0
CP8-1-FGGACTCGAACCTCCACGCTCTCP8-1-RAGAGTCCAACTCCATTGAATTGCCA7.0
CP8-2-FCTATATGATCCGATCGATTGCGTAAGCP8-2-RGCATTTCGGGGAGAACCAGCTAG6.0
CP8-3-FTAGGCAGTGGCTTGGTTAAGGGACP8-3-RAAAAGTTGACAAACTGGGTGGATACG6.0
CP8-4-FCCTGACAAAATCGACGAAACGGAACP8-4-RGCCGCCACTCGGACTCGAACC4.0
CP9-1-FGGTTCGAGTCCGAGTGGCGGCCP9-1-RCAGTTCTTTACTTGGGCGGTTGGA6.0
CP9-2-FTACCCATTGTTGTTCCAAAGACTCTACCP9-2-RGGTCTAGCTTAATATCGCAAAAATGGC5.8
CP9-3-FTCTATGCGAGCTTTTTTCCGTATCGCP9-3-RACAGCCGACCGCTCTACCAC5.0
CP10-1-FGTGGTAGAGCGGTCGGCTGTCP10-1-RCAGGGACCAGGAGATTGGATCT6.0
CP10-2-FGTGCTTGTTCCCCCCTTCTTCCTCP10-2-RCAGCATCCACCAATTCGGAACTT6.0
CP10-3-FCCGATATAGCAGTAAAAGCAAGACGTCP10-3-RTGGATCCCGCTCTAATAGCTCCG5.0
CP10-4-FTCTTACCTGGGATCGCAAATCCCCP10-4-RTGGGCGCTTTAACCATTCAGCC5.8
Table 2

The barcode sequences for the five Populus accessions.

SpeciesBarcode sequences 5’Barcode sequences 3’
P. tomentosaGCGCGCGCACTCTCTGCAGAGAGTGCGCGCGC
P. alba var. pyramidalisTCATACACACAGATAGCTATCTGTGTGTATGA
P. × hopeiensisTAGTGTGCGACTCTGATCAGAGTCGCACACTA
P. adenopodaTCTGTATCTCTATGTGCACATAGAGATACAGA

Codon usage

To examine deviations in synonymous codon usage by avoiding the influence of amino acid composition, the relative synonymous codon usage (RSCU) was detected using MEGA 5 software [35]. Because short protein-coding genes (CDS) generally result in large estimation errors for codon usage, CDS shorter than 300 bp in length were excluded from the codon usage calculations to avoid sampling bias [36]. Finally, 58 CDS for each cp genome were analyzed in this study.

SSR and long repeat sequence analysis

Microsatellites in the seven Populus cp genomes were detected using MISA [37] with the minimal repeat number set to 12, 6, 5, 5, 5 and 5 for mono-, di-, tri-, tetra-, penta-, and hexa- nucleotides, respectively. All of the repeats were manually verified. We used the online REPuter software [38] to identify and locate forward repeat (F), reverse repeat (R), complemented repeat (C) and palindromic repeat (P) sequences. The following settings for repeat identification were used: (1) Hamming distance equal to 3; (2) minimal repeat size, 30 bp; and (3) maximum computed repeats, 90 bp.

Sequence divergence analysis

To investigate divergence in cp genomes, identity across the whole cp genomes was visualized using the mVISTA viewer in the Shuffle-LAGAN mode among the seven accessions with P. adenopoda as the reference. MAFFT version 7.037 software [39] was used to align the seven cp genome sequences of Populus: P. adenopoda, P. alba, P. alba var. pyramidalis, P. tremula var. davidiana, P. × hopeiensis, P. tomentosa and P. tremula. After manual adjustment with BioEdit software, we performed sliding window analysis to assess variability (Pi) throughout the cp genomes using DnaSP version 5 software [40]. The window length was set to 600 bp and the step size was set to 200 bp. Single nucleotide polymorphisms (SNPs) and indels were detected using the “find variation” in Geneious R8. Inversions were manually detected using the BioEdit software. There were a total of 21 pairwise alignments for the seven cp genomes.

Phylogenetic analysis

To detect the phylogenetic position of P. tomentosa with respect to the other Populus species, 14 accessions with available complete cp genomes were compared, including 10 accessions from section Populus, two accessions from section Turanga of Populus (P. euphratica (KJ624919) and P. ilicifolia (KX421095)) and two accessions from Salix (Salix babylonica (KT449800) and Salix paraplesia (MG262366)) as outgroups. The 10 cp genomes from section Populus included the four new cp genomes (P. adenopoda, P. alba var. pyramidalis, P. × hopeiensis, P. tomentosa) and six complete cp genomes published elsewhere or available from NCBI (P. alba (AP008956), P. tremula var. davidiana (KX306825), P. qiongdaoensis (KX534066), P. rotundifolia (KX425853), P. tremula (KP861984), and P. tremula × alba (MG262346)) [41-44]. The sequences were aligned using MAFFT [39] and adjusted manually where necessary. Maximum likelihood (ML) analyses were conducted using RAxML with 1000 bootstrap replicates [45]. Bayesian inference (BI) was performed using the program MrBayes 3.1.2 [46]. The jModelTest 2.0 program [47] was used to determine the best-fitting model for each dataset based on the Akaike information criterion and the optimal model of “TVM +F+R2”. The Markov chain Monte Carlo (MCMC) algorithm was run for 1,000,000 generations, and a burn-in of 25% was used for the analysis.

Results and discussion

Complete cp genomes of Populus species

The seven cp genomes ranged in size from 155,853 bp (P. tremula var. davidiana) to 156,746 bp (P. adenopoda) (Fig 1 and Table 3). All of them displayed a typical quadripartite structure, consisting of a pair of IRs (27,571–27,660 bp) separated by the LSC (84,127–84,934 bp) and the SSC (16,413–18,584 bp) regions (Table 3). Gene content and order were very similar among the cp genomes of the seven accessions and similar to those of other published cp genomes [43, 44, 48, 49].
Fig 1

Gene map of the four Populus cp genomes.

The genes that are drawn outside the circle are transcribed clockwise, whereas those that are drawn inside the circle are transcribed counterclockwise. The large single copy (LSC), small single copy (SSC) and inverted repeat (IRA and IRB) regions are indicated.

Table 3

Summary of the features of the complete cp genomes of the seven Populus accessions.

P. adenopodaP. alba [25]P. alba var. pyramidalisP. tremula var. davidiana [26]P. × hopeiensisP. tomentosaP. tremula [27]
Size(bp)156,746156,505156,225155,853156,294156,469156,067
LSC(bp)84,93484,61884,43184,12784,62984,72284,377
SSC(bp)16,55216,56716,53016,58416,41316,53116,490
IR(bp)27,63027,66027,63227,57127,62627,60827,600
CDS(bp)80,28979,19480,66180,63180,54180,66180,634
Number of total genes130128130130130130130
Number of CDS genes85(7)83(6)85(7)85(7)85(7)85(7)85(7)
Number of tRNA genes37(7)37(7)37(7)37(7)37(7)37(7)37(7)
Number of rRNA genes8(4)8(4)8(4)8(4)8(4)8(4)8(4)
Overall GC content (%)36.7936.7436.7936.7636.7336.7836.76
GC content in LSC (%)34.6434.5634.6334.5834.5234.6034.55
GC content in SSC (%)30.5230.4930.5330.4030.5630.6730.56
GC content in IR (%)41.9741.9541.9742.0141.9542.0041.97

Gene map of the four Populus cp genomes.

The genes that are drawn outside the circle are transcribed clockwise, whereas those that are drawn inside the circle are transcribed counterclockwise. The large single copy (LSC), small single copy (SSC) and inverted repeat (IRA and IRB) regions are indicated. The four cp genomes all encode 130 genes with the same gene order and gene clusters. Among these genes, 112 are unique genes, including 78 protein-coding genes, 30 tRNA genes and 4 rRNA genes, except in P. alba, which has 111 unique genes (77 protein-coding genes, 30 tRNA genes and 4 rRNA genes). Twelve distinct genes (atpF, ndhA, ndhB, petB, rpl2, rpoC1, trnK-UUU, trnG-UCC, trnL-UAA, trnV-UAC, trnI-GAU, trnA-UGC) contain one intron and three genes (clpP, ycf3 and rps12) contain two introns. All annotated genes are listed in S1 Table. The overall GC contents range from 36.73% (P. × hopeiensis) to 36.79% (P. adenopoda and P. alba var. pyramidalis). However, the GC content is unequally distributed in the Populus cp genomes; it is highest in the IR regions (41.95–42.01%), moderate in the LSC regions (34.52–34.64%) and lowest in the SSC regions (30.40–30.67%) (Table 3). The IR regions have the highest GC content due to the presence of eight rRNA sequences in the IR regions [19]. Furthermore, the AT content of the seven cp genomes was 55.1%, 62.6% and 70.5% at the first, second, and third codon positions, respectively, within protein-coding positions (Table 4). Overall, these seven cp genomes show a high conservation of all genome features, such as gene content, gene order, exon-intron structure and GC content. The alignment analysis revealed that the cp genomes of the seven Populus accessions were highly conserved, and that no rearrangement of gene organization had occurred (Fig 2).
Table 4

Base composition of the CDS sequences.

T/UCAGLength (bp)
P. adenopoda1st position24.018.531.126.526,763
2nd position33.019.929.617.526,763
3rd position38.013.932.415.826,763
CDS31.617.431.019.980,289
P. alba1st position24.018.531.126.626,398
2nd position33.020.029.617.626,398
3rd position38.013.832.415.826,398
CDS31.517.431.020.079,194
P. alba var. pyramidalis1st position24.018.531.126.426,887
2nd position33.019.929.617.626,887
3rd position38.013.932.415.926,887
CDS31.617.531.019.980,661
P. tremula var. davidiana1st position24.018.531.126.426,877
2nd position33.020.029.617.626,877
3rd position38.013.932.415.826,877
CDS31.617.531.019.980,631
P. × hopeiensis1st position24.018.531.126.426,847
2nd position33.020.029.617.626,847
3rd position38.013.932.415.926,847
CDS31.617.431.020.080,541
P. tomentosa1st position24.018.531.126.426,887
2nd position33.020.029.617.626,887
3rd position38.013.932.415.926,887
CDS31.617.531.019.980,661
P. tremula1st position24.018.531.126.426,878
2nd position33.019.929.617.626,878
3rd position38.013.932.415.926,878
CDS31.517.531.020.080,634
Fig 2

Gene arrangement map of the seven cp genomes using MAUVE software in Geneious R8.

Annotations of rRNA, protein coding and tRNA genes are shown in red, white and green boxes, respectively.

Gene arrangement map of the seven cp genomes using MAUVE software in Geneious R8.

Annotations of rRNA, protein coding and tRNA genes are shown in red, white and green boxes, respectively.

IR expansion and contraction

The IR regions are known to promote the stability of the other regions of the genome by intramolecular recombination between the two copies of the IRs, thus limiting recombination between the two single copy regions [50, 51]. Comparison of the boundaries between the IRs and single copy regions of the seven Populus accessions revealed very small boundary differences. Four junctions (JLA, JLB, JSA and JSB) lay between the two IRs (IRB and IRA) and the two single copy regions (LSC and SSC). We carefully compared the IR border positions and the adjacent genes among the seven cp genomes. Detailed comparisons of the IR-SSC (JSA) and IR-LSC (JSB) boundaries among the cp genomes of the seven species are presented in Fig 3. For JLA, the boundary was located between rps19 and the trnH gene. The variation in distances between rps19 and JLA was from 200 bp to 219 bp, and the distances in the four species P. adenopoda, P. alba, P. alba var. pyramidalis and P. tremula were the same. The distance between trnH and JLA was consistent at 3 bp except in P. adenopoda, where it was 14 bp. The ycf1 gene spanned the SSC and IRA regions and the rpl22 gene spanned the LSC and IRB regions very similar length among all seven Populus accessions. For the ycf1 gene, 1705 bp was integrated into the IRB region in all accessions, except P. × hopeiensis, where 1708 bp was integrated into this region, and the length of the ycf1 gene in the SSC region was the same between the two accessions of P. alba var. pyramidalis and P. tomentosa.
Fig 3

Comparison of the LSC, IR, and SSC border regions among the seven Populus cp genomes.

Codon usage was calculated for the protein-coding genes present in the Populus cp genome. Most protein-coding genes employ the standard ATG as the initiator codon. However, ATA, ATC, TTC, and ATT are also used as alternative start codons [52]. Among the Populus protein-coding genes, two genes were used as alternative start codons ATC for rpl16 and GTG for ndhD. The codon usage patterns of the 58 distinct protein-coding genes in the seven cp genomes were examined. The cp genomes of P. alba var. pyramidalis and P. tomentosa were consistent, each with a length of 75,960 bp and containing 25,320 codons, whereas those of P. adenopoda, P. alba, P. tremula var. davidiana, P. × hopeiensis, P. tremula were 75,588 bp, 74,778 bp, 75,930 bp, 75,840 bp and 75,933 bp, respectively, in size and contained 25,196, 24,926, 25,310, 25,280 and 25,311 codons, respectively, as shown in S2 Table. As an important indicator of codon usage bias, the RSCU value is the frequency observed for a codon divided by its expected frequency [53]. The values are divided into four categories: RSCU value of less than 1.0 (lack of bias), RSCU value between 1.0 and 1.2 (low bias), RSCU value between 1.2 and 1.3 (moderate bias) and RSCU value greater than 1.3 (high bias) [54, 55]. Our results showed that the RSCU values corresponding to the usage of 31 codons in the seven accessions showed preferences (<1) for except methionine (Met) and tryptophan (Trp), with 29 codons having A/T in the third codon position. All three stop codons were present, with UAA being the most frequent stop codon in all seven cp genomes (S2 Table). In addition, our results indicated that leucine (Leu: 10.70%, 10.65%, 10.67%, 10.67%, 10.67%, 10.66%, 10.66% and 10.68%) and cysteine (Cys: 1.13%, 1.11%, 1.14%, 1.14%, 1.14%, 1.14%, 1.14% and 1.14%) were the most and least commonly encoded amino acids, respectively, in all seven cp genomes (Fig 4 and S2 Table).
Fig 4

Amino acid frequencies of the seven Populus cp genomes based on 58 protein-coding sequences.

SSR and long repeat analyses

Simple sequence repeats (SSRs) can be used as genetic markers in population genetics and evolutionary studies of closely related species, because of their high variability at the intraspecific level [56-58]. The number of cp genomes SSRs (cpSSRs) ranged from 26 to 46 among the seven Populus accessions (Fig 5A). The number of cpSSRs in P. tomentosa (26) was the same as that in P. alba var. pyramidalis (26), and the numbers of cpSSRs in the three accessions P. alba, P. tremula var. davidiana and P. × hopeiensis were similar (S3 Table). The mononucleotide repeat (P1) number with the highest variability ranged from 23 (P. alba var. pyramidalis and P. tomentosa) to 39 (P. tremula), and all of the P1s were composed of poly A (polyadenine) and poly T (polythymine) repeats (Fig 5B and S3 Table). Research has shown that, in the cp genome, SSRs are generally composed of polythymine (poly T) or polyadenine (poly A) repeats and infrequently contain tandem cytosine (C) and guanine (G) repeats [59, 60]. In addition, all the dinucleotide repeat (P2) sequences in the seven accessions were AT repeats. In total, 74.83% SSRs were detected in the LSC region, 13.85% in the IR regions and 12.12% in the SSC region (Fig 5C). In general, the cpSSRs of the seven Populus accessions represented abundant variation and will be useful for assays detecting polymorphisms at the population level for inferring distant phylogenetic relationships among Populus species [61].
Fig 5

Comparison of SSRs among the seven cp genomes.

(A) The number of SSRs detected in seven Populus cp genomes. (B) The number of SSR types detected in seven Populus cp genomes: P1, mononucleotide repeat; P2, dinucleotide repeat, P3, trinucleotide repeat and C, compound repeat (C) Frequencies of identified SSRs.

Comparison of SSRs among the seven cp genomes.

(A) The number of SSRs detected in seven Populus cp genomes. (B) The number of SSR types detected in seven Populus cp genomes: P1, mononucleotide repeat; P2, dinucleotide repeat, P3, trinucleotide repeat and C, compound repeat (C) Frequencies of identified SSRs. Long repeat sequences have important roles in cp genome evolution and genome rearrangements and can be informative in phylogenetic studies [62]. Four repeat types were detected in the cp genome using REPuter software. However, complement repeats (C) were only identified in P. alba, P. alba var. pyramidalis, P. tremula var. davidiana and P. × hopeiensis which had four, two, one and four repeats, respectively. Nineteen forward repeats (F), three reverse repeats (R) and 14 palindrome repeats (P) were discovered in P. tomentosa. The repeat numbers of the other six cp genomes are shown in Fig 6A and S4 Table. The repeats were mostly distributed in the intergenic spacer (IGS) and intron sequences (S4 Table). Among these repeats, 290 (80.78%) had lengths of 30–39 bp, and only five (1.39%) were longer than 100 bp (Fig 6B). The presence of these repeats indicates that the locus is a crucial hotspot for genome reconfiguration [63, 64]. Furthermore, these repeats are an informative source for developing genetic markers for phylogenetic and population studies [64].
Fig 6

Analysis of repeat sequences in the seven cp genomes.

(A) Frequency of repeat types. Forward repeat (F), reverse repeat (R), palindrome repeat (P) and complement repeat (C). (B) Frequency of repeats ≥30 bp in length.

Analysis of repeat sequences in the seven cp genomes.

(A) Frequency of repeat types. Forward repeat (F), reverse repeat (R), palindrome repeat (P) and complement repeat (C). (B) Frequency of repeats ≥30 bp in length.

Genome variation

SNP markers are the most abundant type of mutation and the most important marker for species identification [65]. Indels not only play an important role in elucidating genome evolution [66, 67], but also have potential value in constructing phylogenies [68, 69]. In this study, we compared these polymorphisms among the seven cp genomes. The numbers of nucleotide substitutions and indels varied from 44 to 274 and 129 to 252, respectively, and most mutations were located in noncoding regions (Table 5, S5 and S6 Tables).
Table 5

Numbers of nucleotide substitutions and indels in the seven cp genomes.

P. adenopodaP. albaP. alba var. pyramidalisP. tremula var. davidianaP. × hopeiensisP. tomentosaP. tremula
P. adenopoda/143155225249173243
P. alba163(85/78)/135220245149244
P. alba var. pyramidalis150(76/74)74(33/41)/216234129239
P. tremula var. davidiana260(139/121)259(139/120)250(131/119)/155234223
P. × hopeiensis262(134/128)259(139/120)246(128/118)124(64/60)/246250
P. tomentosa151(83/68)77(36/41)44(20/24)258(140/118)258(138/120)/252
P. tremula259(138/121)255(139/116)214(132/82)274(148/126)259(136/126)254(137/117)/

The lower triangle shows the numbers of nucleotide substitutions in complete cp genomes, and the numbers of Ts and Tv are presented in parentheses. The upper triangle indicates the numbers of indels.

The lower triangle shows the numbers of nucleotide substitutions in complete cp genomes, and the numbers of Ts and Tv are presented in parentheses. The upper triangle indicates the numbers of indels. In searching for SNPs and indels, we found little differences among the cp genome sequences of P. tomentosa, P. alba and P. alba var. pyramidalis, which had similar mutation models (S5 and S6 Tables). Interestingly, there were always more transitions (Ts) than transversions (Tv) in Populus except in two pairwise comparisons (P. tomentosa vs. P. alba and P. tomentosa vs. P. alba var. pyramidalis). Transitions (Ts) occurred at higher frequencies than did transversions (Tv) in almost all DNA sequences; transition/transversion (Ts/Tv) bias is a general property of DNA sequence evolution [70]. In the gene coding regions, seven genes (atpB, ndhD, ndhF, rpoB, rpoC2, rps8 and ycf1) were found to have SNP mutations, and four of genes had more synonymous substitutions than nonsynonymous substitutions between P. alba var. pyramidalis and P. tomentosa (S7 Table). In addition, 13 genes had SNP mutations between P. tomentosa and P. alba (S7 Table). Therefore, the phylogenetic relationships of these species may be affected by different mutation models.

Small inversions

Small inversions in the cp genomes of angiosperms are ubiquitous and are commonly associated with a hairpin secondary structure [71, 72]. Small inversions are generally detected by performing pairwise comparisons between sequences of closely related taxa [71]. In this study, a total of eight small inversions were uncovered based on the sequence alignment of the seven complete cp genomes, of which five were located in the LSC region, two were located in the IR regions, and one was located in the SSC region. In addition, eight small inversions were detected in the ndhC-trnV, rbcL-accD, petA-psbJ, trnW-trnP, rpl16-rps3, trnL-ycf15, ycf15-trnL and ndhF-trnL intergenic regions. The number of small inversions among the 21 pairwise alignments ranged from one to six. There was one small inversion between P. alba var. pyramidalis and P. tomentosa located in petA-psbJ and one between P. tremula var. davidiana and P. tremula, which was located in ndhF-trnL (S8 Table).

Genome sequence divergence among the seven Populus accessions

We used mVISTA to perform a sequence identity analysis with P. adenopoda as a reference (Fig 7). The alignment revealed high sequence similarity across the cp genomes, which suggests that they are highly conserved. To investigate the levels of sequence divergence, we calculated the levels of genetic divergence among the cp genomes of the seven accessions using DnaSP software. The pairwise nucleotide divergence values between two of the seven cp genomes varied from 0.00028 to 0.00164 (Table 6), with a mean of 0.00103. Using sliding window analysis, we identified the seven most divergent regions (Pi>0.005): trnH-psbA, matK, psbM-psbD, ndhC-trnV, ycf1, ndhF-ccsA, and ccsA-ndhD (Fig 8). Further work is necessary to determine whether these seven variable loci can be used in Populus phylogenetic analyses or serve as excellent candidate markers for population genetic and phylogenetic analysis [73].
Fig 7

Whole cp genome alignments of the seven Populus accessions using the mVISTA program, with P. adenopoda as the reference.

The Y-axis indicates identity from 50% to 100% and gray arrows indicate the position and direction of each gene. Red indicates noncoding sequences (CNS), blue indicates the exons of protein-coding genes (exon) and green indicates tRNA or rRNA genes.

Table 6

Pairwise nucleotide divergences of the eight cp genomes of Populus.

P. adenopodaP. albaP. alba var. pyramidalisP. tremula var. davidianaP. hopeiensisP. × tomentosaP. tremula
P. adenopoda/
P. alba0.00066/
P. alba var. pyramidalis0.000630.00031/
P. tremula var. davidiana0.001110.001100.00106/
P. × hopeiensis0.001140.001130.001090.00054/
P. tomentosa0.000640.000320.000280.001080.00112/
P. tremula0.001120.001100.001080.001180.001210.00164/
Fig 8

Comparison of the nucleotide variability values of the seven cp genomes of Populus.

The genetic divergences among the Populus cp genomes were calculated with the DnaSP software (window length, 600 bp; step size, 200 bp). X-axis, position of the midpoint of a window; Y-axis, nucleotide diversity of each window.

Whole cp genome alignments of the seven Populus accessions using the mVISTA program, with P. adenopoda as the reference.

The Y-axis indicates identity from 50% to 100% and gray arrows indicate the position and direction of each gene. Red indicates noncoding sequences (CNS), blue indicates the exons of protein-coding genes (exon) and green indicates tRNA or rRNA genes.

Comparison of the nucleotide variability values of the seven cp genomes of Populus.

The genetic divergences among the Populus cp genomes were calculated with the DnaSP software (window length, 600 bp; step size, 200 bp). X-axis, position of the midpoint of a window; Y-axis, nucleotide diversity of each window. Cp genomes provide abundant resources, that are useful for evolutionary, taxonomic, and phylogenetic studies [20, 60, 74]. Whole cp genomes and protein-coding genes have been successfully used to resolve phylogenetic relationships at almost every taxonomic level during the past decade [60, 75]. The complete cp genome sequences of the seven Populus accessions and the three published complete cp genomes of members of section Populus (P. qiongdaoensis (KX534066), P. rotundifolia (KX425853), P. tremula × alba) were used for phylogenetic analysis, with P. euphratica (KJ624919), P. ilicifolia (KX421095), Salix babylonica (KT449800) and Salix paraplesia (MG262366) included as outgroups. ML and BI nucleic acid analyses were performed, and the results are summarized in Fig 9. The two topologies show similar phylogenetic patterns. Each topology divided the 10 Populus accessions into two clades. The first divergent clade contained P. adenopoda, P. alba, P. alba var. pyramidalis, and P. tomentosa, and the second contained P. rotundifolia, P. × hopeiensis, P. tremula var. davidiana, P. qiongdaoensis, P. tremula, and P. tremula × alba. The phylogenetic tree revealed that P. tomentosa was closely related to both P. alba var. pyramidalis and P. alba (bootstrap support = 100% and BI = 1.0).
Fig 9

Phylogeny of the 12 Populus species inferred from ML and BI analysis of the cp genome dataset.

Numbers between the lines on the left indicate the ML bootstrap values for clades with >50% support, and the numbers on the right indicate the Bayesian posterior probabilities.

Phylogeny of the 12 Populus species inferred from ML and BI analysis of the cp genome dataset.

Numbers between the lines on the left indicate the ML bootstrap values for clades with >50% support, and the numbers on the right indicate the Bayesian posterior probabilities. According to the published Flora of China [76], the species of section Populus share a smooth bark but vary in bark color. In P. tomentosa, the color of the bark on the basal part of the trunk changes with plant age, shifting from dull gray to grayish green or grayish white and then to dark gray. The bark is grayish white in P. alba and P. adenopoda, grayish green or grayish white in P. tremula var. davidiana and P. tremula, and yellowish green to grayish white in P. × hopeiensis. In addition, the shape of the bud in Populus is ovoid or ovoid-globose and the shape of capsule is narrowly conical or long ovoid-ellipsoid; only P. tomentosa, P. alba and P. × hopeiensis have dense, white tomentose buds. In a previous analysis of bract and other characteristics, of the 22 P. tomentosa clones, the clones were divided into three populations, and the authors speculated that P. tomentosa is a natural hybrid of P. alba and P. tremula var. davidiana [15]. Zhang et al [17] compared 26 traits among P. tomentosa and five related species (including several varieties). Their comparisons revealed that P. tremula var. davidiana and P. alba var. pyramidalis may have participated in the formation of some natural types of P. tomentosa, although substantial variation exists among natural types. In addition, although many wild P. tomentosa ecotypes have arisen during the evolution of the species [77], 14 clones collected from throughout the species’ entire natural ranges, clustered together in an amplified fragment length polymorphism (AFLP) marker analysis [78]. Wang et al [79] used 24 single-copy nuclear DNA sequences and 12 plastid fragments to reconstruct the phylogeny of Populus, which suggested that section Populus is a monophyletic group. The genus was divided into two distinct clades with maximum bootstrap support and posterior probability. The nuclear DNA phylogeny revealed a close relationship between P. tomentosa and P. adenopoda; however, in the plastid phylogeny, P. tomentosa and P. adenopoda belonged to two different clades. The authors speculated that in the hybridization event giving rise to P. tomentosa, the ancestor of P. tremula var. davidiana and P. × hopeiensis served as the maternal parent and P. adenopoda served as the paternal role. To clarify the origins of P. tomentosa and P. × hopeiensis, Wang et al [80] analyzed 10 nuclear DNA sequences and 6 cpDNA sequences from 392 individuals from 36 populations of 8 taxa (P. × hopeiensis, P. tomentosa, P. alba, P. adenopoda, P. tremula var. davidiana, P. tremula, P. tremuloides, and P. grandidentata). The authors aimed to improve the understanding of hybridization and introgression in section Populus. The results supported the division of P. tomentosa into two genetic types (mb1 and mb2) with different maternal parents; in both genetic types, P. alba acted as the male parent, whereas P. adenopoda and P. tremula var. davidiana acted as the maternal parent in mb1 and mb2, respectively. However, there is always a big controversy about the possible parent of P. tomentosa. RAPD and AFLP analyses have suggested that P. tomentosa is possibly a natural hybrid of P. alba and P. adenopoda [14-15], an interpretation highly consistent with observations of chromosomal behaviors during meiosis and pollen fertility [18]. Our analyses showed that P. alba var. pyramidalis is closely related P. tomentosa, and Yin [81] suggested that P. alba var. pyramidalis could be regarded as a variant of P. alba. Based on these findings, we speculate that P. alba was involved in the formation of P. tomentosa as a common female parent based on the cp genomes.

Conclusion

In the present study, we report four newly sequenced complete cp genomes from section Populus and comparative genomic analyses of these genomes and three other published cp genome sequences. The seven cp genomes were similar in structure and had a high degree of synteny. Comparison of seven cp genomes revealed seven divergent regions (trnH-psbA, matK, psbM-psbD, ndhC-trnV, ycf1, ndhF-ccsA and ccsA-ndhD) in the highly variable regions, which can be utilized as potential molecular markers for population genetic and phylogenetic studies in Populus. The location and distribution of SSRs and long repeat sequences were examined and shown to be similar and conserved among the genomes. In addition, a total of seven small inversions were detected in the ndhC-trnV, rbcL-accD, petA-psbJ, trnW-trnP, rpl16-rps3, trnL-ycf15, ycf15-trnL and ndhF-trnL intergenic regions. ML and BI phylogenetic trees based on the complete cp genome sequences indicated that P. tomentosa is closely related to both P. alba var. pyramidalis and P. alba. Thus, we speculate that P. alba was involved in the formation of P. tomentosa as a common female parent.

List of genes in the cp genomes.

(XLSX) Click here for additional data file.

Codon usage in the eight Populus cp genomes.

(XLSX) Click here for additional data file.

SSR repeats in the eight cp genomes.

(XLSX) Click here for additional data file.

Repeat sequences in the eight cp genomes.

(XLSX) Click here for additional data file.

Transitions (Ts) and transversions (Tv) among the 28 pairwise alignments.

(XLSX) Click here for additional data file.

Indels among the 28 pairwise alignments.

(XLSX) Click here for additional data file.

Comparisons of synonymous (S) and nonsynonymous (N) substitutions per gene of protein-coding chloroplast genes among the 21 pairwise alignments.

(XLSX) Click here for additional data file.

Small inversions among the 21 pairwise alignments.

(XLSX) Click here for additional data file.
  49 in total

1.  REPuter: the manifold applications of repeat analysis on a genomic scale.

Authors:  S Kurtz; J V Choudhuri; E Ohlebusch; C Schleiermacher; J Stoye; R Giegerich
Journal:  Nucleic Acids Res       Date:  2001-11-15       Impact factor: 16.971

Review 2.  Chloroplast evolution: secondary symbiogenesis and multiple losses.

Authors:  T Cavalier-Smith
Journal:  Curr Biol       Date:  2002-01-22       Impact factor: 10.834

3.  MEGA: a biologist-centric software for evolutionary analysis of DNA and protein sequences.

Authors:  Sudhir Kumar; Masatoshi Nei; Joel Dudley; Koichiro Tamura
Journal:  Brief Bioinform       Date:  2008-04-16       Impact factor: 11.622

4.  Phylogenetic analysis of 83 plastid genes further resolves the early diversification of eudicots.

Authors:  Michael J Moore; Pamela S Soltis; Charles D Bell; J Gordon Burleigh; Douglas E Soltis
Journal:  Proc Natl Acad Sci U S A       Date:  2010-02-22       Impact factor: 11.205

5.  Complete chloroplast genome sequence of Magnolia kwangsiensis (Magnoliaceae): implication for DNA barcoding and population genetics.

Authors:  Dai-Yong Kuang; Hong Wu; Ya-Ling Wang; Lian-Ming Gao; Shou-Zhou Zhang; Lu Lu
Journal:  Genome       Date:  2011-07-27       Impact factor: 2.166

6.  Revealing genetic diversity of tree peonies at micro-evolution level with hyper-variable chloroplast markers and floral traits.

Authors:  Zhili Suo; Chuanhong Zhang; Yongqi Zheng; Lixia He; Xiaobai Jin; Boxin Hou; Jiajue Li
Journal:  Plant Cell Rep       Date:  2012-09-09       Impact factor: 4.570

7.  An evolutionary perspective on synonymous codon usage in unicellular organisms.

Authors:  P M Sharp; W H Li
Journal:  J Mol Evol       Date:  1986       Impact factor: 2.395

8.  The tRNAscan-SE, snoscan and snoGPS web servers for the detection of tRNAs and snoRNAs.

Authors:  Peter Schattner; Angela N Brooks; Todd M Lowe
Journal:  Nucleic Acids Res       Date:  2005-07-01       Impact factor: 16.971

9.  Comparative analysis of the complete chloroplast genome sequences in psammophytic Haloxylon species (Amaranthaceae).

Authors:  Wenpan Dong; Chao Xu; Delu Li; Xiaobai Jin; Ruili Li; Qi Lu; Zhili Suo
Journal:  PeerJ       Date:  2016-11-10       Impact factor: 2.984

10.  Genome Sequences of Populus tremula Chloroplast and Mitochondrion: Implications for Holistic Poplar Breeding.

Authors:  Birgit Kersten; Patricia Faivre Rampant; Malte Mader; Marie-Christine Le Paslier; Rémi Bounon; Aurélie Berard; Cristina Vettori; Hilke Schroeder; Jean-Charles Leplé; Matthias Fladung
Journal:  PLoS One       Date:  2016-01-22       Impact factor: 3.240

View more
  6 in total

1.  Comparative analysis of plastid genomes within the Campanulaceae and phylogenetic implications.

Authors:  Chun-Jiao Li; Ruo-Nan Wang; De-Zhu Li
Journal:  PLoS One       Date:  2020-05-14       Impact factor: 3.240

2.  The complete chloroplast genome of Onobrychis gaubae (Fabaceae-Papilionoideae): comparative analysis with related IR-lacking clade species.

Authors:  Mahtab Moghaddam; Atsushi Ohta; Motoki Shimizu; Ryohei Terauchi; Shahrokh Kazempour-Osaloo
Journal:  BMC Plant Biol       Date:  2022-02-19       Impact factor: 4.215

3.  Comparison of eight complete chloroplast genomes of the endangered Aquilaria tree species (Thymelaeaceae) and their phylogenetic relationships.

Authors:  Muhammad Syahmi Hishamuddin; Shiou Yih Lee; Wei Lun Ng; Shairul Izan Ramlee; Dhilia Udie Lamasudin; Rozi Mohamed
Journal:  Sci Rep       Date:  2020-08-03       Impact factor: 4.379

4.  Transcriptome analysis of diploid and triploid Populus tomentosa.

Authors:  Wen Bian; Xiaozhen Liu; Zhiming Zhang; Hanyao Zhang
Journal:  PeerJ       Date:  2020-10-28       Impact factor: 2.984

5.  Complete Chloroplast Genomes of Fagus sylvatica L. Reveal Sequence Conservation in the Inverted Repeat and the Presence of Allelic Variation in NUPTs.

Authors:  Bartosz Ulaszewski; Joanna Meger; Bagdevi Mishra; Marco Thines; Jarosław Burczyk
Journal:  Genes (Basel)       Date:  2021-08-29       Impact factor: 4.096

6.  Complete chloroplast genome of Stephania tetrandra (Menispermaceae) from Zhejiang Province: insights into molecular structures, comparative genome analysis, mutational hotspots and phylogenetic relationships.

Authors:  Shujie Dong; Zhiqi Ying; Shuisheng Yu; Qirui Wang; Guanghui Liao; Yuqing Ge; Rubin Cheng
Journal:  BMC Genomics       Date:  2021-12-06       Impact factor: 3.969

  6 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.