| Literature DB >> 29899275 |
Julian Lange1, Eugenia Münch2, Jan Müller3, Tobias Busche4,5, Jörn Kalinowski6, Ralf Takors7, Bastian Blombach8.
Abstract
Zero-growth processes are a promising strategy for the production of reduced molecules and depict a steady transition from aerobic to anaerobic conditions. To investigate the adaptation of Corynebacterium glutamicum to altering oxygen availabilities, we conceived a triple-phase fermentation process that describes a gradual reduction of dissolved oxygen with a shift from aerobiosis via microaerobiosis to anaerobiosis. The distinct process phases were clearly bordered by the bacteria’s physiologic response such as reduced growth rate, biomass substrate yield and altered yield of fermentation products. During the process, sequential samples were drawn at six points and analyzed via RNA-sequencing, for metabolite concentrations and for enzyme activities. We found transcriptional alterations of almost 50% (1421 genes) of the entire protein coding genes and observed an upregulation of fermentative pathways, a rearrangement of respiration, and mitigation of the basic cellular mechanisms such as transcription, translation and replication as a transient response related to the installed oxygen dependent process phases. To investigate the regulatory regime, 18 transcriptionally altered (putative) transcriptional regulators were deleted, but none of the deletion strains showed noticeable growth kinetics under an oxygen restricted environment. However, the described transcriptional adaptation of C. glutamicum resolved to varying oxygen availabilities provides a useful basis for future process and strain engineering.Entities:
Keywords: Corynebacterium glutamicum; aerobiosis; anaerobiosis; microaerobiosis; transcriptional response; triple-phase process
Year: 2018 PMID: 29899275 PMCID: PMC6027265 DOI: 10.3390/genes9060297
Source DB: PubMed Journal: Genes (Basel) ISSN: 2073-4425 Impact factor: 4.096
Figure A2Carbon balance of the triple-phase process. Analyzed products (biomass, lactate, succinate, acetate and CO2) were balanced with respect to glucose as sole carbon source over the entire cultivation period of 0–16 h (Figure 1A). Error bars represent the SD of four independent experiments.
Figure 1The triple-phase process with Corynebacterium glutamicum cultivated in CGXII + 60 g glucose L−1. (A) The 30 L bioreactor cultivation in 10 L minimal medium was realized with constant agitation (445 rpm) throughout the entire process and a gassing of 0.1 vvm within the aerobic (dark grey) and microaerobic (grey) phase. The anaerobic (light grey) phase was initiated by a stop of aeration and temporary flushing of the headspace with N2. Sampling for e.g., RNA-sequencing analysis is indicated with circled numbers (①, ②, ③, ④, ⑤, ⑥); (B) Biomass/substrate yield (YX/S); (C) Product/substrate yields (YP/S). Error bars and shaded area of the dissolved oxygen (DO) represent the standard deviation (SD) of four independent experiments.
Overview of the growth rate (µ), the biomass/substrate yield (YX/S), biomass specific glucose consumption rate (qS) and the product/substrate yield (YP/S) for the aerobic, microaerobic, and anaerobic condition of triple-phase process (Figure 1A). Errors represent the standard deviation (SD) of four independent experiments.
| Phase | µ, h−1 | YX/S, g g−1 | qS, g g−1 h−1 | YP/S, mol mol−1 | ||
|---|---|---|---|---|---|---|
| Lactate | Succinate | Acetate | ||||
| aerobic | 0.40 ± 0.01 | 0.52 ± 0.04 | 0.77 ± 0.06 | 0.03 ± 0.01 | 0.00 ± 0.00 | 0.00 ± 0.00 |
| microaerobic | 0.21 ± 0.00 | 0.29 ± 0.02 | 0.72 ± 0.05 | 0.49 ± 0.03 | 0.22 ± 0.02 | 0.31 ± 0.01 |
| anaerobic | 0.09 ± 0.01 | 0.16 ± 0.01 | 0.56 ± 0.07 | 1.39 ± 0.05 | 0.37 ± 0.01 | 0.13 ± 0.02 |
Figure A3Pearson correlation of RNA-sequencing data. The log2TPM values within the entire raw RNA-sequencing data were correlated (no significance constraints applied). Sample IDs of the triple-phase process from left to right aerobiosis (①, ②), microaerobiosis (③, ④, ⑤) and anaerobiosis (⑥).
Figure 2Overall transcriptional changes during the triple-phase process. RNA-sequencing analysis was conducted with a log-fold change (m-value, >1.50, <–1.50) and an average differential expression value (a-value, >1.00) cutoff with the aerobic state ① serving as reference. (A) Differentially expressed genes were counted within the aerobic (②), microaerobic (③, ④, ⑤) and anaerobic (⑥) phase and summed over the total process timeframe (Figure 1A). For the microaerobic phase (samples ③, ④, ⑤) an average value was calculated and allocated to up- or downregulation. (B) Venn diagram separated into up- and downregulated genes within the three major process phases. The sum of totally altered genes is given in boxes beside the circle of the respective phase.
Figure 3Transcriptional response to a shift from aerobiosis via microaerobiosis to anaerobiosis including genes of glycolysis, tricarboxylic acid cycle (TCA), glyoxylate shunt, oxidative pentose phosphate pathway and selected amino acid biosynthesis pathways. Column graphs represent log2-fold changes of enhanced (black) and reduced (grey) expression. Values outside the significance constraints (m-value > 1.50, < −1.50 and a-value > 1.00) are also shown (white). From left to right aerobiosis (②), microaerobiosis (③, ④, ⑤) and anaerobiosis (⑥) versus the aerobic reference (①; Figure 1A). Abbreviations of the given genes: aceA (isocitrate lyase), aceB (malate synthase), adhA (alcohol dehydrogenase), aspT (aspartate aminotransferase), alaT (alanine aminotransferase), ald (acetaldehyde dehydrogenase), fbp (fructose-1,6-bisphosphatase), fda (fructose-bisphosphate aldolase), fum (fumarate hydratase), gapA (glyceraldehyde-3-phosphate dehydrogenase), gdh (glutamate dehydrogenase), gltA (citrate synthase), glyA (serine hydroxymethyltransferase), ilvBN (acetohydroxyacid synthase), ilvC (acetohydroxyacid isomeroreductase), ldhA (l-lactate dehydrogenase), leuA (2-isopropylmalate synthase), leuB (3-isopropylmalate dehydrogenase), leuCD (3-isopropylmalate dehydratase), malE (malic enzyme), mdh (malate dehydrogenase), pck (phosphoenolpyruvate carboxykinase), pfk (6-phosphofructokinase), pgk (3-phosphoglycerate kinase), ppc (phosphoenolpyruvate carboxylase), pyc (pyruvate carboxylase), sdhABCD (succinate dehydrogenase), serA (phosphoglycerate dehydrogenase), serB (phosphoserine phosphatase), sucCD (succinyl-CoA synthetase), tpi (triosephosphate isomerase), zwf (subunit of the glucose-6P dehydrogenase). Graphic represents extended version to literature [81].
Figure 4(A) Specific activities of the glucose-6P dehydrogenase (G6P-DH) and 6P-gluconate dehydrogenase (6PG-DH) in U per mg total protein. (B) Intracellular l-glutamate analysis in samples taken during the triple-phase process [aerobic (①, ②), microaerobic (③, ④, ⑤), anaerobic conditions (⑥); Figure 1A]. Error bars represent SD of three (A) or four (B) independent experiments.
Figure 5Transcriptional response of the cytochrome bc-aa and cytochrome bd oxidase to altering oxygen availabilities. (A) Genetic organization and operon structures. Binding of the transcriptional regulators GlxR, RamB, HcrA and OxyR is indicated. (B) Schematic organization of the cytochrome oxidases in the cytoplasmic membrane. Column graphs represent log2-fold changes of enhanced (black) and reduced (grey) expression. Open columns are values outside the significance constraints (m-value > 1.50, < −1.50 and a-value > 1.00). From left to right aerobiosis (②), microaerobiosis (③, ④, ⑤), and anaerobiosis (⑥) versus the aerobic reference (①; Figure 1A). Scaling of the graphs is variable. Shading links genes to proteins. Graphic A and B based on the online tool CoryneRegNet and Bott and Niebisch, respectively [86,87].
Figure 6Correlation of total RNA content and growth rate within the triple-phase process. (A) The growth rate (µ, 1) and the total RNA per cell (2) is depicted from left to right for the process phases: aerobiosis (①, ②), microaerobiosis (③, ④, ⑤), and anaerobiosis (⑥; Figure 1A). (B) Direct correlation of the total RNA content and the growth rate. Linear regression was calculated neglecting the first sampling point (①, open circle). Error bars represent SD of a triplicate experiment.
Relative differential expression of sigma factors. Description based on literature [98,103]. Column graphs represent log2-fold changes of enhanced (black) and reduced (grey) expression. Open columns are values outside the significance constraints (m-value > 1.50, <−1.50 and a-value > 1.00). From left to right aerobiosis (②), microaerobiosis (③, ④, ⑤) and anaerobiosis (⑥) versus the aerobic reference (①; Figure 1A). Scaling of these graphs is variable.
| Gene ID | Name | Description | Rel. Diff. Expression |
|---|---|---|---|
| cg2092 |
| Primary (housekeeping) sigma factor |
|
| cg2102 |
| Nonessential primary-like sigma factor involved in gene expression during the transition phase, under oxygen deprivation and during environmental stress responses |
|
| cg0309 |
| Regulates expression of a branched quinol oxidation pathway |
|
| cg0696 |
| ECF sigma factor probably involved in the adaptation to micro-aerobic environments |
|
| cg1271 |
| ECF sigma factor involved in responses to cells surface stresses |
|
| cg0876 |
| ECF sigma factor controlling the heat and oxidative stress response |
|
| cg3420 |
| ECF sigma factor controlling the expression of disulfide stress-related genes |
|
Relative differential expression of putatively oxygen responsive regulators. Description based on literature [98,103]. Column graphs represent log2-fold changes of enhanced (black) and reduced (grey) expression. Open columns are values outside the significance constraints (m-value > 1.50, <−1.50 and a-value > 1.00). From left to right aerobiosis (②), microaerobiosis (③, ④, ⑤) and anaerobiosis (⑥) versus the aerobic reference (①; Figure 1A). Scaling of these graphs is variable.
| No. | Gene ID | Name | Description | Rel. Diff. Expression |
|---|---|---|---|---|
| 1 | cg0993 |
| Bacterial regulatory protein |
|
| 2 | cg3303 |
| Putative transcriptional regulator, PadR-family |
|
| 3 | cg1327 |
| Putative transcriptional regulator, Crp-family |
|
| 4 | cg2500 |
| Putative transcriptional regulator, ArsR-family |
|
| 5 | cg2502 |
| Putative transcriptional regulator, Fur-family |
|
| 6 | cg3202 |
| Transcriptional regulator, GntR-family |
|
| 7 | cg1120 |
| Repressor of iron protein genes |
|
| 8 | cg2965 |
| Putative transcriptional regulator, AraC-family |
|
| 9 | cg0444 |
| Master regulator of carbon metabolism |
|
| 10 | cg2320 |
| Putative transcriptional regulator, ArsR-family |
|
| 11 | cg2746 |
| Putative sugar diacid utilization regulator |
|
| 12 | cg2648 |
| Putative transcriptional regulator, ArsR-family |
|
| 13 | cg3388 |
| Activator of putative hydroxyquinol pathway genes |
|
| 14 | cg0215 |
| Cold-shock protein A |
|
| 15 | cg1410 |
| Repressor of ribose uptake and uridine utilization genes |
|
| 16 | cg3352 |
| Transcriptional activator of gentisate catabolism |
|
| 17 | cg0150 |
| Putative transcriptional regulatory protein, Fic/Doc family |
|
| 18 | cg1053 |
| Putative transcriptional regulator, TetR-family |
|
| 19 | cg2109 |
| Hydrogen peroxide sensing regulator |
|
Figure A4Cultivation of C. glutamicum WT and ΔoxyR under progressing oxygen limitation in shaking flasks with baffles or without baffles in CGXII + 40 g glucose L−1 as sole carbon source. (A) WT cultivation in baffled (filled symbols) and unbaffled (open symbols) shaking flasks. (B,C) Cultivation of C. glutamicum ΔoxyR in shaking flasks with baffles (B) and without baffles (C). In both graphs the WT cultivation is shown in grey (circles). Error bars show SD of four independent cultivations of the C. glutamicum WT strain. For C. glutamicum ΔoxyR (black, diamonds) the average of two comparable independent cultivations is depicted.
Figure A1Shaking flask cultivation of C. glutamicum WT in CGXII + 60 g glucose L−1. Error bars represent the SD of five independent experiments.
Figure 7Hypothetical model of C. glutamicum’s response to micro- and anaerobiosis including unknown regulatory mechanisms, metabolites, or cellular signals (?). Reinforcement and mitigation is visualized by arrowheads and squares, respectively. Column graphs (with exception of intracellular l-glutamate titers) represent log2-fold changes of enhanced (black) and reduced (grey) expression. Open columns are values outside the significance constraints (m-value > 1.50, <−1.50 and a-value > 1.00). From left to right aerobiosis (②), microaerobiosis (③, ④, ⑤) and anaerobiosis (⑥) versus the aerobic reference (①; Figure 1A). Scaling of these graphs is variable. Intracellular l-glutamate pools are depicted relatively to aerobic intracellular titers analogously to differential expression column graphs. Error bars represent SD. Abbreviations: RNAP, RNA polymerase; DNAP, DNA polymerase.
Bacterial Strains, plasmids, and oligonucleotides.
| Strain, Plasmid, or Oligo-Nucleotide | Relevant Characteristics or Sequence | Source, Reference or Purpose |
|---|---|---|
|
| ||
| F- Φ80 | [ | |
| Markerless deletion of OxyR (cg2109) | [ | |
| Markerless deletion of cg3303 by homologous recombination with pJULΔcg3303 | This study | |
| Markerless deletion of cg2320 by homologous recombination with pJULΔcg2320 | This study | |
| Markerless deletion of g2965 by homologous recombination with pJULΔcg2965 | This study | |
| Markerless deletion of cg2746 by homologous recombination with pJULΔcg2746 | This study | |
| Markerless deletion SutR (cg0993) by homologous recombination with pJULΔ | This study | |
| Markerless deletion of cg1327 by homologous recombination with pJULΔcg1327 | This study | |
| Markerless deletion of Znr (cg2500) by homologous recombination with pJULΔ | This study | |
| Markerless deletion of Zur (cg2502) by homologous recombination with pJULΔ | This study | |
| Markerless deletion of FarR (cg3202) by homologous recombination with pJULΔ | This study | |
| Markerless deletion RipA (cg1120) by homologous recombination with pJULΔ | This study | |
| Markerless deletion of cg2648 by homologous recombination with pJULΔcg2648 | This study | |
| Markerless deletion of IclR (cg3388) by homologous recombination with pJULΔ | This study | |
| Markerless deletion of CspA (cg0215) by homologous recombination with pJULΔ | This study | |
| Markerless deletion of RbsR (cg1410) by homologous recombination with pJULΔ | This study | |
| Markerless deletion of GenR (cg3352) by homologous recombination with pJULΔ | This study | |
| Markerless deletion of cg0150 by homologous recombination with pJULΔcg0150 | This study | |
| Markerless deletion of MmpLR (cg1053) by homologous recombination with pJULΔ | This study | |
| Markerless deletion of RamB (cg0444) by homologous recombination with pK19Δ | This study | |
|
| ||
| pK19 | For chromosomal integration and deletion of genetic information ( | [ |
| pJULΔcg3303 | For deletion of cg3303, pK19 | This study |
| pJULΔcg2320 | For deletion of cg2320, pK19 | This study |
| pJULΔcg2965 | For deletion of cg2965, pK19 | This study |
| pJULΔcg2746 | For deletion of cg2746, pK19 | This study |
| pJULΔ | For deletion of | This study |
| pJULΔcg1327 | For deletion of cg1327, pK19 | This study |
| pJULΔ | For deletion of | This study |
| pJULΔ | For deletion of | This study |
| pJULΔ | For deletion of | This study |
| pJULΔ | For deletion of | This study |
| pJULΔcg2648 | For deletion of cg2648, pK19 | This study |
| pJULΔ | For deletion of | This study |
| pJULΔ | For deletion of | This study |
| pJULΔ | For deletion of | This study |
| pJULΔ | For deletion of | This study |
| pJULΔcg0150 | For deletion of cg0150, pK19 | This study |
| pJULΔ | For deletion of | This study |
| pK19Δ | For deletion of | [ |
|
|
| |
| pK19seqfw | TAATGCAGCTGGCACGAC | Fw Sequencing primer pK19 |
| pK19seqrv | TAATGGTAGCTGACATTCATCCG | Rv Sequencing primer pK19 |
| Δcg3303-1 | Fw primer Flank1 in pJULΔcg3303 | |
| Δcg3303-2 | CCCCAGTACCATGCAGCTG | Rv primer Flank1 in pJULΔcg3303 ( |
| Δcg3303-3 | Fw primer Flank2 in pJULΔcg3303 ( | |
| Δcg3303-4 | GTGCTTGCGGCAGCGTGAA | Rv primer Flank2 in pJULΔcg3303 |
| Δcg2320-1 | Fw primer Flank1 in pJULΔcg2320 | |
| Δcg2320-2 | Rv primer Flank1 in pJULΔcg2320 ( | |
| Δcg2320-3 | Fw primer Flank2 in pJULΔcg2320 ( | |
| Δcg2320-4 | Rv primer Flank2 in pJULΔcg2320 | |
| Δcg2965-1 | Fw primer Flank1 in pJULΔcg2965 | |
| Δcg2965-2 | Rv primer Flank1 in pJULΔcg2965 ( | |
| Δcg2965-3 | Fw primer Flank2 in pJULΔcg2965 ( | |
| Δcg2965-4 | Rv primer Flank2 in pJULΔcg2965 | |
| Δcg2746-1 | Fw primer Flank1 in pJULΔcg2746 | |
| Δcg2746-2 | Rv primer Flank1 in pJULΔcg2746 ( | |
| Δcg2746-3 | Fw primer Flank2 in pJULΔcg2746 ( | |
| Δcg2746-4 | Rv primer Flank2 in pJULΔcg2746 | |
| ΔsutR-1 | Fw primer Flank1 in pJULΔ | |
| ΔsutR-2 | Rv primer Flank1 in pJULΔ | |
| ΔsutR-3 | Fw primer Flank2 in pJULΔ | |
| ΔsutR-4 | Rv primer Flank2 in pJULΔ | |
| Δcg1327-1 | Fw primer Flank1 in pJULΔcg1327 | |
| Δcg1327-2 | Rv primer Flank1 in pJULΔcg1327 ( | |
| Δcg1327-3 | Fw primer Flank2 in pJULΔcg1327 ( | |
| Δcg1327-4 | Rv primer Flank2 in pJULΔcg1327 | |
| Δznr-1 | Fw primer Flank1 in pJULΔ | |
| Δznr-2 | Rv primer Flank1 in pJULΔ | |
| Δznr-3 | Fw primer Flank2 in pJULΔ | |
| Δznr-4 | Rv primer Flank2 in pJULΔ | |
| Δzur-1 | Fw primer Flank1 in pJULΔ | |
| Δzur-2 | Rv primer Flank1 in pJULΔ | |
| Δzur-3 | Fw primer Flank2 in pJULΔ | |
| Δzur-4 | Rv primer Flank2 in pJULΔ | |
| ΔfarR-1 | Fw primer Flank1 in pJULΔ | |
| ΔfarR-2 | Rv primer Flank1 in pJULΔ | |
| ΔfarR-3 | Fw primer Flank2 in pJULΔ | |
| ΔfarR-4 | Rv primer Flank2 in pJULΔ | |
| ΔripA-1 | Fw primer Flank1 in pJULΔ | |
| ΔripA-2 | Rv primer Flank1 in pJULΔ | |
| ΔripA-3 | Fw primer Flank2 in pJULΔ | |
| ΔripA-4 | Rv primer Flank2 in pJULΔ | |
| Δcg2648-1 | Fw primer Flank1 in pJULΔcg2648 | |
| Δcg2648-2 | Rv primer Flank1 in pJULΔcg2648 ( | |
| Δcg2648-3 | Fw primer Flank2 in pJULΔcg2648 ( | |
| Δcg2648-4 | Rv primer Flank2 in pJULΔcg2648 | |
| ΔiclR-1 | Fw primer Flank1 in pJULΔ | |
| ΔiclR-2 | Rv primer Flank1 in pJULΔ | |
| ΔiclR-3 | Fw primer Flank2 in pJULΔ | |
| ΔiclR-4 | Rv primer Flank2 in pJULΔ | |
| ΔcspA-1 | Fw primer Flank1 in pJULΔ | |
| ΔcspA-2 | Rv primer Flank1 in pJULΔ | |
| ΔcspA-3 | Fw primer Flank2 in pJULΔ | |
| ΔcspA-4 | Rv primer Flank2 in pJULΔ | |
| ΔrbsR-1 | Fw primer Flank1 in pJULΔ | |
| ΔrbsR-2 | Rv primer Flank1 in pJULΔ | |
| ΔrbsR-3 | Fw primer Flank2 in pJULΔ | |
| ΔrbsR-4 | Rv primer Flank2 in pJULΔ | |
| ΔgenR-1 | Fw primer Flank1 in pJULΔ | |
| ΔgenR-2 | Rv primer Flank1 in pJULΔ | |
| ΔgenR-3 | Fw primer Flank2 in pJULΔ | |
| ΔgenR-4 | Rv primer Flank2 in pJULΔ | |
| Δcg0150-1 | Fw primer Flank1 in pJULΔcg0150 | |
| Δcg0150-2 | Rv primer Flank1 in pJULΔcg0150 ( | |
| Δcg0150-3 | Fw primer Flank2 in pJULΔcg0150 ( | |
| Δcg0150-4 | Rv primer Flank2 in pJULΔcg0150 | |
| ΔmmpLR-1 | Fw primer Flank1 in pJULΔ | |
| ΔmmpLR-2 | Rv primer Flank1 in pJULΔ | |
| ΔmmpLR-3 | Fw primer Flank2 in pJULΔ | |
| ΔmmpLR-4 | Rv primer Flank2 in pJULΔ | |
| ΔramB1 | CCACGCCGGGCACCTG | Fw primer Δ |
| ΔramB2 | GGCGCGATAGTGGATTCGTG | Rv primer Δ |