| Literature DB >> 29301210 |
Rabindra Nath Das1, Edith Chevret2, Vanessa Desplat3, Sandra Rubio4, Jean-Louis Mergny5,6, Jean Guillon7.
Abstract
G-quadruplexes (G4) are stacked non-canonical nucleic acid structures found in specific G-rich DNA or REntities:
Keywords: FRET-melting; G-quadruplex; G4 ligands; antiproliferative activity; cancer; circular dichroism; diquinolinyl-pyridine; telomerase
Mesh:
Substances:
Year: 2017 PMID: 29301210 PMCID: PMC6017375 DOI: 10.3390/molecules23010081
Source DB: PubMed Journal: Molecules ISSN: 1420-3049 Impact factor: 4.411
Figure 1The structures of Phen-DC3, pyridostatin, 360A and newly designed 2,6-di-(4-carbamoyl-2-quinolyl)pyridine derivatives 1a–f.
Scheme 1Structure of 1a–f and synthetic scheme for diquinolinyl-pyridine derivatives 1a–f.
Physical properties of ammonium salts 1a–f.
| Compound a | Salt b,c | Elemental Analyses | Feature | Yield (%) d |
|---|---|---|---|---|
| 2(COOH)2 | Anal. Calcd. for C39H43N7O10: C, 60.85; H, 5.63; N, 12.74. Found: C, 60.94; H, 5.54; N, 12.86 | Yellow powder | 81 | |
| 2(COOH)2 | Anal. Calcd. for C45H51N7O10: C, 63.59; H, 6.05; N, 11.54. Found: C, 63.67; H, 5.91; N, 11.43 | Yellow powder | 84 | |
| 4(COOH)2 | Anal. Calcd. for C49H61N9O18: C, 55.31; H, 5.78; N, 11.85. Found: C, 55.20; H, 5.94; N, 11.74 | Brown powder | 75 | |
| 2(COOH)2 | Anal. Calcd. for C43H47N7O10: C, 62.84; H, 5.76; N, 11.93. Found: C, 62.95; H, 5.66; N, 11.98 | Yellow powder | 78 | |
| 4(COOH)2 | Anal. Calcd. for C43H47N7O10: C, 62.84; H, 5.76; N, 11.93. Found: C, 62.95; H, 5.66; N, 11.98 | Yellow powder | 80 | |
| 2 (COOH)2 | Anal. Calcd. for C43H47N7O12: C, 60.49; H, 5.55; N, 11.48. Found: C, 60.64; H, 5.42; N, 11.67 | Yellow powder | 82 |
a Crystallization solvent: iPrOH–H2O; b The stoichiometry and composition of the salts were determined by elemental analyses and obtained values were within ±0.4% of the theoretical values; c Melting point of the salts were found to be >260 °C; d The yields only included the conversions into the ammonium oxalates.
FRET-melting values for compounds 1a–f with F21T in K+ or Na+ conditions.
| Compound | ∆Tm (°C) a in K+ Condition | ∆Tm (°C) b in Na+ Condition | ||
|---|---|---|---|---|
| 2 µM | 5 µM | 2 µM | 5 µM | |
| 15.5 ± 2.1 | 19.7 ± 0.3 | 4.7 ± 0.4 | 7.7 ± 1.0 | |
| 13.8 ± 0.5 | 18.9 ± 1.6 | 5.1 ± 0.2 | 7.8 ± 0.7 | |
| 18.7 ± 1.1 | 23.5 ± 0.8 | 10.9 ± 0.1 | 15.5 ± 1.4 | |
| 13.5 ± 0.5 | 19.1 ± 1.9 | 4.1 ± 0.9 | 6.2 ± 0.9 | |
| 6.8 ± 1.5 | 12.8 ± 1.6 | 2.9 ± 1.1 | 2.6 ± 0.8 | |
| 1.3 ± 0.4 | 1.9 ± 0.8 | 0.6 ± 0.2 | 0.4 ± 0.1 | |
a ∆Tm of F21T (0.2 µM) is recorded in 10 mM lithium cacodylate (pH 7.2), 10 mM KCl, and 90 mM LiCl. F21T Tm in K+ = 52.4 ± 0.3 °C; b ∆Tm of F21T (0.2 µM) is recorded in 10 mM lithium cacodylate (pH 7.2) and 100 mM NaCl. F21T Tm in Na+ is 48.8 ± 0.9 °C. Error margins correspond to SD of at least three independent experiments.
Figure 2Stabilization of F21T (0.2 µM) by 1a–d (5 µM) in the presence of various concentrations of a double-stranded competitor, ds26. Comparison of ∆Tm in K+ conditions in the absence of competitor (black) vs. ∆Tm in K+ conditions in the presence of ds26 (grey bars). Error bars correspond to SD of at least three independent experiments. Experiments were performed in 10 mM lithium cacodylate buffer (pH 7.2), 90 mM LiCl, and 10 mM KCl. Tm in absence of ligands of F21T is 52.4 ± 0.3 °C.
Figure 3Stabilization specificity profile of 1a–d (5 µM) toward various G4 oligonucleotides. The difference in Tm in presence and absence of 1a–d, ∆Tm, in °C is plotted for each sequence. 9 quadruplexes and one duplex (FdxT) were tested. Experiments were performed in 10 mM lithium cacodylate buffer (pH 7.2), 90 mM LiCl, and 10 mM KCl. Tm in absence of ligands: FdxT (Tm = 66.6 ± 0.7 °C), F25cebT (Tm = 68.3 ± 0.7 °C); FmycT (Tm = 64.8 ± 0.3 °C); Fkit1T (Tm = 66.5 ± 0.3 °C ); F21T (Tm = 52.4 ± 0.3 °C); F21ctaT (Tm = 56.6 ± 0.2 °C); FtbaT (Tm = 46.1 ± 0.3 °C); Fbom17T (Tm = 44.7 ± 0.6 °C); FPf1T (Tm = 45.8 ± 0.9 °C); FPf8T (Tm = 45.7 ± 0.2 °C).
Stabilization profile of 1a–d (5 µM) toward various G4 oligonucleotides.
| G4 Oligonucleotides | 1a | 1b | 1c | 1d |
|---|---|---|---|---|
| FdxT | 0.7 | 0.7 | 1.7 | 0.1 |
| F25Cebt | 14.8 | 13.8 | 17.5 | 14.9 |
| FmycT | 19.9 | 19.6 | 22.2 | 19.9 |
| Fkit1T | 16.8 | 18.9 | 15.6 | 17.1 |
| F21T | 19.7 | 18.9 | 23.5 | 19.1 |
| F21CTAT | 9.2 | 9.0 | 12.2 | 8.9 |
| FTBAT | 7.8 | 6.9 | 17.6 | 10.4 |
| FBom17T | 11.3 | 7.3 | 22.8 | 12.3 |
| FPf1T | 6.5 | 3.8 | 10.3 | 9.2 |
| FPf8T | 4.2 | 5.9 | 13.7 | 9.7 |
Figure 4CD titration of c-myc (2 μM) with (a) 1a, (b) 1b, (c) 1c and 22CTA (2 μM) with (d) 1a, (e) 1b, (f) 1c. CD spectra were recorded in 10 mM lithium cacodylate buffer (pH 7.3), 90 mM LiCl, and 10 mM KCl.
Figure 5Telomerase activity (TA) in My-La, MV-4-11 and K562 cell lysates was investigated in the presence of 0–20 µM of (a) 1a, (b) 1b and (c) 1c ligands.
In vitro sensitivity of compounds 1a–c on two human myeloid leukaemia cell lines, and cytotoxicity on human peripheral blood mononuclear cells PBMNC + PHA.
| Ligands | K562 IC50 (µM) | HL60 IC50 (µM) | Cytotoxicity on Activated Human Peripheral Blood Mononuclear Cells (PBMNC) PBMNC + PHA IC50 (µM) |
|---|---|---|---|
| >50 | >50 | >50 | |
| 3.0 ± 0.5 | 18 ± 2.0 | 5 ± 0.3 | |
| >50 | >50 | >50 |
List of DNA sequences used in the FRET assay.
| Sequence Name | Sequence(5′–3′) |
|---|---|
| ds26 | CAATCGGATCGAATTCGATCCGATTG |
| F21T | Fam-G3TTAG3TTAG3TTAG3-Tamra |
| Fbom17T | Fam-G2TTAG2TTAG2TTG2-Tamra |
| FdxT | Fam-TATAGCTAT-hexaethyleneglycol-TATAGCTATA-Tamra |
| FmycT | Fam-TTGAG3TG3TAG3TG3TAA-Tamra |
| F25cebT | Fam-AG3TG3TGTAAGTGTG3TG3T-Tamra |
| FtbaT | Fam-G2TTG2TGTG2TTG-Tamra |
| c-myc | TTGAG3TG3TAG3TG3TAA |
| 22AG | AG3TTAG3TTAG3TTAG3 |
| 24TTG | TTGGGTTAGGGTTAGGGTTAGGGA |
| 22CTA | AGGGCTAGGGCTAGGGCTAGGG |