Artemy D Beniaminov1, Roman A Novikov2, Olga K Mamaeva2, Vladimir A Mitkevich2, Igor P Smirnov3, Mikhail A Livshits2, Anna K Shchyolkina2, Dmitry N Kaluzhny4. 1. Engelhardt Institute of Molecular Biology, Russian Academy of Sciences, Vavilov str., 32, 119991 Moscow, Russia abeniaminov@mail.ru. 2. Engelhardt Institute of Molecular Biology, Russian Academy of Sciences, Vavilov str., 32, 119991 Moscow, Russia. 3. Institute for Physical-Chemical Medicine of Ministry of Public Health, Malaya Pirogovskaya str. 1a, 119435 Moscow, Russia. 4. Engelhardt Institute of Molecular Biology, Russian Academy of Sciences, Vavilov str., 32, 119991 Moscow, Russia uzhny@mail.ru.
Abstract
Structure-specific ligands are convenient tools for the recognition, targeting or probing of non-canonical DNA structures. Porphyrin derivatives exhibit a preference for interaction with G-quadruplex (G4) structures over canonical duplex DNA and are able to cause photoinducible damage to nucleic acids. Here, we show that Zn(II) 5,10,15,20-tetrakis(N-carboxymethyl-4-pyridinium)porphyrin ( ZNP1: ) interacts with different conformations of the telomeric sequence d(TAGGG(TTAGGG)3) at submicromolar concentrations without any detectible disturbance of the particular fold. Among different folds, potassium (3+1) hybrid G4-structure. reveal the highest affinity to ZNP1: The pattern of guanine oxidation is specific for each telomeric DNA conformation and may serve as an additional tool for probing the G4 topology. The potassium (3+1) and parallel G4 conformations are more susceptible to light-induced oxidation than the sodium G4 conformation or double helix of the telomeric DNA. The major products of the guanine modifications are spiroiminodihydantoin (Sp) and 8-oxoguanine (8-oxoG). ZNP1: -induced oxidation of guanines results in the structural rearrangement of parallel and (3+1) G4 conformations yielding an antiparallel-like G4 conformation. The mechanism of the observed light-induced conformational changes is discussed.
Structure-specific ligands are convenient tools for the recognition, targeting or probing of non-canonical DNA structures. Porphyrin derivatives exhibit a preference for interaction with G-quadruplex (G4) structures over canonical duplex DNA and are able to cause photoinducible damage to nucleic acids. Here, we show that Zn(II) 5,10,15,20-tetrakis(N-carboxymethyl-4-pyridinium)porphyrin ( ZNP1: ) interacts with different conformations of the telomeric sequence d(TAGGG(TTAGGG)3) at submicromolar concentrations without any detectible disturbance of the particular fold. Among different folds, potassium (3+1) hybrid G4-structure. reveal the highest affinity to ZNP1: The pattern of guanine oxidation is specific for each telomeric DNA conformation and may serve as an additional tool for probing the G4 topology. The potassium (3+1) and parallel G4 conformations are more susceptible to light-induced oxidation than the sodium G4 conformation or double helix of the telomeric DNA. The major products of the guanine modifications are spiroiminodihydantoin (Sp) and 8-oxoguanine (8-oxoG). ZNP1: -induced oxidation of guanines results in the structural rearrangement of parallel and (3+1) G4 conformations yielding an antiparallel-like G4 conformation. The mechanism of the observed light-induced conformational changes is discussed.
Telomeric DNA is a promising target for small molecules in a potential antitumor therapy. Such therapy is aimed at the inhibition of the telomerase, a ribonucleoprotein, which is known to be activated in ∼90% of all humantumors (1). The very end of human telomeres consists of a single stranded hexanucleotide DNA repeat (TTAGGG)n that is capable of forming a G-quadruplex structure. Human telomeric DNA reveals extreme structural diversity in vitro. Several conformations of telomeric DNA were solved by NMR and X-ray techniques (2–9). In most conformations, all guanines are involved in the formation of G-quartets, however, 5′-3′ direction of each of the four strands may vary. Solution conditions as well as flanking nucleotides of an oligonucleotide determine the preferable G4 conformation. For example, the basket type of antiparallel G4 is formed by d(AGGG(TTAGGG)3) in .NaCl solution (2). However, the same oligodeoxynucleotide in the presence of K+ ions revealed a propeller-type of all-parallel structure when solved by X-ray crystallography (3). A formation of (3+1) structures in K+ solution was observed with NMR. In that study, oligonucleotides d(TAGGG(TTAGGG)3) and d(TAGGG(TTAGGG)3TT) formed the structures named (3+1) Form 1 and (3+1) Form 2, respectively (4–6). Two other possible structures with (3+1) strand orientation were assumed to also exist (6). Wang et al. found that oligonucleotide d(TAGGG(TTAGGG)3) in Na+ solution also forms the (3+1) Form 1 structure despite different CD and 1D NMR spectra (7). The authors explained the differences in CD and NMR spectra between sodium Na+ and K+ structures of d(TAGGG(TTAGGG)3) via different quartet stacking in varied cation conditions (7). Another basket type antiparallel G4 structure was observed for d(GGG(TTAGGG)3T) in KCl solution and contained only two G-quartets (8). Different G-quadruplex conformations can be converted to a propeller-type parallel-stranded G-quadruplex in a water depleted potassium-containing crowded solution (9). Processes of G-quadruplex folding and interconversion between different conformation are being intensively studied (10,11).Small molecules specific to G4 structures may have several important applications. Besides inhibition of the telomerase and cell growth arrest, these molecules can potentially be used in recognition and targeting the G4, G4 imaging, directed suppression of genes containing G4 motifs and finally, as a structural probe of the G4 DNA. In the latter case, the influence of a G4 binder on the G4 conformation is of considerable importance. G4 specific ligands either stabilize the G4 structure and/or cause certain conformational rearrangements. Binding of some bisquinolinium G4 DNA ligands (360A, Phen‐DC3 and pyridostatin) can result in the restructuring of telomeric G4 into an antiparallel two-quartets fold presumably due to the displacement of metal ions (12). The destruction of all quartets in the telomeric G4 structure in sodium or a single quartet in potassium is required for anthrathiophenedione derivative binding (13). These changes essentially depend on ligand binding and seem to be reversible upon ligand dissociation.Porphyrin derivatives are generators of singlet oxygen, a characteristic property utilized in the photodynamic therapy (14). The oxidation pathways of the telomeric quadruplex triggered by several oxidative stress inducers were studied (15). It was found that singlet oxygen preferably oxidizes all guanines on the exterior faces of G-quartets and furnishes multiple products of oxidation including a major final product of spiroiminodihydantoin (Sp). Individual guanines were subject to oxidation in the telomeric quadruplex complex with TMPyP4 (16). Oxidation of guanines in the 5′-position of the GGG block reduces telomerase activity (17). Additionally, G-quadruplex structure hinders the removal of oxidative DNA lesions by human DNA glycosylases (18).Cationic porphyrins bind with some preference to G4 over canonical double-stranded DNA structure (19,20). Tetracarboxymethyl porphyrins, including ZnP1 (Supplementary Figure S1), were synthesized (21,22) and their DNA binding properties were described by us earlier (22–24). Here, we focus on the mechanism of the interaction between the ZnP1porphyrin and the telomeric sequence and its ability to light-induce oxidation of guanines within different G4 conformations. ZnP1 revealed a high affinity to G4 structures, preference to certain G4 telomeric conformations and a high yield of guanine oxidation under light irradiation. All these features are useful in developing approaches for controllable reduction of telomerase activity in tumor cells.The same properties of the ZnP1porphyrin are helpful in discriminating between various conformations of G4 DNA. Previously, well-studied cationic 5,10,15,20-tetrakis-(4-N-methylpyridiniumyl) porphyrin (TMPyP4) (25) as well as tetrakis(2-trimethylaminoethylethanol) phthalocyaninato zinc tetraiodine (Zn-TTAPc) (26) were used as singlet oxygen generating probes for determining strand orientation in different intramolecular folds of G4 structures. However, it was found that interaction of the indicated ligands with G- quadruplex led to considerable distortion of G4 conformation (20,26).Here, we study the interaction and light-induced oxidation of the telomeric G-quadruplex with ZnP1. Binding of the ZnP1porphyrin to different folds of the telomeric quadruplex appears to retain its native G4 conformation, thus making ZnP1 a more favorable agent for accurate probing of the highly polymorphic structure of the human telomeric DNA. Additionally, we demonstrate that prolonged light irradiation of the ZnP1:G4 complex results in changes of the G4 structure specific to its initial conformation.
MATERIALS AND METHODS
Chemicals and sample preparation
The oligodeoxynucleotides TQ23: TAGGG(TTAGGG)3, TQ23-F: TAGGG(TTAGGG)3-FAM, F-TQ23: FAM-TAGGG(TTAGGG)3, TQ23comp: (CCCTAA)3CCCTA, TQ22: AGGG(TTAGGG)3, TQ22-F AGGG(TTAGGG)3-FAM, nonG4: AGGCTTGGCGGGAAAAAGAACG-FAM were synthesized by DNA-synthesis (Moscow, Russia). The concentration of each oligonucleotide was determined spectrophotometrically based on absorption at 260 nm in water at 90°С using the following molar extinction coefficients: ϵ(TQ23) = 269 000 М−1·cm−1 and ϵ(TQ23comp) = 233 000 М−1·cm−1, ϵ(TQ22) = 261000 М−1·cm−1, ϵ(nonG4) = 269000 М−1·cm−1. Synthesis of ZnP1 was described previously (22). Stock solutions of ZnP1 (50 μМ or 5 mM) were prepared by dissolving the dry compound in water. Dimethyl sulfate (DMS), polyethylene glycol (PEG) 200 and formamide were purchased from Sigma-Aldrich (USA).The G-quadruplex structure was formed in 10 mM phosphate buffer (pH 7.8) containing either 100 mM KCl or 100 mM NaCl or 100 mM KCl supplemented with 40% PEG 200 via fast annealing: the solution of the oligonucleotide was heated for 1 min at 95°C followed by 10 min incubation on ice. The duplex structure was obtained by mixing equimolar amounts of TQ23-F and TQ23comp oligonucleotides in 10 mM phosphate buffer (pH 7.8) containing 100 mM KCl and heated for 1 min at 95°C with a subsequent slow cooling to room temperature for 2 h. ZnP1 was added from a stock solution to a pre-formed DNA structure after a renaturation procedure in all experiments.
Light source
To avoid heating of the samples and ensure an equal illumination dose when irradiating multiple samples, we used a set of blue (460–470 nm) light-emitting diodes (LED; luminous intensity 2 cd, bulb size 5 mm). Each LED was intended to irradiate a single sample having been applied directly to the bottom of the tube.
Fluorescence and absorption spectroscopy
FAM quenching was registered with a Cary Eclipse spectrofluorometer (Varian) at a wavelength of 515 nm upon excitation at 490 nm. The measurements were conducted at 1 nM of oligonucleotide. Apparent binding constants were estimated by fitting experimental data to a 1:1 stoichiometry model binding curve. Absorption spectra were recorded with a Jasco V-550 spectrophotometer in the 350–700 nm wavelength range. Absorbance spectra were obtained for the sequential mixture of 2 μM TQ23 oligonucleotide and 2 μM ZnP1 solutions at different ratios. Thus, the total concentration of TQ23+ZnP1 was constant equalling 2 μM.
Isothermal titration calorimetry (ITC)
The thermodynamic parameters of ZnP1 binding to TQ23 oligonucleotide were measured using an iTC200 instrument (MicroCal, Northampton, MA, USA). Experiments were carried out at 25°C in 10 mM sodium phosphate buffer (pH 7.8) supplemented with either 100 mM NaCl or 100 mM KCl or 100 mM KCl with 40% PEG 200. Two microliter aliquots of 500 μM ZnP1 solution were injected into a 200 μl calorimetric cuvette containing 20 μM of oligonucleotide in an appropriate buffer solution to achieve the complete binding isotherm. The heat of dilution was measured by injecting a solution of ZnP1 into the same buffer. The obtained values were subtracted from the heat of binding reaction to obtain the effective heat of binding. The resulting titration curves were fitted to two-binding-mode model using MicroCal Origin software. Thus, the association constant (K), enthalpy change (ΔH) and stoichiometry (N), were determined. The entropy variation (ΔS) was calculated according to the standard thermodynamic equation. Three independent experiments were averaged.
CD spectroscopy
Circular dichroism (CD) measurements were performed at 20°C with a Jasco-715 CD spectrometer using a quartz cell with a 10 mm optical path length. The spectra were obtained at a bandwidth of 1 nm. Three scans were averaged. The concentration of oligonucleotides was 2 μM. CD at 290 nm was chosen for plotting the temperature denaturation curves. The melting curves were normalized to CD signal at 20°C corresponding to a completely folded structure. The temperature ramp was 0.5°C/min. Melting temperature was determined as the midpoint of the curve.
Mass spectrometry
Before MALDI MS analysis, the reaction mixture was desalted using C-18 ZipTip (Millipore, USA) according to the protocol recommended by the manufacturer. Reaction products were applied to the MALDI plate with 2 μl of 30% acetonitrile. For MALDI MS analysis of oxidation products, 3-hydroxypicolinic acid (3HPA) diluted in deionized water (35 mg/ml) was used as a matrix. A 0.2 M stock solution of diammonium citrate diluted in deionized water was added to the 3HPA matrix for a final concentration of 10 mM that maintained the molecules in an ammonium form. MALDI-TOF MS scans were performed using MicroFlex instrument (Bruker, Germany) equipped with a nitrogen laser (337 nm) for the detection of positive ions.
Nuclear magnetic resonance (NMR)
Samples for NMR analysis were prepared by fast renaturation of the TQ23 oligonucleotide at a concentration of 40 μM in a 0.55 ml solution of 90% H2O:10% D2O consisting of a 10 mM phosphate buffer (pH 7.8) and 100 mM KCl in the absence/presence of 20 μM ZnP1. One dimensional proton spectra of the samples in H2O+D2O were recorded with Bruker AVANCE III HD 300 MHz and Bruker AMX-III 400 MHz using Watergate W5 pulse sequence with gradient (zggpw5 from Bruker library) for efficient H2O suppression. 1H chemical shifts were referenced relative to external sodium 2,2-dimethyl-2-silapentane-5-sulfonate. Acquisition time was 12 h for a single 1D experiment. The NMR data were processed using Bruker XWIN-NMR and Bruker TopSpin 3.1 software.
Photocleavage with ZnP1 and DMS probing
DNA oxidation was performed in a 20 μl solution formed by mixing ZnP1porphyrin and pre-annealed TQ23-F oligonucleotide for a final concentration of 1 μM of ligand and 2 μM of TQ23-F. The reaction mixture was incubated for 10 min at room temperature prior to light irradiation for 1 min. DMS probing was performed by adding 1 μl of DMS (1:5 diluted in EtOH) to 20 μl of 2 μM TQ23-F preliminary renatured in the indicated buffer followed by incubation for 2 min at room temperature. After either ZnP1-induced oxidation or DMS modification, the oligonucleotide was EtOH-precipitated and dissolved in 4 μl of the loading buffer containing 30 mM sodium phosphate buffer (pH 7.8), 80 % formamide, 0.025 % bromophenol blue and 0.025 % xylene cyanol. Following the heating of the oligonucleotide in the loading buffer at 90°C for 20 min, the cleavage products were resolved in denaturing 16% polyacrylamide gel. The gel was visualized with Typhoon FLA 9500 fluorescence scanner (GE Healthcare, USA) equipped with 473 nm blue LD laser and LBP filter.The above protocols for ZnP1 or DMS probing have been devised in our lab in order to adapt the conventional technique to fluorescently labeled oligonucleotides. We found that the use of the 3′-end fluorescent label (FAM) affords several benefits: (i) the 3′-end label enables the replacement of piperidine with other aqueous and non-aqueous solutions with formamide appearing to be the most efficient among those tested by us (similar observations were made recently by Stevens et al. (27)), (ii) the sequence of the short TQ23 oligonucleotide can be resolved entirely up to the last 3′-end nucleotide even in a small gel due to the low mobility of FAM label and high resolution of modern fluorescent scanners.
RESULTS
Quadruplex conformation remains intact upon ZnP1 binding
We started the study of interaction between ZnP1porphyrin and telomeric DNA with the analysis of structural effects that the ligand might induce in the telomeric DNA quadruplex upon binding. The inherent structural diversity of the human telomeric sequence was represented in this study by three conformations (Scheme 1) obtained by placing the oligonucleotide TQ23 under three types of solution conditions: presence of potassium ions, presence of sodium ions and under molecular crowding conditions.
Scheme 1.
Schemes of (3+1) Form 1 (А), antiparallel (B) and parallel (C) G-quadruplex conformations. Nucleotide numbering corresponds to TQ23 oligonucleotide. Syn- and anti-conformation of guanines are colored in pink and blue respectively.
Schemes of (3+1) Form 1 (А), antiparallel (B) and parallel (C) G-quadruplex conformations. Nucleotide numbering corresponds to TQ23 oligonucleotide. Syn- and anti-conformation of guanines are colored in pink and blue respectively.Corresponding CD spectra of the TQ23 structures are shown in Figure 1 (blue spectra, open circles). The major conformation of TQ23 in the solution containing potassium ions was shown by NMR (4) to be the (3+1) Form 1 of the telomeric G-quadruplex (Scheme 1A). The corresponding CD spectrum consists of a positive band near 290 nm, a shoulder at 265 nm and a small negative band at 240nm (Figure 1A, blue spectrum, open circles). CD spectrum of the sodium-induced conformation (Figure 1B) has a positive band near 295 nm and a negative band at 265 nm, which is characteristic to an opposite stacking interaction of guanine quartets in antiparallel (Scheme 1B) G-quadruplex structure (28,29). Under molecular crowding conditions, TQ23 forms all-parallel G-quadruplex (Scheme 1C) and the CD spectrum has a positive band at 265 nm and a negative band at 240 nm (9) (Figure 1C).
Figure 1.
CD spectra of the telomeric oligonucleotide TQ23 in the presence of (A) K+ ions, (B) Na+ ions ions and under conditions of (C) molecular crowding. Blue open circles—spectra of G-quadruplex structure formed by TQ23 oligonucleotide; red filled circles— spectra in the presence of an equimolar concentration of ZnP1 compound. The concentration of both TQ23 and ZnP1 was 2 μM.
CD spectra of the telomeric oligonucleotide TQ23 in the presence of (A) K+ ions, (B) Na+ ions ions and under conditions of (C) molecular crowding. Blue open circles—spectra of G-quadruplex structure formed by TQ23 oligonucleotide; red filled circles— spectra in the presence of an equimolar concentration of ZnP1 compound. The concentration of both TQ23 and ZnP1 was 2 μM.The addition of an equimolar concentration of ZnP1 compound did not change the CD spectra of the G-quadruplex structures (Figure 1, red spectra, filled circles). Further incubation of either TQ23 conformation with ZnP1 also had no effect on the CD spectra, implying that drug binding does not disturb the DNA structure.The hybrid (3+1) structure of the telomeric DNA is a family that includes 4 structural conformers with different loop arrangements but presumably similar CD spectra (4,6). One-dimensional 1H NMR spectra were recorded in potassium salt in order to exclude possible structural transitions between different conformers within the hybrid (3+1) family upon binding with ZnP1 (Figure 2). NMR spectrum of TQ23 in the absence of ZnP1porphyrin corresponds to the hybrid (3+1) Form 1 conformer of the telomeric G4 as described by Luu et al. (4). In the presence of ZnP1, broadening of resonance peaks and negligible changes of their chemical shifts caused by a complex formation with the ligand were observed. Most importantly, the shape of the spectrum and the positions of the peaks were mainly preserved indicating the conservation of the (3+1) Form 1 quadruplex conformation upon interaction with ZnP1.
Figure 2.
Imino and part of aromatic regions in 1H NMR spectra of ZnP1, telomeric oligonucleotide TQ23 and complexes of TQ23 with ZnP1. The peaks corresponding to imino protons of TQ23 are assigned according to (4).
Imino and part of aromatic regions in 1H NMR spectra of ZnP1, telomeric oligonucleotide TQ23 and complexes of TQ23 with ZnP1. The peaks corresponding to imino protons of TQ23 are assigned according to (4).
ZnP1 binding sites on telomeric quadruplex
Parameters of the ZnP1 interaction with TQ23 quadruplex were measured with ITC. The binding curves are biphasic (Supplementary Figure S2), showing the formation of two types of complexes with different stoichiometry and affinities. Fitting the theoretical binding curve of the two binding modes to the titration data enabled us to determine the thermodynamic parameters of binding (Table 1). The strongest ZnP1 binding had a 1:1 stoichiometry for both sodium and potassium structures although the binding was characterized by a much higher binding constant in the case of the (3+1) Form 1 quadruplex (in the presence of K+ ions) as compared to the sodium-induced TQ23 structure (Na+ ions). Furthermore, weaker types of complexes were observed for both conformations. Three ZnP1 molecules in potassium conditions and two ZnP1 molecules in sodium conditions were able to bind to TQ23 with the constants measuring an order of magnitude smaller than that for the strong type complex. Stoichiometry of strong ZnP1 binding to the parallel TQ23 in PEG had a peculiar feature: the stoichiometry of ZnP1:TQ23 interaction was close 1:2 (Table 1, bottom line). It may be accounted for the binding of a single ZnP1 molecule to two adjacent parallel TQ23 quadruplexes. The dominance of the entropic component of the total free energy of ZnP1 binding to all three G-quadruplex conformations suggests that hydrophobic interactions contribute significantly to binding.
Table 1.
Thermodynamic parameters of ZnP1 binding with TQ23 quadruplex
N1
K1, 106 M−1
ΔH1, kcal/mol
−TΔS1, kcal/mol
N2
K2, 106 M−1
ΔH2, kcal/mol
−TΔS2, kcal/mol
K+
1.0 ± 0.1
130 ± 90
−2.0 ± 0.1
−9.0
3.1 ± 0.1
5 ± 4
−0.33 ± 0.03
−8.8
Na+
0.8 ± 0.1
3.7 ± 1.5
−2.9 ± 0.2
−6.0
2.1 ± 0.2
0.3 ± 0.1
−0.9 ± 0.2
−6.5
K+/PEG
0.4 ± 0.1
15 ± 6
−3.4 ± 0.2
−6.3
2.5 ± 0.1
6.6 ± 0.3
−0.66 ± 0.08
−7.2
The binding of ZnP1 was further monitored by changes to its absorption spectra (Soret band) upon binding to the three G4 conformations of TQ23. The most profound bathochromic shift was observed in the case of the potassium G4 conformer at a low ZnP1:TQ23 ratio (Supplementary Figure S3) when the strong binding site was preferably occupied. This type of change in absorption spectra is indicative of the ligand shielding from solvent and therefore indicates stacking interaction in the strongest complex of ZnP1 with G4 structure under potassium conditions.The preferential position of the ZnP1 binding site in TQ23 quadruplex was also probed by attaching FAM covalently either to the 5′ or to the 3′-end of TQ23 (oligonucleotides F-TQ23 and TQ23-F, correspondingly). The position of the strongest binding site for ZnP1porphyrin was assessed by monitoring of fluorescence quenching upon titration of F-TQ23 and TQ23-F at a low concentration (1 nM) of the oligonucleotides. We found that ZnP1 quenches the 5′-FAM at a markedly smaller concentration than it does the 3′-FAM (Supplementary Figure S4). Therefore, the strongest binding site is closer to the 5′-end of the studied oligonucleotide folds. Note, the covalent attachment of FAM to either end of TQ23 does not change the quadruplex conformation as revealed by CD measurements (Supplementary Figure S5). In agreement with ITC data, the fluorescent method proved that the hybrid (3+1) structure has the highest affinity for ZnP1 among the three G-quadruplex folds considered.
Light-induced conformational changes in telomeric G4 structure
Porphyrins are known to modify nucleic acids by generating reactive oxygen species when exposed to light. This property of porphyrins was tested for ZnP1 in complex with the three G4 conformations under study. Illumination of ZnP1:TQ23 complex with blue light (see Materials and Methods) led to significant CD spectral changes for TQ23 oligonucleotide in potassium and for molecular crowding conditions. According to CD measurements, both the (3+1) and the parallel G4 conformers (Figure 3A and C, correspondingly) tended to transform to an antiparallel type of structure. On the contrary, sodium-induced structures retained conformation upon irradiation of the complex with ZnP1 (Figure 3B). In the control experiment, no changes of TQ23 CD spectra upon light illumination in the absence of ZnP1 was detected (Supplementary Figure S6).
Figure 3.
Changes of circular dichroism spectra after light irradiation of telomeric oligonucleotide TQ23 and ZnP1 complex in the presence of (A) K+ ions and (B) Na+ ions and under (C) molecular crowding conditions. Red spectra correspond to the equimolar mixture of TQ23 oligonucleotide and ZnP1 before irradiation (red, circles); Black not marked spectra were recorded after illumination with blue light for (A and B) 5 and 10 min and (C) 5, 10, 20, 30, 45 min. Green open circles - spectra after illumination with blue light (A –20 min; B – 20min; C – 60 min).
Changes of circular dichroism spectra after light irradiation of telomeric oligonucleotide TQ23 and ZnP1 complex in the presence of (A) K+ ions and (B) Na+ ions and under (C) molecular crowding conditions. Red spectra correspond to the equimolar mixture of TQ23 oligonucleotide and ZnP1 before irradiation (red, circles); Black not marked spectra were recorded after illumination with blue light for (A and B) 5 and 10 min and (C) 5, 10, 20, 30, 45 min. Green open circles - spectra after illumination with blue light (A –20 min; B – 20min; C – 60 min).Similar conformational changes were observed for the interaction of the telomeric quadruplex with the ligands PDS, 360A and phen-DC3 (12). Authors interpreted the observed CD spectral changes in terms of a structural rearrangement of the (3+1) form to an antiparallel G4 caused by the displacement of a K+ ion from the quadruplex. In our case, the binding of the ligand left the structure intact, however, subsequent irradiation with light resulted in the formation of the structure with CD spectrum typical for an antiparallel G4 both in 100 mM KCl and in the presence of 40% PEG 200 with 100 mM KCl (green curves in Figure 3A and C).Light-illumination of the complex ZnP1:TQ23 in a potassium buffer for 30 min resulted in the disappearance of the NMR peaks corresponding to the imino proton transfer in the G4 structure (Figure 2, two bottom spectra). Evidently, the appearance of the oxidation products of guanine nucleotides seems to have led to the destruction of some guanine quartets and the subsequent refolding to a more favorable TQ23 conformation. Since different guanines can be oxidized in different G4-molecules, light-illumination can result in heterogeneous mixture of G-quadruplex molecules of TQ23 characterized by antiparallel type of CD spectrum (to be discussed below in more detail). At the same time, ZnP1 seems to remain bound to the resulting conformations of TQ23 since: (i) positions of ZnP1 aromatic peaks practically do not shift after light illumination (Figure 2), and (ii) the environment of ZnP1 changes insignificantly after irradiation of the ZnP1:TQ23 complex as judged by minor alterations of ZnP1 absorption spectrum (Supplementary Figure S7).Thermodynamic stability of the G4 structure initially increases upon formation of the complex with ZnP1 yet then decreases considerably (ΔTm = 15°C) after light-irradiation of the complex (Supplementary Figure S8). Earlier, Vorlickova et al. demonstrated that direct synthetic replacement of certain guanines with 8-oxo-guanines in the telomeric quadruplex leads to the destabilization of the structure (30). In order to define the position of the modified guanines and the type of modification induced by ZnP1, we performed chemical mapping and MS analysis.
Sp and 8oxoG are the two major forms of guanine light-induced modifications by ZnP1
The products of guanine oxidation were analyzed by MALDI-TOF mass spectrometry. Figure 4 shows MALDI MS spectra for the reaction mixture with an equimolar ZnP1 concentration without light-illumination (top) and after a short exposure to light (bottom). Two signals, with +16 Da and +32 Da, of oxidized oligonucleotide were the most intense in the analyzed reaction mixture. The +16 Da band corresponds most likely to 8-oxoG, while the +32 Da band may indicate either the simultaneous oxidation of two guanines to their 8-oxo form, or the formation of another oxidation product, spiroiminodihydantoin, which contributes to an additional +32 Da shift on the molecular weight of the original oligonucleotide (15). Since the oxidation was performed in mild conditions (5 min of irradiation to the complex) and only a small fraction of molecules were supposed to get oxidized, simultaneous modification of two guanines was very unlikely for statistical reasons. Hence, we assigned the +32 Da peak to the spiroiminodihydantoin oxidation product.
Figure 4.
MALDI MS spectra of ZnP1:TQ23 complex in potassium-containing buffer before (top) and after 5 min of light irradiation (bottom).
MALDI MS spectra of ZnP1:TQ23 complex in potassium-containing buffer before (top) and after 5 min of light irradiation (bottom).
Mapping of the oxidized guanines in TQ23 sequence
Guanine oxidation of the telomeric oligonucleotideTQ23-FAM was performed in five different structural contexts: unfolded DNA (ssDNA), double stranded DNA (dsDNA) and three types of the G-quadruplex conformations mentioned above. ssDNA was obtained by heating and subsequent fast cooling of the oligonucleotide in 20 mM Tris HCl buffer (pH 8.0) without the addition of any counterions. A CD spectrum of TQ23 confirmed that the oligonucleotide was poorly structured under these experimental conditions (Supplementary Figure S9). dsDNA was annealed slowly in presence of the complementary oligonucleotide, TQ23comp, while potassium-, sodium- and PEG-induced G4 conformations were formed as described above. Attachment of the 3′-FAM label did not change any of the G4 conformations as demonstrated above by CD (Supplementary Figure S5). Treatment of the TQ23-FAM with DMS confirmed proper formation of all five types of structures under the indicated conditions: ssDNA (Figure 5 lane11) and dsDNA (Figure 5, lane 15) were modified with DMS, while the three G4 DNA conformations were protected from DMS modification as expected (Figure 5, lanes 12–14).
Figure 5.
Modification of TQ23-FAM with ZnP1 (lanes 6–10) or DMS (lanes 11–15). Five structural forms of TQ23 (see text) was probed: unfolded DNA (ss), G4 potassium form (KCl), G4 sodium (NaCl), G4 in KCl/PEG (PEG) and double stranded DNA (ds). C-control lanes obtained by the same light irradiation in the absence of ZnP1 (lanes 1–5).
Modification of TQ23-FAM with ZnP1 (lanes 6–10) or DMS (lanes 11–15). Five structural forms of TQ23 (see text) was probed: unfolded DNA (ss), G4 potassium form (KCl), G4 sodium (NaCl), G4 in KCl/PEG (PEG) and double stranded DNA (ds). C-control lanes obtained by the same light irradiation in the absence of ZnP1 (lanes 1–5).For ZnP1 probing experiments, the ligand was added to each pre-formed structure, incubated for 10 min and then briefly light irradiated to ensure partial DNA modification. Subsequent cleavage of the TQ23 oligonucleotide at the oxidized guanines showed that each structural form of the oligonucleotide displayed a specific pattern of guanine modification. ssDNA and dsDNA demonstrated weak and nearly uniform oxidation of all the guanines in the TQ23 oligonucleotide (Figure 5, lanes 6 and 10, correspondingly). In the presence of 100 mM KCl, certain guanines of the extreme tetrads were modified. Modifications of the G9 and the G15 were most profound while that of the G3, G23 and G21 were less explicit (Figure 5, lane 7). In presence of 40% PEG 200, the guanines at the 5′-end of each GGG block were the most efficiently oxidized guanines; a weaker oxidation occurred to the guanines of the 3′- tetrad while the middle tetrad remained untouched (Figure 5, lane 9). The higher oxidation efficiency of the guanines belonging to flanking G-quartets can be interpreted by their greater accessibility to the solvent. This is supported by the uniform modification of all Gs in duplex and in non-structured DNA, where the nucleotides are equally accessible.Light-induced modification of the TQ23 with ZnP1 appeared ineffective for sodium-induced G-quadruplex structure. This effect cannot be explained solely by the lower affinity of ZnP1 to the sodium telomeric G4 conformation, as the light-induced modification was performed at concentrations of both oligonucleotide and the drug exceeding dissociation constant of the interaction. Other factors should be considered to provide a possible explanation, e.g. a lower solvent accessibility of guanines in the sodium structure or a different type of the ligand interaction with sodium TQ23 conformation.One can also note that the G23 which is located at the very 3′-end of the oligonucleotide displayed a higher reactivity independent of the structure. This effect can be due to a higher solvent accessibility of the G23 residue because of an inherent flexibility of the 3′-end bearing fluorescent label FAM. In order to exclude FAM-dependent photo-inducible modification of the nearby Gs, we performed a control experiment in the absence of ZnP1 (Figure 5, lanes 1–5). Since no oxidation of the FAM-labeled oligonucleotide was observed in this case, we can conclude that guanine modifications arise exclusively from ZnP1-driven photo-oxidation of DNA. Thus, the pattern of the G4 photo inducible oxidation in the presence of ZnP1 is specific to each telomeric quadruplex conformation.Since neither 8-oxoG nor Sp can maintain the proper structure of the G-tetrad (30), oxidation of any of the G3, G9, G15, G21 or G23 in a KCl solution should lead to destruction of the tetrad this guanine belongs to. The other three guanines of the tetrad may still form a triplet or disintegrate. The two remaining tetrads may also stay intact or rearrange after oxidation. In an attempt to shed some light on how the oxidation of a guanine affects the overall G4 structure, we performed DMS probing of the TQ23 G4 structure after light-induced modification with ZnP1 (Supplementary Figure S10). This experiment reveals the guanines that are still protected by Hoogsteen interactions after the oxidation.When performed in a KCl solution (Supplementary Figure S10, lanes 2–4), the probing experiment clearly shows that after oxidation with ZnP1, the guanines belonging to the extreme tetrads are more strongly modified by DMS than the guanines belonging to the middle tetrad (Supplementary Figure S10, lane 4). Although we probed with DMS a mixture of different molecules that may have different guanines oxidized, we can conclude, that all of them have the middle tetrad intact, while either the top or bottom tetrad are disturbed by oxidation. The same probing experiment was performed in sodium (Supplementary Figure S10, lanes 5–7) and confirmed that the sodium structure was less susceptible to oxidation, remaining largely intact and protected from DMS modification. One may conceive that such a resistance of the sodium structure to ZnP1 oxidation may be attributed to the nature of the counter ion. To address this, we tested the efficiency of ZnP1-dependent oxidation of an unrelated to G4 structure oligonucleotide nonG4: AGGCTTGGCGGGAAAAAGAACG in sodium and potassium buffer solutions (Supplementary Figure S10, lanes 8 and 9). Five minutes of light irradiation of the single-stranded oligonucleotide revealed identical oxidation efficiency of guanines in the different salts.Therefore, the poor oxidation of the sodium conformation in TQ23 is determined by its idiosyncratic structure and its peculiar way of interaction with the ligand. We compared the ZnP1-dependent oxidation of the sodium form of 23-mer TQ23 with that of the 22-mer TQ22 AG3(TTAG3)3 presenting an antiparallel structure established by both NMR and CD methods (2,29). The light-induced changes of the ZnP1 complexes with TQ23 and TQ22 were monitored by CD measurements (Supplementary Figure S11) and by mapping of the modified guanines (Supplementary Figure S12). CD revealed that in spite of the deeper band at 260 nm, the antiparallel sodium structure of TQ22 behaved similarly to the sodium structure of TQ23: binding of ZnP1 to TQ22 or TQ23 in Na+ and subsequent light irradiation have not resulted in any remarkable changes of the CD spectra (Supplementary Figure S11). In agreement with CD, probing of the oxidized guanines showed that, similar to the sodium form of TQ23 oligonucleotide, antiparallel TQ22 structure is resistant to light-induced oxidation (Supplementary Figure S12). Thus, we conclude that the distinctive oxidation patterns of the studied G-quadruplex folds reflect their structural topology.
DISCUSSION
In this work we analyzed the interaction of porphyrin derivative ZnP1 with three conformations of the telomeric G-quadruplex DNA formed by oligonucleotide d(TAGGG(TTAGGG)3) (TQ23). Contrary to the majority of G-quadruplex specific ligands, ZnP1 appeared not to disturb intact structures of the G-quadruplex as demonstrated by CD and NMR. Three independent techniques – ITC, ZnP1 absorption and fluorescent quenching were applied to access an affinity and character of the ligand binding to the G-quadruplex conformations. We observed two types of complexes, a strong and a weak one and a considerable entropy contribution to the free energy of binding. The potassium-induced structure revealed a higher affinity and higher entropic component than the sodium-induced structure. The entropy-driven binding of other porphyrin derivatives to a quadruplex was observed earlier (20) and could be explained by the large hydrophobic surface of the porphyrin ring available for interaction with DNA. Data for TMPyP4 (20) suggests that TMPyP4 molecules could bind to the truncated human quadruplex sequences, both in potassium and under molecular crowding conditions, via two distinct stacking-mode interactions: with the external G-tetrad planes and with the bases of the loops connecting the G-tetrads. Previously, (24) we had found that the interaction of the metal-free tetra-carboxymethylporphyrin analogue P1 with the sodium form of the telomeric quadruplex results in two types of complexes: a strong complex can occur from the interaction with TTA loops whereas the weaker complexes are formed with G-quartets. Evidently, the preferable mode choice of porphyrin binding to G4 DNA (stacking with G-quartets or interaction with loops) is defined by several factors: the type of G4 conformation, the substituents on the porphyrin periphery (carboxymethyl groups in our case) and the presence of a metal-ion in its macrocycle.In case of ZnP1porphyrin, quenching experiments of the 5′- and 3′- fluorescently labeled oligonucleotide TQ23 (Supplementary Figure S4) argue that the preferential site of binding is located within the vicinity of the 5′-end of the oligonucleotide regardless of the type of TQ23 folding: potassium or sodium G4 forms. However, several lines of evidence suggest that the interaction of ZnP1 with potassium and sodium G4 conformations have different characters. Stronger affinity, higher entropy contribution to the binding free energy, a considerable shift of absorption spectra of ZnP1 under potassium conditions may suggest direct stacking interactions of the ligand with the 5′ G-quartet of the (3+1) form. At the same time, decreased entropic components of the interaction with ZnP1, a negligible shift in the Soret band upon ligand binding and resistance of the sodium structure to ZnP1-dependent oxidation assume a different type of interaction by the sodium structure with the ligand. We can suggest that the sodium conformation accommodates ZnP1 mainly by the loops. The bases of the loops could be involved in stacking interactions with ZnP1 in a similar fashion as observed in the X-Ray structure of the TMPyP4 complex with G4 DNA (31), which would explain still notable entropy contribution to free energy of ZnP1 binding to the sodium structure. Resistance of the sodium conformer to ZnP1-dependent oxidation can be explained by a distal interaction of the ligand with the loops, which set the ligand apart from the core of the G4 structure and prevent generated singlet oxygen from reaching the guanines. Antiparallel topology of the sodium form of TQ23 (conforming with its typically antiparallel CD spectrum) would promptly explain its lower affinity to the drug: the interaction could be constrained, e.g. by presence of the diagonal loop that could protect the 5′-G-quartet from stacking with ZnP1. Our comparison of the oxidation efficiency of TQ23 and TQ22 showed that the sodium forms of both oligonucleotides are resistant to oxidation while their potassium forms are more sensitive to ZnP1-dependent oxidation. Similar resistance to ZnP1-dependent oxidation for sodium forms of TQ23 and the antiparallel structure of TQ22 implies similar conformation for both oligonucleotides.Summarizing the experimental data, we conclude that such a distinct behavior of the sodium and potassium forms of TQ23 should originate from their structural dissimilarity. Wang et al. showed by NMR that oligonucleotide TQ23 folds in (3+1) Form 1 structure both in KCl and NaCl solution, despite different CD and 1D NMR spectra (7). If we assume that at low (micromolar) concentrations, both sodium and potassium structures of TQ23 have the same (3+1) topology, then it would be difficult to explain remarkably altered mode of interaction of these conformers with ZnP1 by local differences in the tetrads stacking or tensions in the loops brought about by sodium ions. On the other hand, several studies have demonstrated that a high oligonucleotide concentration coupled with prolonged incubation of the telomeric G-DNA may cause a tremendous change of the initial structure (32–34). We believe that the diverse solution conditions of low (this study) and high (NMR) oligonucleotide concentrations as well as applied renaturation procedures may cause the inconsistency. We have provided several lines of experimental evidence that suggests the presence of a predominantly antiparallel conformation of sodium form in TQ23 under our experimental conditions. Thus, light-induced action of ZnP1porphyrin on the telomeric G-quadruplex reflects a topology of G-quadruplex folding.Although the mechanism of ZnP1 action on the telomeric DNA is not known, we can hypothesize on the nature of the G4 structural changes occurring after light-induced oxidation. Since binding of ZnP1 to G4 DNA does not change its conformation, we conclude that the modification of guanines occurring after irradiation is the main driving force of the conformational changes. According to mapping of TQ23 modification in KCl, several guanines (G3, G9, G15, G21 or G23) of the external tetrads can be oxidized under light irradiation. This experiment is done under conditions when only a small fraction of the DNA molecules are modified, i.e. no more than one guanine is modified per molecule. Consequently, we obtain a mixture of the telomeric G4 molecules with different guanines oxidized. Such heterogeneity makes determining the resulting structure with NMR impossible although the resulting mixture is characterized by antiparallel type of circular dichroism spectrum (Figure 3A, green spectrum). We suppose that regardless of position of modification (G3, G9, G15, G21 or G23), all these different G-quadruplex molecules tend to rearrange into antiparallel G4 conformation. This is supported by works of Vorlickova et al. (30) and Zhou et al. (18), demonstrated that modification of any single guanine of the extreme tetrads is sufficient for triggering certain conformational changes resulted in a final structure with antiparallel type of CD spectrum.Oxidation of any guanine G3, G9, G15, G21 or G23 (schematically depicted in Figure 6A in red) in KCl disturbs either the top or bottom tetrad. Although the C8 atom is not involved in the interaction between the bases, it is located in the grooves and 8-oxo modifications may shift the preference of the base to adopt syn or anti conformation in G4 DNA. 8-oxoG(syn):A(anti) base pair (Figure 6B) is known to arise in double stranded DNA (35) and one can envision this type of interaction between 8-oxoG and an adenine of the loops. This interaction with the loops may include a strand shift as shown in the right column of Figure 6A. Note, that in the latter case, the middle tetrad (G4-G10-G16-G22) still remains intact, thus conforming to the DMS probing of the oxidized G4-DNA (Supplementary Figure S10). The other product, spiroiminodihydantoin must destroy the G-tetrade, but can also create an alternative interaction to an adenine of the loops or a guanine (35,36) (Figure 6B) that could contribute to an energy gain necessary for conformational rearrangement. Additionally, a decrease in the terminal quartet stability leads to a loss of a hydrophobic surface, which may induce the switch to the resulting conformation (CD spectrum in green, Figure 3C).
Figure 6.
(A) Schematic illustration of different products of TQ23 arising after oxidation of one of the guanines G3, G9, G15, G21 in KCl solution by ZnP1 under light irradiation. The oxidized G residue (8-oxoG or Sp) is depicted in red. Although the mechanism of tetrads rearrangement after bulging out of the oxidized G is not known, a shift of the strand containing oxidized guanine base might be involved as illustrated in the right column structures. (B) Hypothetical pairing of Sp with guanine and of 8-oxoG with adenine (35,36).
(A) Schematic illustration of different products of TQ23 arising after oxidation of one of the guanines G3, G9, G15, G21 in KCl solution by ZnP1 under light irradiation. The oxidized G residue (8-oxoG or Sp) is depicted in red. Although the mechanism of tetrads rearrangement after bulging out of the oxidized G is not known, a shift of the strand containing oxidized guanine base might be involved as illustrated in the right column structures. (B) Hypothetical pairing of Sp with guanine and of 8-oxoG with adenine (35,36).Interestingly, the (3+1) potassium telomeric structure tends to change its CD spectra to an antiparallel type under a variety of other factors. For example, the binding of several G4 specific drugs, e.g. 360A, Phen‐DC3 and PDS (12) and cations (37) grant telomeric G4 DNA antiparallel conformation. Along with 8oxoG (30), adenine (38) or an abasic site (39) substitution for any guanine belonging to the terminal quartets had a similar effect according to the CD spectra.
CONCLUSION
In this study, we have demonstrated that Zn(II) tetracarboxymethyl porphyrin derivative ZnP1 is able to bind to different conformations of the G4 telomeric DNA: parallel, antiparallel and (3+1) conformations. Although ZnP1 has different affinities and possible different modes of interaction with the three types of intramolecular telomeric G-quadruplex, the ligand does not affect the native conformation of the G4 DNA upon binding. ZnP1 preferentially modifies intramolecular (3+1) and parallel G4 conformations upon light-illumination producing a pattern of guanine cleavage specific to each conformation. This property may be applied in probing and structural characterization of the quadruplex fold in combination with other spectral data. Independent of the initial type of the telomeric G4 fold, light-induced oxidation of the G4 in complex with ZnP1 results in a conformational rearrangement to an antiparallel type of G4 structure. Modification of guanines at the 5′-end of the telomeric sequence is known to be the most effective in telomerase inhibition (17). We further assume that the light-induced selective oxidation of the 5′-flanking guanines caused by the porphyrin derivatives have the potential to be used for reducing telomerase activity in tumor cells.
Authors: Rashid M Abu-Ghazalah; Steve Rutledge; Lewis W Y Lau; David N Dubins; Robert B Macgregor; Amr S Helmy Journal: Biochemistry Date: 2012-09-07 Impact factor: 3.162
Authors: O A Kovaleva; A K Shchelkina; O K Mamaeva; V A Ol'shevskaia; A V Makarenkov; A S Semeĭkin; A A Shtil'; O F Borisova; D N Kaliuzhnyĭ Journal: Mol Biol (Mosk) Date: 2013 May-Jun
Authors: Oxana A Kovaleva; Vladimir B Tsvetkov; Olga K Mamaeva; Valentina A Ol'shevskaya; Anton V Makarenkov; Lyubov G Dezhenkova; Alexander S Semeikin; Olga F Borisova; Alexander A Shtil; Anna K Shchyolkina; Dmitry N Kaluzhny Journal: Eur Biophys J Date: 2014-08-28 Impact factor: 1.733