Literature DB >> 28912544

Development of chloroplast genome resources for peanut (Arachis hypogaea L.) and other species of Arachis.

Dongmei Yin1, Yun Wang2, Xingguo Zhang2, Xingli Ma2, Xiaoyan He2, Jianhang Zhang2.   

Abstract

ABSRACT: Peanut (Arachis hypogaea L.) is an important oilseed and cash crop worldwide. Wild Arachis spp. are potental sources of novel genes for the genetic improvement of cultivated peanut. Understanding the genetic relationships with cultivated peanut is important for the efficient use of wild species in breeding programmes. However, for this genus, only a few genetic resources have been explored so far. In this study, new chloroplast genomic resources have been developed for the genus Arachis based on whole chloroplast genomes from seven species that were sequenced using next-generation sequencing technologies. The chloroplast genomes ranged in length from 156,275 to 156,395 bp, and their gene contents, gene orders, and GC contents were similar to those for other Fabaceae species. Comparative analyses among the seven chloroplast genomes revealed 643 variable sites that included 212 singletons and 431 parsimony-informative sites. We also identified 101 SSR loci and 85 indel mutation events. Thirty-seven SSR loci were found to be polymorphic by in silico comparative analyses. Eleven highly divergent DNA regions, suitable for phylogenetic and species identification, were detected in the seven chloroplast genomes. A molecular phylogeny based on the complete chloroplast genome sequences provided the best resolution of the seven Arachis species.

Entities:  

Mesh:

Year:  2017        PMID: 28912544      PMCID: PMC5599657          DOI: 10.1038/s41598-017-12026-x

Source DB:  PubMed          Journal:  Sci Rep        ISSN: 2045-2322            Impact factor:   4.379


Introduction

Arachis hypogaea L., known commonly as the peanut or groundnut, is an herbaceous plant belonging to the botanical family Fabaceae. Peanut has a long and relatively complex history which involves natural evolution and human domestication[1]. A. hypogaea is an important oilseed and cash crop worldwide, and is mainly cultivated in tropical and subtropical areas as well as in warm parts of temperate regions. China is the largest peanut producer in the world with over 20% of the planting area and more than 40% of the production[2]. A. hypogaea is an allotetraploid (AABB-type genome; 2n = 4x = 40) with a genome size of about 2.7 Gb that is probably derived from a single recent hybridization event between the two diploid species Arachis ipaensis (BB genome) and Arachis duranensis (AA genome) followed by polyploidization[3]. The genus Arachis is native to South America, and the 80 recognized species have been divided taxonomically into nine sections based on their morphology, geographical distribution, and cross compatibility relationships[4]. Wild Arachis spp. offer novel genetic resources for commercial peanut improvement. Thus, knowledge of the genetic relationships within the genus and accurate species identification is important for the efficient use of wild species in breeding programmes for broadening the genetic base of A. hypogaea [1]. For example, the A. duranensis genome is a major source of candidate genes for fructification and oil biosynthesis[1]. Consequently, in the genus Arachis, molecular resources have been developed in recent years for genetic characterization, phylogenetics, and domestication studies. A wide range of molecular markers including isozymes and proteins[5,6], RFLPs[7], RAPDs[8,9], AFLPs[10,11] and microsatellites[2,12-14] have been used in investgations of genetic diversity and population structure in cultivars/breeding lines and for linkage map construction and QTL analysis. The nrITS (nuclear ribosomal internal transcribed spacer) and 5.8 S rDNA sequences have been used for estimating phylogenetic relationships[15-17]. However, at the genus level, only a few chloroplast genomic resources have been explored. In Genbank, there are presently fewer than 100 sequences from the chloroplast DNA of Arachis species. Chloroplast DNA (cpDNA) is a powerful tool in plant systematics and for the identification of DNA polymorphisms at the inter- and intra-specific levels[18]. The recent availability of next-generation sequencing technologies has enabled the generation of large amounts of DNA sequence data at relatively low cost, which has in turn allowed the exploration of many plant genomes at the molecular level along with novel approaches for phylogenetic studies and breeding strategies. Due to the slower evolution of chloroplast genomes compared to nuclear genomes, chloroplast sequences provide valuable resources that are commonly used in studies of population genetics, phylogeny, phylogeography, and species identification[19-21]. Chloroplasts are key photosynthetic organelles in plants that provide energy to green plants. The chloroplast genome is a highly conserved circular DNA molecule ranging in size from 115 to 165 kb. The cpDNA genome usually carries two copies of a large inverted repeat (IR) separated by small (SSC) and large (LSC) single-copy regions. Approximately 130 genes are encoded by the circular chloroplast genome, which exhibits a highly conserved gene order and content, and typically encodes 79 proteins, 30 transfer RNAs, and four ribosomal RNAs[22,23]. The number of sequenced plant plastid genomes increased rapidly during the last decade due to the implementation of next-generation DNA sequencing technologies[24]. The number of chloroplast genomes from land plants released by the National Center for Biotechnology Information (NCBI) has risen to 1540 (accessed March 7, 2017). Complete chloroplast genome sequences are widely accepted as informative and valuable data sources for studies in evolutionary biology. In this study, we sequenced the chloroplast genomes of seven Arachis species using a next-generation sequencing platform. Our aim was to retrieve valuable chloroplast genome information, such as SNPs, microsatellites, indels, and highly variable regions for this genus, by comparing the chloroplast genomes to one another. Our second objective was to assess phylogenetic relationships among the seven Arachis species. Our results will provide abundant molecular tools for further species identification, phylogenetic resolution, and population genetics, and will also assist in breeding in Arachis species.

Results

Chloroplast genome sequencing, assembly, and validation

Using the Illumina HiSeq. 4000 system, total DNA from seven species of Arachis was sequenced to produce 11,732,639–17,815,336 paired-end raw reads (150 bp average read length) per species. All sequences were assembled by first using a de novo assembly and then a reference-based assembly. To validate the accuracy of the assembled chloroplast genome, four junction regions and all gaps between all contigs were validated by Sanger-based sequencing in each of the seven chloroplast genomes. The finished, high quality chloroplast genome sequences thus obtained were used in the following analyses and were submitted to GenBank.

Chloroplast genome structural features and gene content

The assembled genomes of all seven Arachis species are collinear with previously published chloroplast genomes of Arachis [25], because no rearrangements were identified. The Arachis chloroplast genomes ranged from 156,275 to 156,395 base pairs in length, with A. hypogaea being the largest and A. batizocoi the smallest. All of the Arachis chloroplast genomes displayed the typical quadripartite structure of angiosperm cpDNA, which consists of a pair of IR regions (25,813–25,824 bp) separated by a LSC region (85,863–85,951 bp), and a SSC region (17,786–17,849 bp). The guanine-cytosine (GC) contents of the cpDNA for the seven species were very similar, around 36.4% (Table 2).
Table 2

Details of the complete chloroplast genomes of seven Arachis species.

A. appressipila A. batizocoi A. diogoi A. helodes A. hypogaea A. rigonii A. villosa
Total156,394156,275156,393156,378156,395156,343156,381
LSC85,94685,86385,95185,93485,95185,86885,932
SSC18,80018,78618,79418,79618,79618,84918,801
IR25,82425,8132582425,82425,82425,81325,824
Total110110110110110110110
Protein coding genes76767676767676
rRNA4444444
tRNA30303030303030
GC%36.4%36.4%36.4%36.4%36.4%36.4%36.4%
When the duplicated genes in the IR regions were counted only once, the seven Arachis chloroplast genomes all have 110 different genes arranged in the same order, including 76 protein-coding genes, 30 tRNAs, and 4 rRNAs. Seven genes that include one tRNA gene, four rRNA genes, and five protein-coding genes (rpl23, ycf2, ndhB, rps7, ycf15) are completely duplicated in the IR regions. Twelve of the protein-coding genes and six of the tRNA genes contain introns; 15 of these contain a single intron, whereas three genes have two introns (Fig. 1, Table 1). To detect a possible IR expansion, the IR-LSC/SSC borders with full annotations for the adjacent genes were compared across the seven chloroplast genomes analysed, but no differences were found.
Figure 1

Map of the Arachis chloroplast genome. The genes inside and outside of the circle are transcribed in the clockwise and counterclockwise directions, respectively. Genes belonging to different functional groups are shown in different colors. Thick lines indicate the extent of the inverted repeats (IRa and IRb) that separate the genomes into small single-copy (SSC) and large single-copy (LSC) regions.

Table 1

Genes identified in the chloroplast genome of Arachis species.

Category for genesGroup of geneName of gene
Photosynthesis related genesPhotosystem I psaA, psaB, psaC, psaI, psaJ
Photosystem II psbA, psbB, psbC, psbD, psbE, psbF, psbH, psbI, psbJ, psbK, psbL, psbN, psbT, psbZ
cytochrome b/f compelx petA, *petB, *petD, petG, petL, petN
ATP synthase atpA, atpB, atpE, *atpF, atpH, atpI
cytochrome c synthesis ccsA
Assembly/stability of photosystem I *ycf3,ycf4
NADPH dehydrogenase *ndhA, *ndhB, ndhC, ndhD, ndhE, ndhF,ndhG, ndhH, ndhI, ndhJ, ndhK
Rubisco rbcL
Transcription and translation related genestranscription rpoA, rpoB, *rpoC1, rpoC2
ribosomal proteins rps2, rps3, rps4, rps7, rps8, rps11, *rps12, rps14,rps15, *rps16, rps18, rps19, rpl2, rpl14, *rpl16, rpl20, rpl22, rpl23, rpl32, rpl33,rpl36
RNA genesribosomal RNA rrn5, rrn4.5, rrn16, rrn23
transfer RNA *trnA-UGC, trnC-GCA, trnD-GUC, trnE-UUC, trnF-GAA,trnG-GCC, *trnG-UCC, trnH-GUG, trnI-CAU, *trnI-GAU,*trnK-UUU, trnL-CAA, *trnL-UAA, trnL-UAG, trnfM-CAU,trnM-CAU, trnN-GUU, trnP-UGG, trnQ-UUG,trnR-ACG, trnR-UCU, trnS-GCU, trnS-GGA, trnS-UGA, trnT-GGU,trnT-UGU, trnV-GAC, *trnV-UAC, trnW-CCA, trnY-GUA
Other genesRNA processing matK
carbon metabolism cemA
fatty acid synthesis accD
proteolysis *clpP
Genes of unknown functionconserved reading frames ycf1, ycf2

Intron-containing genes are marked by asterisks (*).

Map of the Arachis chloroplast genome. The genes inside and outside of the circle are transcribed in the clockwise and counterclockwise directions, respectively. Genes belonging to different functional groups are shown in different colors. Thick lines indicate the extent of the inverted repeats (IRa and IRb) that separate the genomes into small single-copy (SSC) and large single-copy (LSC) regions. Analyses of simple sequence repeat (SSR) in the Arachis chloroplast genomes. (A) Number different SSRs types detected by MISA. (B) Frequency of identified SSR motifs in the different repeat classes. Genes identified in the chloroplast genome of Arachis species. Intron-containing genes are marked by asterisks (*). Details of the complete chloroplast genomes of seven Arachis species.

Chloroplast genome sequence divergence among Arachis species

The seven chloroplast genomes were fully aligned, giving an alignment matrix of 156,818 bp. The alignment revealed a high degree of sequence similarity across the Arachis chloroplast genome, which suggests that it is highly conserved in Arachis. We retrieved 643 variable sites (0.41%), including 212 singletons and 431 parsimony-informative sites (0.27%) across the entire chloroplast genome (Table 3).
Table 3

Variable site analyses in the seven Arachis chloroplast genomes.

Variable sitesInformation sitesNucleotide Diversity
Number of sitesNumbers%Numbers%
LSC88,2624600.52%2980.34%0.00185
SSC18,8981350.71%910.48%0.0025
IR25,829240.09%210.08%0.00037
Complete cp genome156,8186430.41%4310.27%0.00144
Variable site analyses in the seven Arachis chloroplast genomes. To elucidate the level of sequence divergence, the nucleotide variability (π) values within 600 bp windows in the seven Arachis chloroplast genomes were calculated with DnaSP 5.0 software. The variability throughout the chloroplast genomes was quantified using the average nucleotide diversity (π) (Fig. 3). The average value of π is 0.00166. Among the LSC, SSC, and IR regions, the SSC exhibits the highest nucleotide diversity (0.0025), and the IR exhibit the least divergence (0.00037). There were eleven peaks which showed remarkably higher π values (>0.006). Two are in the coding regions of ndhF and ycf1, one is in the ndhA intron, and nine are in the intergenic regions (accD-psaI, psbE-petL, rps11-rpl36, rpl32-trnL, trnC-rpoB, trnG-trnS, trnL-trnT-rps4, trnP-psaJ). Seven of these regions lie in the LSC and four are in the SSC.
Figure 3

Sliding window analysis of the complete chloroplast genomes of seven Arachis species (window length: 600 bp, step size: 200 bp). X-axis: position of the window midpoint, Y-axis: nucleotide diversity within each window.

Sliding window analysis of the complete chloroplast genomes of seven Arachis species (window length: 600 bp, step size: 200 bp). X-axis: position of the window midpoint, Y-axis: nucleotide diversity within each window. The number of nucleotide substitutions and p-distances and were used to estimate the divergence between the seven Arachis species. The number of nucleotide substitutions in pairwise comparisons between the seven species ranged from 23 to 433, and the p-distances ranged from 0.00015 to 0.00278 (Table 4). The overall sequence divergence estimated by p-distance among the four genomes was only 0.00167. The cp genomes of A. batizocoi and A. rigonii had the lowest levels of sequence divergence.
Table 4

Nucleotide substitutions and sequence divergence in seven complete chloroplast genomes in Arachis.

A. appressipila A. batizocoi A. diogoi A. helodes A. hypogaea A. rigonii A. villosa
A. appressipila 0.002720.000860.000950.000920.002710.00088
A. batizocoi 4240.002700.002810.002750.000150.00273
A. diogoi 1344210.000570.000610.002660.00074
A. helodes 149438890.000580.002780.00081
A. hypogaea 14442896910.002740.00077
A. rigonii 422234154334270.00270
A. villosa 138425116126121420

The lower triangle shows the number of nucleotide substitutions between the genomes. The upper triangle indicates the calculated sequence divergence for the seven complete chloroplast genomes.

Nucleotide substitutions and sequence divergence in seven complete chloroplast genomes in Arachis. The lower triangle shows the number of nucleotide substitutions between the genomes. The upper triangle indicates the calculated sequence divergence for the seven complete chloroplast genomes.

Indels and microsatellites

The indels were filtered to separate common indel events from all SSR-indel mutations in this study. We adopted a simple and straightforward strategy for identifying common indel mutations. We retrieved 85 common indels from the cp genomes of all seven Arachis species (Table S2). Only one was found in a genic region (ycf1). Ten (12%) were located in intronic regions, including atpF, clpP, ndhA (two indels), petB, petD, trnG, trnV and ycf3 (two indels). Forty-four spacer regions harboured indels; the psbD-trnT spacer had the highest number of indels (seven), followed by atpH-atpF (five), pebM-petN (four), trnV-ndhC (three), and rpl32-trnL (three). The sizes of the common indels ranged from 1 to 20 bp, with indels of 1, 4, and 6 bp being the most common (Fig. 4). The largest one, in ndhF-rpl32, was a deletion in the A. batizocoi cp genome, while the next largest, which was found in ndhE-ndhG, was an insertion in A. rigonii. Most common indels found in the chloroplast genomes provided phylogenetic signal at the species level.
Figure 4

Indels identified in the cp genomes of seven Arachis species. (A) Numbers of individual indels shown by sequence length. (B) Relative frequency of indel occurrence in introns, exons, and spacer regions.

Indels identified in the cp genomes of seven Arachis species. (A) Numbers of individual indels shown by sequence length. (B) Relative frequency of indel occurrence in introns, exons, and spacer regions. With MISA analysis, 101 universal SSR loci were detected in the chloroplast genomes of all seven Arachis species. Among the SSRs identified, we found 60 mononucleotide motifs that ranged in length from 10 to 15 nucleotides, 27 dinucleotide, 5 trinucleotide, and 9 tetranucleotide SSRs. The majority of the SSRs consist of A/T mononucleotide repeats. Chloroplast genome SSRs are composed of A and/or T and rarely contain tandem C and/or G repeats. Thirty-seven SSR loci showed polymorphism after in silico comparative analysis (Fig. 2, Table S3). Intergenic regions contained 30 SSRs, and there were seven located in intronic regions. We designed primer pairs for amplification of all the SSRs (Table 5, Table S4).
Figure 2

Analyses of simple sequence repeat (SSR) in the Arachis chloroplast genomes. (A) Number different SSRs types detected by MISA. (B) Frequency of identified SSR motifs in the different repeat classes.

Table 5

SSRs identified from in silico comparative analysis of the seven Arachis cp genomes.

No.PositionRegionLocatinSSR typeForward sequenceReverse sequenceLength (bp)
1trnK-rbcLLSCspacer(A)10TACCATTGAGTTAGCAACCCCCCGATTTCTTCACGTTACAGAGGC248
2trnK-rbcLLSCspacer(A)12CGATTTCTTCACGATCGGATTAAATATAATCAAATTCGATTTA141
3rbcL-atpBLSCspacer(A)12TCATATGTATGGCGCAACCCAATTCATGGGCGAGCATACAATTT189
4trnV intronLSCintron(T)12TCAAAAACGCAAGGGCTATAGCTACTGGACGTCTCAACCCTTTG190
5trnF-trnLLSCspacer(A)15ACTCGAATCCATTTGTGAAAGACTTCCCTCTATCCCCAAAAGACCT131
6trnL-trnTLSCspacer(T)10TTGCGATTAGAATCGCATTAAAGATTCGACAAAATCTGGATA151
7trnL-trnTLSCspacer(T)11ATTACTGTAACTGTAATAGAAATGCTCTAACCTCTGAGCTA246
8ycf3 2nd intronLSCintron(A)11TGATCTGTCATTACGTGCGACTTCTTTACGGCGCTTCCTCTATC208
9ycf3-psaALSCspacer(T)12TGAAGATCACAGGGCGTTCTTATGGATGGACTGATGTAGACAACA280
10ycf3-psaALSCspacer(AT)7TAGTTCTATTTATATTATTCATTTAAATGAAATATGCATTA143
11ycf3-psaALSCspacer(T)10ATTCAAAAAGGTCCGTTGAGCGCTCCTTCCGGACAACACATACA230
12psbD-trnTLSCspacer(A)14GTGAAGCCATGATTTGATGTAATTAGTCGATATTTACGATTA193
13psbD-trnTLSCspacer(A)10GAATCTTGAGGAACGGGAGGATAGTGGACCTAACCCATTGAATCA158
14psbD-trnTLSCspacer(T)13TTGATTATCATTCATTAGAATGTAAGGCGTAAGTCATCGGT243
15trnT-trnELSCspacer(A)12TCCTGCTCTTGAACCGATTCTTGTTGGTTTGCTAGAAAAGGCGT188
16trnT-trnELSCspacer(G)11TGGAATTATAGATTGGCGATTATGTCCTGGACCACTAGACGA223
17trnD-psbMLSCspacer(A)13CCCGTCAGTCCCGAATGAATAACGATTCATCGTCGAGAATGGAA256
18petN-trnCLSCspacer(T)10AAGATTTACTATATCCATGTGTTGACTCTGTACCAGCGATT182
19trnC-rpoBLSCspacer(AT)6GAAAAAGGATTTGCAGTCCCCCGGTTCCGTTTTGTCCTTCCATT140
20trnC-rpoBLSCspacer(A)10GGTGTGTAAACTCTCCCACCTTAAATCGACTCGGGATTTGTTCG227
21atpH-atpFLSCspacer(T)10TACAAGCGGTATTCAAGCCCTCAATTAATAGAATCAGAATTCA227
22atpH-atpFLSCspacer(T)11ATTCAGTTCTTCGGTCGAACGAACCGTAAACCAATTGTTCGTGT259
23atpF-intronLSCintron(A)10AAAGCAAAGCTAGGCATAGGCAACGTAGGTCATCGATTTCGCAT259
24trnQ-accDLSCspacer(a)13TGCAAGCAAAAGTGTATTCCGGACTTGGTCCAGGATCTTTTAGCT167
25psaJ-rpl33LSCspacer(T)10CTATTGATCGAAATCAATCGTCCATTGAAGCCTGTACCAGAT235
26rpl20-rps12LSCspacer(T)12GAGTTGGTTTAGATCAATCTATGTCAGCAGCAGAAGCTCA231
27rps12-clpPLSCspacer(A)14GTGACATTTCGGATTGGCTGTCATTGTTGATCTTGTCGCGGTTG276
28clpP intron 1LSCintron(T)15AGATCAGCATCAGTAAATGATATCGGAAGCCTATTTCAGTGTC249
29clpP-psbBLSCspacer(A)11CACACCACCATTGCGTATTGTTGAACACGATACCAAGGCAAACC271
30rps11-rpl36LSCspacer(TA)6GAGATGTATGGATATATTCATTTGAATGAATATAGAAATTCTA297
31rps11-rpl36LSCspacer(T)11AGTTTGAATTTCAATATCTAGATCCGAGATTAAGTTGAAGGA251
32rpl16 intronLSCintron(TA)7TCTACAATGGAGCCTCGCAAATACAAATCAAGAGCACCGAGTCA104
33rpl16 intronLSCintron(TTTC)4TGTTGATGCTTTATTACACTTCCCCTCATCGCTTCGCATTATCTGGA272
34rpl2 intronIRintron(T)10TTGCAATCAGTTTCGCTACAGCCTTGTACAGTTTGGGAAGGGGT161
35ndhF-rpl32SSCspacer(A)10GAACTGGAAGCGGAATGAAAGGAGAAGTATTGTGCAAAGATTCAG212
36ndhF-rpl32SSCspacer(A)10ACAGATATCTATGTTTGGCATGCCATGCAACTGATATAGT200
37ndhG-ndhISSCspacer(T)10ATAGAACAGATATCGAAATGAAATAGATATGAAACAGAATA142
SSRs identified from in silico comparative analysis of the seven Arachis cp genomes.

Phylogenetic analysis

We used four datasets (the complete chloroplast genome, the LSC region, the IR region, and the SSC region) to analyze the phylogenetic relationships among members of the genus Arachis. The cp genome of Indigofera tinctoria was used as the outgroup according to Schwarz, et al.[26]. All four datasets produced similar phylogenetic trees with moderate to high support, except for the IR dataset, which had poor support (Fig. 5). The reconstructed phylogeny divided the species into two clades with 100% bootstrap support based on Maximum Likelihood (ML) and Bayesian Inference (BI) analyses. A. batizocoi and A. rigonii form one clade that is sister to the remaining species with 100% bootstrap support. A. hypogaea was closer to A. helodes than to A. diogoi, A. villosa, and A. appressipila.
Figure 5

Phylogenetic relationships of the seven Arachis species constructed from the complete chloroplast genome sequences using maximum likelihood (ML) and Bayesian inference (BI). ML topology shown with ML bootstrap support value/Bayesian posterior probability given at each node.

Phylogenetic relationships of the seven Arachis species constructed from the complete chloroplast genome sequences using maximum likelihood (ML) and Bayesian inference (BI). ML topology shown with ML bootstrap support value/Bayesian posterior probability given at each node.

Discussion

Next generation sequencing (NGS) methods have enabled the rapid and cost-efficient sequencing of plant genomes. In past several years, several studies have reported the development of genetic resources for peanut, including SSRs[14,27], transcript sequences[28,29], and draft nuclear genome sequences[1,3]. However, the chloroplast genome is non-recombining and uniparentally inherited, making it a valuable source of information for improving the phylogenetics, species identification, and resolution[18,30,31]. In this study, we generated complete chloroplast genome sequences for seven Arachis species using NGS sequencing methods. By comparing the chloroplast genome sequences obtained in this work, we were able to retrieve all genetic resources, including SNPs, microsatellites, indels, and ‘hotspot’ regions. The seven Arachis chloroplast genomes showed a high degree of conservation with respect to genome size and structure, gene number, and also GC content. The genetic divergence was found to be extremely low among the seven Arachis chloroplast genomes, as in other angiosperms[32-34]. Within the seven species, only 643 SNPs were detected, which indicated that nucleotide substitution mutations in the chloroplast genome of Arachis species are more prevalent than in species of rice[35,36] and Panax [32], and less frequent than in species of Quercus [37]. Recently, single nucleotide polymorphisms (SNPs) have become the genetic markers of choice, because they are abundant in genomes and are amenable to high-throughput, automated genotyping assays; consequently, SNPs are increasingly popular in phylogeography, phylogenetics and species identification[38,39]. In addition to nucleotide substitutions, indels are another important class of genetic variation. The most common indel sizes range from 1 to 200 bp, and mainly occur in non-coding regions[40]. According to our results, the common indels were often less homoplasious than were nucleotide substitutions (Table S2). It has been shown recently that adding microstructural characters significantly increases resolution and support compared to simple substitution-based matrices of chloroplast DNA sequences[41,42]. SSRs are abundant in the chloroplast genomes of angiosperms, and we identified 101 SSRs in Arachis. The most common types are mononucleotide repeats, ranging in size from 10 to 15 nucleotides, mostly A/T. Because chloroplast genome sequences are highly conserved in Arachis, chloroplastic microsatellites are transferable across species. Polymorphic SSRs allowed us to develop 37 markers for Arachis species (Table 5). These new resources will be potentially useful for population genetic, phylogenetic, and species identification studies in the genus Arachis, possibly in combination with the other informative molecular makers from the mitochondrial and nuclear genomes[27,28,43]. Mutation events in the cp genome are not random, but are clustered in “hotspots,” which result in highly variable regions dispersed throughout the chloroplast genomes[18,44]. We identified eleven variable regions in the Arachis chloroplast genome, which enabled the development of novel markers for genetic studies in Arachis. The divergent hotspot regions could provide adequate genetic information for phylogenetics and species identification, and can be used to develop novel DNA barcodes for Arachis. The chloroplast genome contains highly informative markers in plant phylogenetics due to its relatively small size, largely uniparental inheritance, conservation of gene number and order. With NGS technology, the chloroplast genome can be obtained efficiently, and much valuable sequence data from the chloroplast genome can be developed for plant relationships[45-48]. These larger datasets can offer opportunities for resolving the most taxa in the plant tree of life, even at the species level[36]. The genus Arachis, including approximately 80 species, were divided into nine sections basing on morphological features, geographic distribution and cytogenetics[4]. Although more molecular makers were explored to evaluate Arachis species and sections, the phylogenetic relationships among these them are not fully understood. Here we present a molecular phylogenomics representing nine species. With the chloroplast genome data, they were divided into two groups. One group contains A. batizocoi and A. rigonii, and the other species, A. appressipila, A. appressipila, A. helodes, A. villosa, A. diogoi, and A. hypogaea were clustered together. These Arachis chloroplast genome provided genome-scale information to infer the phylogenetic relationships in Arachis. In this study, we identified indel, SNP, microsatellite, and variable region markers for Arachis by comparative analyses of the seven chloroplast genomes. These new resources will be valuable for exploring the variation in Arachis populations, as well as for phylogenetics and species barcoding.

Materials and Methods

Plant material and DNA extraction

All plant material used in this study was grown in the greenhouse. Fresh leaves of seven Arachis species: Arachis appressipila Krapov. & W. C. Greg., Arachis batizocoi Krapov. & W.C. Greg., Arachis diogoi Hoehne, Arachis helodes Mart. ex Krapov. & Rigoni, Arachis hypogaea L., Arachis rigonii Krapov. & W.C. Greg., and Arachis villosa Benth. were sampled (Table S1). Fresh leaves from each accession were immediately dried with silica gel prior to DNA extraction. Total genomic DNA was extracted using a modified CTAB method[49], and the DNA concentration was quantified using a NanoDrop spectrophotometer (Thermo Scientific, Carlsbad, CA, USA). Total DNA samples with concentrations >30 ng μL−1 were chosen for Illumina sequencing.

Chloroplast genome sequencing, assembly and annotation

DNA was sheared to construct a 400 bp (insert size) paired-end library in accordance with the Illumina HiSeq. 4000 standard protocol. The paired-end reads were qualitatively assessed and assembled using SPAdes 3.6.1[50]. Gaps in the cpDNA sequences were filled by PCR amplification and Sanger sequencing. Sanger sequence reads were proofread and assembled with Sequencher 4.10 (http://www.genecodes.com). The four junctions between the inverted repeats (IRs) and the small single copy (SSC)/large single copy (LSC) regions were checked by amplification with specific primers followed by Sanger sequencing[51]. The cpDNA annotation was performed with Plann[52] using the A. hypogaea reference sequence from Genbank (KX257487). The cpDNA genome map was drawn using Genome Vx software[53].

Molecular marker development and validation

All sequenced Arachis cp genomes were aligned using MIFFT v7[54], assuming collinear genomes for the full alignment, and then adjusted manually using Se-Al 2.0[55]. Variable and parsimony-informative base sites across the complete cp genomes and the LSC, SSC, and IR regions of the six cp genomes were calculated using MEGA 6.0 software[56]. The p-distances among the Arachis chloroplast genomes were calculated with MEGA software to evaluate the divergence among the Arachis species. A sliding window analysis was conducted to calculate the nucleotide diversity (Pi) of the cp genome using DnaSP v5 software. The step size was set to 200 bp, with a 600-bp window length. For retrieving indel mutations, the multiple sequence alignment was imported into DnaSP v5 software[57]. All indels were initially filtered to separate SSRs (simple sequence repeats) from other indel types. The cp genome sequences were analyzed to identify potential microsatellites (SSRs) using MISA software (http://pgrc.ipk-gatersleben.de/misa/). The minimum numbers (thresholds) for the SSR motifs were 10, 5, 4, 3, 3, and 3 for mono-, di-, tri-, tetra-, penta-, and hexa-nucleotide repeats, respectively. All of the repeats found were manually verified, and redundant results were removed. To evaluate the consistency of phylogenetic trees produced from cpDNA regions with different molecular evolutionary rates, we extracted three subsets (LSC, SSC, and IRs) from the complete chloroplast data set, and combined these to produce three types of trees. The lengths of the alignment matrices of these datasets are shown in Table 4. In all the phylogenetic analyses, Indigofera tinctoria was used as an outgroup. The Akaike Information Criterion (AIC) was used in the jModelTest software package v 2.1.3[58] to compare models of character evolution. Maximum likelihood analysis was performed using the RAxML v 8.0.5 software package[59] with 1,000 non-parametric bootstrap replicates. MrBayes 3.2.2[60] was used to perform a Bayesian inference analysis. The Markov chain Monte Carlo (MCMC) analysis was run for 2 × 5,000,000 generations. Trees were sampled at every 1,000 generations with the first 25% discarded as burn-in. The remaining trees were used to build a 50% majority-rule consensus tree. The analysis was run to completion, and the average standard deviation of split frequencies was <0.01. Supplementary information Supplementary Dataset 4
  46 in total

1.  RAPD and ISSR fingerprints as useful genetic markers for analysis of genetic diversity, varietal identification, and phylogenetic relationships in peanut (Arachis hypogaea) cultivars and wild species.

Authors:  S N Raina; V Rani; T Kojima; Y Ogihara; K P Singh; R M Devarumath
Journal:  Genome       Date:  2001-10       Impact factor: 2.166

2.  MAFFT multiple sequence alignment software version 7: improvements in performance and usability.

Authors:  Kazutaka Katoh; Daron M Standley
Journal:  Mol Biol Evol       Date:  2013-01-16       Impact factor: 16.240

3.  Variation of isozyme patterns among Arachis species.

Authors:  H T Stalker; T D Phillips; J P Murphy; T M Jones
Journal:  Theor Appl Genet       Date:  1994-01       Impact factor: 5.699

4.  Transcriptome-wide sequencing provides insights into geocarpy in peanut (Arachis hypogaea L.).

Authors:  Xiaoping Chen; Qingli Yang; Haifen Li; Heying Li; Yanbin Hong; Lijuan Pan; Na Chen; Fanghe Zhu; Xiaoyuan Chi; Wei Zhu; Mingna Chen; Haiyan Liu; Zhen Yang; Erhua Zhang; Tong Wang; Ni Zhong; Mian Wang; Hong Liu; Shijie Wen; Xingyu Li; Guiyuan Zhou; Shaoxiong Li; Hong Wu; Rajeev Varshney; Xuanqiang Liang; Shanlin Yu
Journal:  Plant Biotechnol J       Date:  2015-10-26       Impact factor: 9.803

5.  Whole plastome sequencing reveals deep plastid divergence and cytonuclear discordance between closely related balsam poplars, Populus balsamifera and P. trichocarpa (Salicaceae).

Authors:  Daisie I Huang; Charles A Hefer; Natalia Kolosova; Carl J Douglas; Quentin C B Cronk
Journal:  New Phytol       Date:  2014-07-31       Impact factor: 10.151

6.  MrBayes 3.2: efficient Bayesian phylogenetic inference and model choice across a large model space.

Authors:  Fredrik Ronquist; Maxim Teslenko; Paul van der Mark; Daniel L Ayres; Aaron Darling; Sebastian Höhna; Bret Larget; Liang Liu; Marc A Suchard; John P Huelsenbeck
Journal:  Syst Biol       Date:  2012-02-22       Impact factor: 15.683

7.  Relationships of wild and domesticated rices (Oryza AA genome species) based upon whole chloroplast genome sequences.

Authors:  Peterson W Wambugu; Marta Brozynska; Agnelo Furtado; Daniel L Waters; Robert J Henry
Journal:  Sci Rep       Date:  2015-09-10       Impact factor: 4.379

8.  A chloroplast genomic strategy for designing taxon specific DNA mini-barcodes: a case study on ginsengs.

Authors:  Wenpan Dong; Han Liu; Chao Xu; Yunjuan Zuo; Zhongjian Chen; Shiliang Zhou
Journal:  BMC Genet       Date:  2014-12-20       Impact factor: 2.797

Review 9.  Chloroplast genomes: diversity, evolution, and applications in genetic engineering.

Authors:  Henry Daniell; Choun-Sea Lin; Ming Yu; Wan-Jung Chang
Journal:  Genome Biol       Date:  2016-06-23       Impact factor: 13.583

10.  Shallow Whole Genome Sequencing for the Assembly of Complete Chloroplast Genome Sequence of Arachis hypogaea L.

Authors:  Sudheesh K Prabhudas; Sowjanya Prayaga; Parani Madasamy; Purushothaman Natarajan
Journal:  Front Plant Sci       Date:  2016-07-27       Impact factor: 5.753

View more
  10 in total

1.  Origin and parental genome characterization of the allotetraploid Stylosanthes scabra Vogel (Papilionoideae, Leguminosae), an important legume pasture crop.

Authors:  André Marques; Lívia Moraes; Maria Aparecida Dos Santos; Iara Costa; Lucas Costa; Tomáz Nunes; Natoniel Melo; Marcelo F Simon; Andrew R Leitch; Cicero Almeida; Gustavo Souza
Journal:  Ann Bot       Date:  2018-12-31       Impact factor: 4.357

2.  The Complete Chloroplast Genome Sequence of Cicer bijugum, Genome Organization, and Comparison with Related Species.

Authors:  Melih Temel; Yasin Kaymaz; Duygu Ateş; Abdullah Kahraman; Muhammed Bahattin Tanyolaç
Journal:  Curr Genomics       Date:  2022-04-07       Impact factor: 2.689

3.  Complete chloroplast genome of Myracrodruon urundeuva and its phylogenetics relationships in Anacardiaceae family.

Authors:  Bruno Cesar Rossini; Mario Luiz Teixeira de Moraes; Celso Luis Marino
Journal:  Physiol Mol Biol Plants       Date:  2021-04-11

4.  The complete chloroplast genome of Stryphnodendron adstringens (Leguminosae - Caesalpinioideae): comparative analysis with related Mimosoid species.

Authors:  Ueric José Borges de Souza; Rhewter Nunes; Cíntia Pelegrineti Targueta; José Alexandre Felizola Diniz-Filho; Mariana Pires de Campos Telles
Journal:  Sci Rep       Date:  2019-10-02       Impact factor: 4.379

5.  Twelve complete chloroplast genomes of wild peanuts: great genetic resources and a better understanding of Arachis phylogeny.

Authors:  Juan Wang; Yuan Li; Chunjuan Li; Caixia Yan; Xiaobo Zhao; Cuiling Yuan; Quanxi Sun; Chengren Shi; Shihua Shan
Journal:  BMC Plant Biol       Date:  2019-11-19       Impact factor: 4.215

6.  Comparative and Phylogenetic Analysis of Complete Chloroplast Genomes in Eragrostideae (Chloridoideae, Poaceae).

Authors:  Kuan Liu; Rong Wang; Xiu-Xiu Guo; Xue-Jie Zhang; Xiao-Jian Qu; Shou-Jin Fan
Journal:  Plants (Basel)       Date:  2021-01-06

7.  Chloroplast Phylogenomic Analyses Reveal a Maternal Hybridization Event Leading to the Formation of Cultivated Peanuts.

Authors:  Xiangyu Tian; Luye Shi; Jia Guo; Liuyang Fu; Pei Du; Bingyan Huang; Yue Wu; Xinyou Zhang; Zhenlong Wang
Journal:  Front Plant Sci       Date:  2021-12-17       Impact factor: 5.753

8.  The complete chloroplast genome of Onobrychis gaubae (Fabaceae-Papilionoideae): comparative analysis with related IR-lacking clade species.

Authors:  Mahtab Moghaddam; Atsushi Ohta; Motoki Shimizu; Ryohei Terauchi; Shahrokh Kazempour-Osaloo
Journal:  BMC Plant Biol       Date:  2022-02-19       Impact factor: 4.215

9.  Evolutionary directions of single nucleotide substitutions and structural mutations in the chloroplast genomes of the family Calycanthaceae.

Authors:  Wenpan Dong; Chao Xu; Jun Wen; Shiliang Zhou
Journal:  BMC Evol Biol       Date:  2020-07-31       Impact factor: 3.260

10.  Initial Characterization of the Chloroplast Genome of Vicia sepium, an Important Wild Resource Plant, and Related Inferences About Its Evolution.

Authors:  Chaoyang Li; Yunlin Zhao; Zhenggang Xu; Guiyan Yang; Jiao Peng; Xiaoyun Peng
Journal:  Front Genet       Date:  2020-02-20       Impact factor: 4.599

  10 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.