In silico genomic insights into aspects of food safety and defense mechanisms of a potentially probiotic Lactobacillus pentosus MP-10 isolated from brines of naturally fermented Aloreña green table olives.

Lactobacillus pentosus MP-10, isolated from brines of naturally fermented Aloreña green table olives, exhibited high probiotic potential. The genome sequence of L. pentosus MP-10 is currently considered the largest genome among lactobacilli, highlighting the microorganism's ecological flexibility and adaptability. Here, we analyzed the complete genome sequence for the presence of acquired antibiotic resistance and virulence determinants to understand their defense mechanisms and explore its putative safety in food. The annotated genome sequence revealed evidence of diverse mobile genetic elements, such as prophages, transposases and transposons involved in their adaptation to brine-associated niches. In-silico analysis of L. pentosus MP-10 genome sequence identified a CRISPR (clustered regularly interspaced short palindromic repeats)/cas (CRISPR-associated protein genes) as an immune system against foreign genetic elements, which consisted of six arrays (4-12 repeats) and eleven predicted cas genes [CRISPR1 and CRISPR2 consisted of 3 (Type II-C) and 8 (Type I) genes] with high similarity to L. pentosus KCA1. Bioinformatic analyses revealed L. pentosus MP-10 to be absent of acquired antibiotic resistance genes, and most resistance genes were related to efflux mechanisms; no virulence determinants were found in the genome. This suggests that L. pentosus MP-10 could be considered safe and with high-adaptation potential, which could facilitate its application as a starter culture and probiotic in food preparations.

Introduction

Lactobacilli are ubiquitous in the environment and food production (reviewed in [1]), and they are also part of intestinal, vaginal and oral microbiota [2]. As members of the lactic acid bacteria (LAB), they have been used in food fermentation processes for millennia; however, in the last decade more attention has focused on their probiotic capacity. Thus, when consumed, sufficient live cultures may benefit the host’s health [3]. Lactobacilli and bifidobacteria represent the main LAB probiotics traditionally isolated from human sources (e.g., milk and intestinal tract). However, probiotic LAB from non-dairy origin, such as fruits and vegetables, have increased in the last few years due to increasing frequencies of lactose intolerance, dyslipidemia, allergy and vegetarianism among people [4-6]. Furthermore, those food matrices are characterized by intrinsic physico-chemical properties that mimic conditions in the gastrointestinal tract, since probiotic bacteria from vegetables or fruits possess mechanisms for adherence to surfaces similarly as they would on the intestinal surface, along with their tolerance to acids and several other stresses. As such, several studies have focused on the selection of new probiotic candidates [7, 8] with LAB abundances between 102–104 CFU/g on fruit and vegetable surfaces [9, 10] and 106–108 CFU/g in fermented foods [11, 12].

Along with the probiotic features of some lactobacilli strains, aspects of food safety should be considered as both properties are inherently linked to the specific strains and host susceptibility [13]. Although many Lactobacillus spp. are recognized as GRAS (Generally Regarded As Safe; in the USA) or have attained the QPS (Qualified Presumption of Safety; for the European Commission; European Food Safety Authority “EFSA”) [14] status, probiotic properties and safety aspects of the intended probiotic bacterium should be thoroughly analyzed at genomic scale. Thus, probiogenomics [15] could offer a novel approach to verify the absence of genes related to virulence or antibiotic-resistance transferability and the presence of genes involved in health-promotion.

The complete genome of a potential probiotic Lactobacillus pentosus MP-10, isolated from brines of naturally fermented Aloreña green table olives, was initially sequenced in 2011 [16] and completed in 2016 [17]; in this study, it was re-annotated to provide deeper insight into its defense mechanisms—e.g., antibiotic-resistance and virulence determinants. In this sense, bioinformatic tools could provide a greater sense of the microorganism’s safety in food preparations.

Results and discussion

General genomic features of a probiotic Lactobacillus pentosus MP-10

Lactobacillus pentosus MP-10 has the largest genome among lactobacilli considered to date, which may reflect the bacterium’s ecological flexibility and adaptability. The single circular chromosome of L. pentosus MP-10 consisted of 3,698,214 bp, with an estimated mol% G+C content of 46.32% and 5 plasmids ranging 29–46 kb [17], as represented in Fig 1. The annotated genome sequence (Fig 1A) revealed 3,558 open reading frames (ORFs), of which 84.5% (2,971) were attributed to a COG (Cluster of Orthologous Groups) family and/or were given a functional description; such number exceeded the estimate of protein-coding genes in LAB, of 1,700–2,800 genes [18], and also in L. pentosus strains—such as L. pentosus IG1 from Spanish-style fermented green olives (3,133 ORFs) [19] and L. pentosus KCA1 isolated from a vaginal source (2,992 ORFs) [20]. The genetic variability among L. pentosus strains may be based on their ecological niches as reported by O´Sullivan et al. [21], which compared genomes from different niches. Thus, lactobacilli isolated from fermented olives showed a higher number of predicted ORFs than other sources. Furthermore, ecological adaptability to fermentation is reflected by the presence of additional plasmids in L. pentosus MP-10 (five plasmids; Fig 1B) and seven plasmids in L. pentosus IG1 [19]; plasmids were absent in L. pentosus KCA1 [20]. This suggests that plasmid-borne genes mediate the persistence of lactobacilli in olive fermentation; however, this hypothesis requires further studies for confirmation.

Fig 1

Circular representation of the Lactobacillus pentosus MP-10 chromosome (A) and 5 plasmids (B).

(A) The circles from outside to inside are the annotated CDS elements in forward orientation, the annotated CDS elements in the reverse orientation, several COG functions, the structural RNA, the GC content and the GC screw. (B) The circles from outside to inside of each plasmid are the annotated CDS elements in forward orientation, the annotated CDS elements in the revers orientation, several COG functions, the GC content and the GC screw.

S1 Fig (Supplemental Material) shows the cellular component, the molecular function and the biological process frequencies predicted in L. pentosus MP-10. Among the GO (Gene Ontology) terms, 230 belonged to transcription (DNA-templated), 104 transcription regulation (DNA-templated), 77 to phosphoenolpyruvate-dependent sugar phosphotransferase system, 73 to carbohydrate metabolism, 65 to response to antibiotics, 60 to cell-wall organization, 54 to transport, 48 to sporulation, 33 to glycolytic process and gluconeogenesis, and 12 to defense responses, et al. (S1 Fig).

Comparison of ORFs sequences among L. pentosus MP-10, L. pentosus KCA1, and L. pentosus IG1 (aligned by MAUVE algorithm) showed that the synteny of genes was similar (Fig 2A), although inversion and rearrangements among all L. pentosus strains occurred (Fig 2A). Inversion and rearrangement are the main evolutionary phenomena observed among L. pentosus strains and provide a complete picture of genetic differences among the strains colonizing different ecological niches. The phylogenetic distance between L. pentosus MP-10 and L. pentosus IG1, both isolated from olives, was lower than with L. pentosus KCA1 from vagina (Fig 2B), thus L. pentosus MP-10 was phylogenetically more closely related with L. pentosus IG1.

Fig 2

Mauve visualization of whole genome alignment of L. pentosus MP-10 with L. pentosus IG1 and L. pentosus KCA1 (A) and the phylogenetic tree (B).

Defense mechanisms of Lactobacillus pentosus MP-10

Among the defense mechanisms revealed in the L. pentosus MP-10 genome sequence by in silico analysis, 12 genes were found to be involved in defense responses to viruses and bacteria. Further, we identified the presence of two CRISPR systems: CRISPR1 and CRISPR2 [17] that represent an acquired and adaptive immune system providing protection against mobile genetic elements (i.e., viruses, transposable elements and conjugative plasmids) [22, 23]. In general, a CRISPR mechanism depends on a leader sequence, CRISPR array and CRISPR associated protein responsible genes (cas genes) in bacteria since the expression of CRISPR array could be constitutive or inducible [24, 25]. Analysis carried out with the CRISPRs finder program showed that L. pentosus MP-10 genome possessed genes that encoded nine potential CRISPR arrays (CR) between 159,766 and 3,085,353 bp distributed on the entire whole genome (Fig 3A): six were confirmed CRISPRs, and three were questionable CRISPRs (Fig 3A, Table 1). This may reflect chromosomal plasticity as a means of increasing fitness or changing ecological lifestyles.

Fig 3

Localization of CRISPR elements and prophage regions in L. pentosus MP-10 genome.

(A) Schematic view of the genomic locations of CRISPR arrays (CR) numbered according to the CRISPRdb database. The locations of associated cas Operons (CRISPR1 and CRISPR2) and prophage regions (Region 1, Region 2, Region 3, Region 4 and Region 5), which are numbered according to PHAST are indicated. The asteriscs indicated the questionable CRISPR arrays. (B) Organization of the cas operons (CRISPR1 and CRISPR2) of L. pentosus MP-10 and L. pentosus KCA1. The same color was used for homologous cas genes. The start and end positions are indicated in each case.

Table 1

Characteristics of CRISPR arrays detected in Lactobacillus pentosus MP-10 and other lactobacilli genomes by using CRISPR finder program.

Strains	CRISPR array	Start position	End position	CRISPR length	Number of repeats	DR consensus**
L. pentosus MP-10	CR1	159072	159766	694	11	GTCTTGAATAGTAGTCATATCAAACAGGTTTAGAAC
	CR2*	409315	09451	136	2	CAATCCGTAGCTAAGTCACGTGCACCTGTTT
	CR3	1319339	1319917	578	10	GGATCACCCCCGCATACACGGGGAACAG
	CR4*	1609619	1609708	89	2	GGATCACCCCCGCATACGCGGGGAACAG
	CR5	1610289	1610562	273	5	GGATCACCCCCGCATACGCGGGGAACAG
	CR6	1610698	1611397	699	12	GGATCACCCCCGCATACGCGGGGAACAG
	CR7	1614018	1614531	513	9	ATCACCCCCGCATACACGGGGAACAG
	CR8	2492891	2493112	221	4	TACAGGTGCAGTGGTTGGTGCAGT
	CR9*	3085283	3085353	70	2	CTAGTTGCGGTACTTGAAGCCTT
L. pentosus KCA1	NZ_CM001538_1	131563	132851	1288	20	GTCTTGAATAGTAGTCATATCAAACAGGTTTAGAAC
	NZ_CM001538_2	1239838	1241143	1305	22	GGATCACCCCCGCATACGCGGGGAACAG
	NZ_CM001538_3	1456695	1459106	2411	40	GGATCACCCCCGCATACGCGGGGAACAG
	NZ_CM001538_4	1461724	1462549	825	14	AGGATCACCCCCGCATACACGGGGAATAG
	NZ_CM001538_5	1462701	1463218	517	9	AGGATCACCCCCGCATACACGGGGAATAG
	NZ_CM001538_6	1463351	1464538	1187	20	AGGATCACCCCCGCATACACGGGGAATAG
L. pentosus IG1	FR874854.1_Crispr_1	289548	289944	396	7	GGGATCACCCCCGTATACACGGGGAATACA
	FR874854.1_Crispr_2	299897	300172	275	5	CTATTCCCCGTGTATACGGGGGTGATCCT
	FR874854.1_Crispr_3	585210	585665	455	8	CTGTTCCCCGTGTATGCGGGGGTGATCC
	FR874854.1_Crispr_4	788797	788983	186	4	GTTGTACCACCGCCATCGCCGGGG
	FR874854.1_Crispr_5*	790101	790233	132	3	GTTGTACCACCGCCATCGCCGGGG
	FR874854.1_Crispr_6	920329	920758	429	7	TCTTGACCTTATTGATTTAATGTCCTTCTGAAAC
	FR874854.1_Crispr_7*	1504524	1504670	146	2	GGATTGATGTAAACAGGTGCACGTGACTTAGCTACGGATTG
L. pentosus FL0421	tmp_1_Crispr_1*	221528	221664	136	2	AAACAGGTGTACGTGACTTAGCTACGGATTG
	tmp_1_Crispr_2	466666	467162	496	8	GTTCTAAACCTGTTTGATATGACTACTATTCAAGAC
L. plantarum CF_001296095	NZ_CP012343_2	2563734	2564693	959	15	GTCTTGAATAGTAGTCATATCAAACAGGTTTAGAAC
L. plantarum ZJ316	NC_020229_1	359930	360361	431	7	GTCTTGAATAGTAGTCATATCAAACAGGTTTAGAAC
L. plantarum GCF_001296095	NZ_CP012343_2	2563734	2564693		15	GTCTTGAATAGTAGTCATATCAAACAGGTTTAGAAC
L. plantarum GCF_001715615	NZ_CP015308_2	1823736	1824036		5	GTTCTAAACCTGTTTGATATGACTACTATTCAAGAC
L. plantarum GCF_001660025	NZ_CP015857_1	2311451	2312014		9	GTTCTAAACCTGTTTGATATGACTACTATTCAAGAC
L. plantarum GCF_001659745	NZ_CP015966_1	2416755	2417252		8	GTTCTAAACCTGTTTGATATGACTACTATTCAAGAC
L. plantarum subsp. plantarum GCF_001272315	NZ_CM003439_1	2774673	2775303	630	10	GTCTTGAATAGTAGTCATATCAAACAGGTTTAGAAC
L. paraplantarum GCF_001443645	NZ_CP013130_1	302519	303280	761	12	GGTCTTGACCTTATTGATTTAATGTCCTTCTGAAAC
	NZ_CP013130_2	1344198	1344530	332	6	GGATCACCCCCGCATACACGGGGAACAG
	NZ_CP013130_3	1349145	1349416	271	5	GGATCACCCCCGTATGCACGGGGAATAG
	NZ_CP013130_4	1351689	1352203	514	9	GGATCACCCCCGTATACACGGGGAATAG
	NZ_CP013130_5*	2726056	2726234	178	3	GTCACCTTAGAACAATTCTGAAA
L. brevis GCF_001676805	NZ_CP015398_1	79605	80762	1157	18	GTTCTTAACCCTATTGATTTACCAAGATTCTAAAGC
	NZ_CP015398_2	229570	229735	165	3	GGATCACCCCCACACCTGTGGGGAATAC
	NZ_CP015398_3	391217	391302	85	2	GTATTCCCCACATGTGTGGGGGTGA
	NZ_CP015398_4	1416352	1416623	271	5	GTATTCCCCACGGGTGTGGGGGTGATCC
L. brevis ATCC 367	NC_008497_1	944684	945017	333	6	AGGATCACCCCCACATGTGTGGGGAATAC
	NC_008497_2	2249734	2250005	271	5	GGATCACCCCCACACCTGTGGGGAATAC

*: Questionable CRISPR array.

**: The same DR consensus sequences are indicated by the same color and their reverse complement was underlined.

Each CRISPR array comprised of short spacer sequences that were fragments of foreign DNA, either derived from the phage or plasmid, incorporated into the host between degenerate repeats (DR consensus). The number of confirmed CRISPR arrays was similar in both L. pentosus strains (MP-10 and KCA1); however, the number of repeats and spacers, the CRISPR length, and the DR consensus sequence were different, although two identical repeats were found in both L. pentosus strains (MP-10 and KCA1) (Table 1). Comparison of CRISPR arrays of L. pentosus MP-10 and phylogenetically related lactobacilli, such as L. plantarum, L. paraplantarum and L. brevis (available in CRISPRs database), showed that one DR consensus (5´-GTCTTGAATAGTAGTCATATCAAACAGGTTTAGAAC-3´) or its reverse complement was shared by all L. pentosus and L. plantarum strains except L. pentosus IG1 (Table 1). Such DR consensus could be considered as a more conserved repeat signature in L. plantarum group.

The number of spacers ranged from four in CR5 to eleven in CR6 identified within the six confirmed CRISPR arrays with lengths ranging from 29 to 51 bp (40 bp average length) (Table 2). The search of protospacer was done using CRISPR Target program to localize the DNA target acquired by horizontal gene transfer, and the results revealed the presence of protospacers related to plasmids and phages. These protospacers were located within genes encoding structural viral protein (such as tail-fiber protein) or bacterial enzymes such as thioredoxin reductase, short-chain dehydrogenase, excinuclease ABC subunit A and FMN-dependent oxidoreductase, nitrilotriacetate monooxygenase family protein, et al. (Table 2). Furthermore, the protospacers were also identified within genes of unknown function and in intergenic regions (Table 2).

Table 2

Characteristics of spacers from CRISPR arrays in Lactobacillus pentosus MP-10 genome as revealed by CRISPRTarget program.

CRISPR array	Spacer sequence (5´-3´)	Protospacer characteristics
		Origin of DNA	Position	Strand	Score	Accession number	Gene (GenBank)
CR1	AAAATCATTTGTAAAGTTCAATGGCTTGTT	Haematospirillum jordaniae H5569 Plasmid unnamed 2	262527..262506	-	20	NZ_CP014527.1	Non coding
	GACGCTAACGATCGCCCAACTAAGGTATGGTTACC	X	X	X	X	X	X
	CGCTTGCATGGTACAATAGGAACATGGCAGCGGA	X	X	X	X	X	X
	CGGATGGTCTGCACCTGCGCT	X	X	X	X	X	X
	GGAACGATGGGGAAATAAAGGTTCGCGCCAAGAG	X	X	X	X	X	X
	TATCAGGATGCCCTAAAGACTGCTA	X	X	X	X	X	X
	TTTAAATTCTCCTTTATCTCTTATCGTTTT	Borrelia miyamotoi FR64b Plasmid_07	15826..15799	-	20	NZ_CP004224.1	Non coding
		Clostridium taeniosporum 1/k Plasmid pCt3	119290..119311	+	20	NZ_CP017256.1	Thioredoxin reductase
	TTGCTGTTAAGCTAACTGGCGACATGAGCATTCCC	X	X	X	X	X	X
	ATATTTCCGTTCAAACAACGTAACT	X	X	X	X	X	X
	CGAGCCAAACAAAATTTCGATGTTCAGCAA	X	X	X	X	X	X
CR2*	ACATCAATCCGTAGCTAAGTCACGTGCACCTGTTTACATCAATCCATAGCAAAACCAACGTGCACTTGTTTTCAA	X	X	X	X	X	X
CR3	TCATCTAGTAGATGAATTTGATTGTGGAAATAGG	Buchnera aphidicola str. Ua (Uroleucon ambrosiae) Plasmid pLeu	1180..1206	+	21	NC_017261.1	Non coding
	CAAGTGTTCTGCGAAGAAGCGCTGACAAAAGCCA	Pseudomonas Phage phiPSA1	7572..7597	+	20	KJ507100	Tail fiber protein
	AAAGTCTAAATTTCCGTTCGAATCTTTAAACCA	X	X	X	X	X	X
	ATGACAAGACCAACGATGCGAAGTCCAATGTAA	X	X	X	X	X	X
	ATGCACGAATCGGCGGAACATCCGCCGACAACA	X	X	X	X	X	X
	AAAATATGTTGACCGGTATCGGGCGGGTAACAA	X	X	X	X	X	X
	GAGCGTTCCTTTTTGGCACGGGATTGTTATTCG	Ensifer adhaerens Casida A Plasmid pCasidaAA	246999..247027	+	21	NZ_CP015881.1	Non coding
	TACAATGTACTTGTAGATAAGGAAAGGAAGTTA
	CGCCTTCGCGGTCACGAAAACCGCGATGATGAT	Shinella sp. HZN7 Plasmid pShin-01	346033..346060	+	22	NZ_CP015737.1	TonB-dependent receptor
		Burkholderia phymatum STM815 Plasmid pBPHY01	1636942..1636911	-	22	NC_010625.1	Short-chain dehydrogenase
		Novosphingobium resinovorum SA1 Plasmid pSA2	269117..269088	-	20	NZ_CP017077.1	Excinuclease ABC subunit A
		Sinorhizobium sp. RAC02 Plasmid pBSY16_1	1283345..1283370	+	20	NZ_CP016452.1	FMN-dependent oxidoreductase, nitrilotriacetate monooxygenase family protein
		Escherichia coli PMV-1 pHUSEC411like plasmid	11436..11413	-	20	NC_022371.1	Non coding
		Burkholderia phenoliruptrix BR3459a Plasmid pSYMBR3459	597126..597105	-	20	NC_018696.1	Non coding
		Ralstonia eutropha JMP134 Megaplasmid	24652..24681	+	20	NC_007336.1	Excinuclease ABC, A subunit
CR4*	GGTTGCAGCGGTGCTCGTTGCTTGA	X	X	X	X	X	X
CR5	TATGAGTGGCTGATTGTAAACAATGAATTAGAGG	Acinetobacter baumannii MDR-TJ Plasmid pABTJ1	72649..72622	-	20	NC_017848.1	Hypothetical protein
		Acinetobacter baumannii BJAB07104 Plasmid p1BJAB07104	3093..3066	-	20	NC_021727.1	Hypothetical protein
		Acinetobacter baumannii BJAB0868 Plasmid p2BJAB0868	3093..3066	-	20	NC_021731.1	Hypothetical protein
	CCTGTCGTCATTGATGTAACGGATGGTACCGAG	X	X	X	X	X	X
	CGAACCGGGTACTTGTGTTATTAGGGCTTGTTG	X	X	X	X	X	X
	CAAATCTTCTGAATCACTAATCGCTGAAGCTGA	Bacillus Phage Eldridge	35750..35781	+	20	KU253712	Hypothetical protein
CR6	GTAAAAAACTTTATCCACTCCATGCGCTCCTTG	X	X	X	X	X	X
	GATTGAGAATCTGCAAAACCCGTTAAGCCCTTA	X	X	X	X	X	X
	CCTAATCCAGTCAAACTCATGCCGTTTCGAACA	X	X	X	X	X	X
	AAATACTTATCTTTTGAGACAGCCAACCACATG	Moraxella Phage Mcat17	53007..53034	+	20	KR093641	Non coding
	CATTGATATGGTGGGTTTTTGTTTTGCCAAAAAG	X	X	X	X	X	X
	TGAAGTTTAAGCTGCAGCGCGAAGCTATTGGTA	X	X	X	X	X	X
	CGTTGGCACTTAACGCCGCTATTGGCCTGATGA	Ensifer adhaerens OV14 Plasmid pOV14b	1574834..1574861	+	20	NZ_CP007239.1	NADH:ubiquinone oxidoreductase
	GTCAAGCGTTCAGCTTTGTCGACACCGACGTTA	X	X	X	X	X	X
	CAACTTAACCCTTACCAATTGGTAAGGGTTTTA	X	X	X	X	X	X
	TATCGTAGTTAGTCAAATGCATGACGCGATTCG	X	X	X	X	X	X
	GCCGTTAATTTCGTAATAAAATCATCGTAACCA	Leuconostoc gelidum subsp. gasicomitatum KG16-1 Plasmid: III	21115..21141	+	21	NZ_LN890333.1	Conjugal transfer protein
CR7	GTTCCAAATATAGGAATGTCAATCGGTCACTAAG	X	X	X	X	X	X
	GAATGTGAAGCTGCCCGTATATCGCATCATTAAG	X	X	X	X	X	X
	CGATGTTCTTGTAATACCAAGCTTGTTCTCCCGGG	X	X	X	X	X	X
	AGTGCTTTGGTATCATACCGATCAGCGACTTTGGG	X	X	X	X	X	X
	TGTGAACGCGCAAACGTCTGAATACAGCAAGTAG	X	X	X	X	X	X
	GAGTATTTCCCGCCCGTGGCTGAGGCATTTTGAG	X	X	X	X	X	X
	AATAGTGCAAACTTCACCAAAATGGCAACGCAGG	X	X	X	X	X	X
	TCGCCGCTAGTACCAGTAGCAATCCAATATCCAGG	Enterococcus faecalis Plasmid pBEE99	1574..1547	-	20	NC_013533	Non coding
CR8	TGAACCGTTGGATGAGTTGTTGTCATCCACATCATCATCACTAGGCGTCGT	X	X	X	X	X	X
	TGTAGTCGTACCAGTGCCGCCACCATTGATGTTGTCGCCAGT	Geminocystis sp. NIES-3709 Plasmid pGM3709_05	9880..9908	+	21	NZ_AP014826.1	Hypothetical protein
		Rhizobium sp. LPU83 Plasmid pLPU83d	1927939..1927909	-	21	NZ_HG916855.1	Hypothetical protein
		Oscillatoria nigro-viridis PCC 7112 Plasmid pOSC7112.02	27040..27007	-	20	NC_019730.1	Cobyrinic acid a,c-diamide synthase
		Pseudomonas Phage 17A	16695..16720	+	20	LN889995	Non coding
		Pseudomonas Phage vB_PaeM_PAO1_Ab29	38037..38008	-	20	LN610588	Hypothetical protein
		Pseudomonas Phage S12-1	29421..29392	-	20	LC102730	Phage protein
		Pseudomonas Phage vB_PaeM_CEB_DP1	30502..30473	-	20	KR869157	Putative structural protein
		Pseudomonas Phage phiKTN6	29954..29925	-	20	KP340288	Structural protein
		Pseudomonas Phage phiKT28	30552..30523	-	20	KP340287	Structural protein
		Pseudomonas Phage NH-4	30503..30474	-	20	JN254800	Hypothetical protein
		Pseudomonas Phage SN	30731..30702	-	20	FM887021	Structural protein
		Pseudomonas Phage LMA2	30502..30473	-	20	FM201282	Putative structural protein
		Pseudomonas Phage KPP12	29436..29407	-	20	AB560486	Putative structural protein
	GCTGCCACCACCATTGTTACCGTTGTCACCAGT	Klebsiella variicola DX120E Plasmid pKV2	50267..50292	+	20	NZ_CP009276.1	Non coding
		Burkholderia caribensis MBA4 Plasmid	1469077..1469048	-	20	NZ_CP012748.1	Hypothetical protein
		Lactobacillus plantarum Bacteriophage LP65	62235..62260	+	20	AY682195	Non coding
CR9*	GGTTGCAGCGGTGCTCGTTGCTTGA	X	X	X	X	X	X

X: No results obtained by CRISPRTarget program. HP: Hypothetical protein. ND: Not determined.

Given that the spacers were usually added at one side of the CRISPR system, the chronological record of the viruses and plasmids (protospacers), which invaded L. pentosus MP-10 or its ancestors, could be detected by searching for the spacers with BLAST (Basic Local Alignment Search Tool). For example in CR1, we suggested that the primary invasion was accomplished by Haematospirillum jordaniae H5569 Plasmid unnamed 2, then by other short sequences followed by Borrelia miyamotoi FR64b Plasmid_07, and Clostridium taeniosporum 1/k Plasmid pCt3 (Table 2). On the other hand, multiple targets were observed for all confirmed CRISPR spacers of L. pentosus MP-10 except for CR7 (Table 2). This suggests that L. pentosus MP-10 could target many diverse viruses and plasmids. As such, they could possess an efficient defense mechanism against different pathogens, not only in food systems, but also in intestinal tract—thus reinforcing their probiotic capacity.

Regarding the CRISPR-associated protein involved in sequence-specific recognition and cleavage of target DNA complementary to the spacer, according to the classification suggested by Makarova et al. [26], three major types of the CRISPR-Cas systems were differentiated (Types I, II and III). However, in the present study both signature genes for the Type I (cas3) and Type II (cas9) systems were detected in L. pentosus MP-10 genome (S1 Table, Fig 3B). CRISPR1 and CRISPR2 consisted of three Type-II-C and eight Type-I genes, respectively (Fig 3B), and they were closely associated with the palindromic repeat/spacer units (Fig 3A). CRISPR1 operon consisted of only three genes (cas1, cas2 and cas9), which were similar to those of Streptococcus thermophilus (S1 Table) and adjacent to the CR1 array (Fig 3A). A comparison of L. pentosus MP-10 and L. pentosus KCA1 revealed that CRISPR1 of L. pentosus KCA1 contained one more gene encoding a protein involved in adaptation (the csn2 gene) [27]; while CRISPR1 of L. pentosus KCA1 belonged to Type II-A, CRISPR1 of L. pentosus MP-10 belonged to Type II-C lacking this fourth gene (Fig 3B). Regarding CRISPR2 of L. pentosus MP-10, this operon consisted of eight genes: the coding genes for CRISPR-associated endonucleases Cas1 and Cas2 (ygbT and ygbF genes); the CRISPR system Cascade subunit CasC (casC gene); and the CRISPR system Cascade subunit Cas5 (XX999_01592 gene ID of L. pentosus MP-10), which were similar to Escherichia coli, the Cas3 nuclease/helicase (cas3 gene) in Streptococcus thermophilus, the CRISPR-associated endoribonuclease Cse3 in Thermus thermophilus and two genes unique for L. pentosus MP-10 (XX999_01589 gene ID, or cse1_Lpe gene, and XX999_01590 gene ID, or cse2_Lpe gene) (S1 Table). Among the eight genes of CRISPR2, five of them were shared by both L. pentosus strains (MP-10 and KCA1): cas1, cas2, cas3, casC, cas5 and cse3 (Fig 3B); however, both unique genes for L. pentosus MP-10 (XX999_01589 gene ID, or cse1_Lpe gene, and XX999_01590 gene ID, or cse2_Lpe gene) corresponded to CRISPR-associated protein (KCA1_RS06550) and cse2/casB (KCA1_RS06555) in L. pentosus KCA1. Alignment of these genes revealed that the cse1-Lpe gene from L. pentosus MP-10 showed high similarity to the CRISPR-associated protein from L. pentosus DSM 20314 and L. pentosus FL0421 (99.8% identity) and also with L. pentosus KCA1 (94.2%). However, it showed only 71.6% identity with cse1 gene sequence from L. pentosus IG1, which formed a separate lineage from the other cluster representing the four lactobacilli (Fig 4A). On the other hand, the cse2-Lpe gene from L. pentosus MP-10 was identical to the cse2 gene from L. pentosus DSM 20314 and L. pentosus FL0421 (100% identity) and highly similar to cse2/casB gene from L. pentosus KCA1 (90.2% identity); however, L. pentosus IG1 formed a different lineage (67.3% identity) from the main cluster of other lactobacilli (Fig 4B). It is noteworthy to highlight that the CRISPR genes found in L. pentosus MP-10 were more highly similar to those of L. pentosus DSM 20314 (isolated from corn silage), L. pentosus FL0421 (isolated from temperate deciduous-forest biome soil), and L. pentosus KCA1 (isolated from the vagina), than L. pentosus IG1 isolated from fermented olives. These data provided new insight into the evolution of bacterial resistance against mobile elements in Lactobacillus spp., which highlight their interconnection between different ecosystems; thus L. pentosus MP-10 possess multiple CRISPR elements of various nature, which are (again) of great relevance for the application of this bacterium, not only as a promising probiotic, but also as starter culture at industrial scale.

Fig 4

Phylogenetic relationships of L. pentosus inferred from the alignment of the CRISPR-associated proteins encoding genes [cse1 (A) and cse2 (B)].

The sequences were aligned and the most parsimonious phylogenetic trees were constructed using the CLUSTAL W of Lasergene program, version 14 (MegAlign 14, Inc., Madison, WI, USA). The scale below indicates the number of nucleotide substitutions. Accession numbers are indicated in parentheses.

Detection of mobile genetic elements in Lactobacillus pentosus MP-10 genome

Bacterial genome of L. pentosus MP-10 included 29 transposase, four putative transposon Tn552 DNA-invertase bin3 (four different genes of the same family) located on plasmids (pLPE-2, pLPE-3, pLPE-4 and pLPE-5), and one transposase repressor (IS2 repressor TnpA) coding gene. The transposases represented nine different families, with three of them appearing in multiple copies ranging from three to six (Table 3). Furthermore, they were highly represented by the DDE superfamily: 17 transposase DDE domain proteins (five different genes), which appeared in 5–7 copies as a result of replication events. Other transposases were represented by three transposases (three different genes), three transposases of the mutator family (three different genes), two putative transposases (two different genes, with a single gene unique to L. pentosus MP-10), two transposase IS200 like proteins (two different genes, with one gene unique to L. pentosus MP-10), one transposase from transposon Tn916 and one IS2 transposase TnpB coding gene. Similarity of L. pentosus MP-10 transposase genes was shown to transposases from other Lactobacillus spp.: mainly L. plantarum, L. fermentum, and L. brevis (Table 3). The number of transposase genes present in L. pentosus MP-10 (29 genes) was higher than other lactobacilli strains such as L. pentosus KCA1 (25 genes) [20], L. acidophilus NCFM (18 genes) [28], L. pentosus DSM 20314 (14 genes) and L. pentosus IG1 (five genes) which suggested that insertion element-mediated genome diversification was more frequent in the L. pentosus MP-10 environment (Table 3). Furthermore, BLASTx analysis of transposase-unique genes, predicted in L. pentosus MP-10, revealed similarly encoded proteins in other lactobacilli, and the result further showed that the encoded transposase of L. pentosus MP-10 had similarity with transposase proteins of L. pentosus KCA1, L. pentosus DSM 20314 and L. pentosus FL0421 (Fig 5). ClustalW alignment of XX999_01924 putative transposase and other transposase genes showed 100% identity to transposase gene from L. pentosus DSM 20314 (Fig 5A); however, it was more similar to L. plantarum EGD-AQ4 (98.2% identity) than to L. pentosus KCA1 (90.3% identity) transposases (Fig 5A). Regarding the transposase IS200-like protein encoding gene (XX999_01925), alignment with ClustalW with other related genes showed 100% identity to L. pentosus FL0421 and L. pentosus DSM 20314 (Fig 5B); however, similarly we observed less homology to the encoding gene for the transposase-IS200-like protein from L. pentosus KCA1 (94.9% identity) than to L. plantarum EGD-AQ4 (98.6% identity) (Fig 5B).

Table 3

Characterization of transposase and transposon elements predicted in Lactobacillus pentosus MP-10 genome.

Gene ID	Gene	Position	Strand	Gen length (bp)	Protein description	Protein family	Similarity to transposase in Lactobacillus*
XX999_00032§	bin3_1	24835–25416	-	582	Putative transposon Tn552 DNA-invertase bin3	UniProtKB:P20384	98% identity transposase in L. paracollinoides TMW 1.1995 plasmid pL11995-6
XX999_00061£	XX999_00061	6507–6758	-	252	Transposase	Pfam:PF01527.14	100% identity transposase in L. lindneri TMW 1.481
XX999_00069£	XX999_00069	14032–14613	-	582	Transposase, Mutator family	Pfam:PF00872.12	99% identity transposase in L. fermentum 47–7
XX999_00071£	bin3_2	17298–17972	-	675	Putative transposon Tn552 DNA-invertase bin3	UniProtKB:P20384	99% identity transposase in L. fermentum IFO 3956
XX999_00112	XX999_00112	22929–23432	-	504	Transposase DDE domain protein	Pfam:PF01609.15	99% identity transposase in L. plantarum LY-78
XX999_00245	XX999_00245	157564–158067	-	504	Transposase DDE domain protein	Pfam:PF01609.15	99% identity transposase in L. plantarum LY-78
XX999_00336	XX999_00336	260525–261202	+	678	IS2 repressor TnpA	CLUSTERS:PRK09413	100% identity transposase in L. plantarum AY01
XX999_00337	XX999_00337	261379–262110	+	732	IS2 transposase TnpB	CLUSTERS:PRK09409	100% identity transposase in L. plantarum MF1298 plasmid unnamed7
XX999_00400	XX999_00400	331304–331807	-	504	Transposase DDE domain protein	Pfam:PF01609.15	99% identity transposase in L. plantarum LY-78
XX999_00407	XX999_00407	334530–334901	+	372	Transposase DDE domain protein	Pfam:PF01609.15	99% identity transposase in L. plantarum subsp. plantarum TS12
XX999_00611	XX999_00611	565747–566250	-	504	Transposase DDE domain protein	Pfam:PF01609.15	99% identity transposase in L. plantarum LY-78
XX999_00680	Int-Tn	637701–638858	-	1158	Transposase from transposon Tn916	UniProtKB:P22886	97% identity transposase in L. plantarum LZ206
XX999_01017	XX999_01017	992606–992803	+	198	Transposase	Pfam:PF01527.14	100% identity transposase in L. pentosus IG1
XX999_01502	XX999_01502	1519616–1519912	+	297	Transposase DDE domain protein	Pfam:PF01609.15	99% identity transposase in L. plantarum C410L1 plasmid unnamed1
XX999_01619	XX999_01619	1648272–1648775	+	504	Transposase DDE domain protein	Pfam:PF01609.15	99% identity transposase in L.. plantarum LY-78
XX999_01924	XX999_01924	1973033–1974301	-	1269	Putative transposase	Pfam:PF01385.13	-
XX999_01925	XX999_01925	1974399–1974839	+	441	Transposase IS200 like protein	Pfam:PF01797.10	-
XX999_02663	XX999_02663	2747991–2749130	-	1140	Putative transposase DNA-binding domain protein	Pfam:PF07282.5	75% identity transposase in L. brevis BSO 464 plasmid pLb464-1
XX999_02664	XX999_02664	2749111–2749563	-	453	Transposase IS200 like protein	Pfam:PF01797.10	80% identity transposase in L. brevis BSO 464 plasmid pLb464-1
XX999_02834	XX999_02834	2935214–2935510	+	297	Transposase DDE domain protein	Pfam:PF01609.15	99% identity transposase in L. plantarum LZ227 plasmid LZ227p2
XX999_02924	XX999_02924	3033618–3033914	+	297	Transposase DDE domain protein	Pfam:PF01609.15	99% identity transposase in L. plantarum C410L1 plasmid unnamed1
XX999_02993	XX999_02993	3117440–3117943	+	504	Transposase DDE domain protein	Pfam:PF01609.15	99% identity transposase in L. plantarum LY-78
XX999_03221	XX999_03221	3359214–3359585	+	372	Transposase DDE domain protein	Pfam:PF01609.15	99% identity transposase in L. plantarum subsp. plantarum TS12
XX999_03439	XX999_03439	3608820–3609191	-	372	Transposase DDE domain protein	Pfam:PF01609.15	99% identity transposase in L. plantarum subsp. plantarum TS12
XX999_03498	XX999_03498	3674577–3674948	+	372	Transposase DDE domain protein	Pfam:PF01609.15	99% identity transposase in L. plantarum subsp. plantarum TS12
XX999_03585#	XX999_03585	24998–25501	-	504	Transposase DDE domain protein	Pfam:PF01609.15	99% identity transposase in L. plantarum subsp. plantarum P-8 plasmid LBPp7
XX999_03604#	bin3_3	40077–40709	+	633	Putative transposon Tn552 DNA-invertase bin3	UniProtKB:P20384	100% identity transposase in L. backii TMW 1.1992 plasmid pL11992-1
XX999_03610#	XX999_03610	45885–46475	-	591	Transposase, Mutator family	Pfam:PF00872.12	100% identity transposase in L. backii TMW 1.1992 plasmid pL11992-1
XX999_03614¥	XX999_03614	4535–5902	-	1368	Transposase DDE domain protein	Pfam:PF01609.15	-
XX999_03618¥	XX999_03618	9187–9690	+	504	Transposase DDE domain protein	Pfam:PF01609.15	100% identity transposase in L. plantarum BM4 plasmid pBM2
XX999_03623¥	XX999_03623	13862–15037	+	1176	Transposase, Mutator family	Pfam:PF00872.12	99% identity transposase in L. acidipiscis ACA-DC 1533
XX999_03627¥	XX999_03627	17186–17482	+	297	Transposase DDE domain protein	Pfam:PF01609.15	99% identity transposase in L. plantarum C410L1 plasmid unnamed1
XX999_03633¥	bin3_4	22401–23033	-	633	Putative transposon Tn552 DNA-invertase bin3	UniProtKB:P20384	99% identity transposase in L. plantarum ZJ316 plasmid pLP-ZJ103

*: The best hit was indicated.

§: sequences of pLPE-4 plasmid;

£: sequences of pLPE-3 plasmid;

#: sequences of pLPE-5 plasmid;

¥: sequences of pLPE-2 plasmid.

Fig 5

Phylogenetic relationships of L. pentosus and L. plantarum inferred from the alignment of the transposase encoding genes.

The sequences were aligned and the most parsimonious phylogenetic trees were constructed using the CLUSTAL W of Lasergene program, version 14 (MegAlign 14, Inc., Madison, WI, USA). The scale below indicates the number of nucleotide substitutions. Accession numbers are indicated in parentheses.

On the other hand, screening for prophage DNA within L. pentosus MP-10 genome, using bioinformatic tools such as PHAST, determined the presence of five temperate phage regions. Two regions were intact (Regions 2 and 5, score > 90), the other two were questionable (Regions 1 and 4, score 70–90), and the last one was incomplete (region 3, score < 70) (Fig 3A, Table 4). The complete prophage regions of L. pentosus MP-10 chromosome were identified as Lactobacillus phage Sha1 (region 2; GC content, 40.35%; region length, 39.2 kb) [29] and Oenococcus phage phi 9805 (region 5; GC content, 42.21%; region length, 51.7 kb) [30]. The questionable prophage regions corresponded to Streptococcus pyogenes phage 315.2 (region 1; GC content, 42.18%; region length, 15.4 kb) [29] and Listeria phage B025 (region 4; GC content, 42.96%; region length, 20.9 kb) [31]. The incomplete prophage region was identified as Lactobacillus phage Sha1 (region 3; GC content, 42.61; region length, 26.7 kb) [29]. The occurrence of prophage DNA within bacterial genomes is common; over 40 Lactobacillus prophages have been reported [32] and their presence highlights the genetic diversity and fitness of the Lactobacillus genome. In our case, the presence of prophages may confer selective advantage to the cell, promoting its survivability and its resistance to other infecting phages.

Table 4

Description of prophage regions detected in L. pentosus MP-10 genome by using the PHAST bioinformatic tool.

Region	Region length	Completeness*	Score	Region position	Most common phage	GC%	Total proteins
1	15.4 kb	Questionable	80	39530–54980	PHAGE_Strept_315.2_NC_004585(3)	42.18	24
2	39.2 kb	Intact	150	637535–676738	PHAGE_Lactob_Sha1_NC_019489(27)	40.35	49
3	26.7 kb	Incomplete	40	1405091–1431841	PHAGE_Lactob_Sha1_NC_019489(7)	42.61	25
4	20.9 kb	Questionable	80	1437486–1458462	PHAGE_Lister_B025_NC_009812(8)	42.96	21
5	51.7 kb	Intact	120	2437004–2488736	PHAGE_Oenoco_phi9805_NC_023559 (16)	42.21	57

*: Intact (score > 90), Questionable (score 70–90), Incomplete (score < 70).

S2 Table shows the proteins encoded by the five prophage regions predicted by PHAST tool in L. pentosus MP-10 genome. The complete prophages corresponded to regions 2 and 5 encoded 49 and 57 proteins, respectively (Table 4) and were homologous to Lactobacillus phage Sha1 isolated from traditional Korean fermented food “kimchi” [29] and Oenococcus phage phi 9805 from red wine [30]. Those data suggest that different species colonizing different ecosystems may share the same prophages and their architecture due to the interconnection between different habitats via lateral genetic exchange [33].

Each prophage region of L. pentosus MP-10 genome showed the presence of an integrase: one integrase in each complete prophage (region 2 and 5), two integrases in incomplete prophage (region 3), and a single integrase in the questionable prophage (region 1) (S2 Table); also phage attachment sites (attL and attR) (in regions 1, 2, 3 and 5) were found to be potentially involved in the integration of prophage regions in host chromosome. However, screening of the whole genome (outside prophage regions) of L. pentosus MP-10 for phage integrases as markers for mobile DNA elements, such as prophages, determined the presence of fifteen integrase core domain proteins not adjacent to the prophage-like region, thus we deduce that they were not involved in prophage mobility (data not shown). However, lysis genes (endolysin and holin) detected in prophage regions may be used by L. pentosus MP-10 in their own ecological niche or could be used in the food industry to eliminate undesirable bacteria during fermentation, particularly in cheese making to accelerate ripening. However, studies concerning the application of L. pentosus MP-10 in several fermentations should be studied in depth.

In silico analysis of safety properties of L. pentosus MP-10

To generate further insights into the food-safety aspects of L. pentosus MP-10, we surveyed the genes related with antibiotic resistance and virulence factors in their genome.

Antibiotic resistance

Firstly, a BLAST search was conducted for each annotated element of L. pentosus MP-10 genome sequence against the antibiotic resistance genes database (CARD). The search predicted the presence of several genes involved in antibiotic resistance although their identity to known resistance genes were low (< 90%), thus we could not suggest that the genes in L. pentosus MP-10 genome were homologous to the described genes (data not shown). To predict the complete resistome from L. pentosus MP-10 genome, including resistance genes and mutations conferring antibiotic resistance, we used the Resistance Gene Identifier (RGI) tool available in the recent updated CARD database [34], which used archive’s curated AMR (antimicrobial resistance) detection models. Here, we detected strict hits, which were defined as being within the similarity cut-offs of the individual AMR detection models and represented likely homologs of AMR genes according to Jia et al. [34]. The RGI revealed that L. pentosus MP-10 chromosome contained specific resistance genes for different antibiotics: aminocoumarin (alaS, an alanyl-tRNA synthetase gene, 1 hit), fluoroquinolone (mfd gene, 1 hit) and mupirocin (ileS or isoleucyl-tRNA synthetase gene, 2 hits), as well as genes coding for efflux pump proteins conferring resistance to multiple antibiotics (Fig 6, S3 Table). Among them, we found LmrB and LmrD multidrug efflux pumps that confer resistance to lincosamides in Bacillus subtilis, and Streptomyces lincolnensis and Lactococcus lactis, respectively [35-36]; the regulator of ArlR efflux-pump that binds to the norA promoter to activate its expression [37]; and the multidrug efflux pump EmeA from Enterococcus faecalis conferring resistance to several antimicrobial agents (S3 Table). Previous phenotypic analysis of antibiotic susceptibility of L. pentosus MP-10 [38] revealed that this strain showed resistance to cefuroxime, ciprofloxacin, teicoplanin, trimethoprim, trimethoprim/sulfamethoxazole and vancomycin. However, L. pentosus MP-10 was sensitive to clindamycin [38], thus lmrB and lmrD genes coding for multidrug efflux pumps were not involved in clindamycin resistance.

Fig 6

Screening of the whole genome of Lactobacillus pentosus MP-10 by using the perfect and strict algorithms in the Resistance Gene Identifier (RGI) with overall resistance in the center, resistance classes in the middle, and individual resistance genes on the outer (open reading frames).

On the other hand, a loose algorithm, which works outside of the detection model cut-offs to provide detection of new, emergent threats and more distant homologs of AMR genes [34], was also used; S4 Table shows the results. Considering the previous results of antibiotic resistance phenotypic screening [38], we can suggest that resistance to cefuroxime, ciprofloxacin, teicoplanin, trimethoprim, trimethoprim/sulfamethoxazole and vancomycin may be mediated by new genes responsible (not determined up to date) for the intrinsic resistance; however, further studies are required to confirm this hypothesis.

Regarding the possibility of acquired resistance by horizontal gene transfer, ResFinder did not detect any acquired antibiotic resistance genes for aminoglycoside, beta-lactam, colistin, fluoroquinolone, fosfomycin, fusidic acid, MLS-series (macrolide, lincosamide and streptogramin B), nitroimidazole, oxazolidinone, phenicol, rifampicin, sulphonamide, trimethoprim, tetracycline and glycopeptide (data not shown).

In summary, in silico analysis of antibiotic resistance in L. pentosus MP-10 showed the absence of acquired antibiotic resistance genes, and the resistome was mostly represented by efflux-pump resistance genes responsible of the intrinsic resistance exhibited by this strain.

Virulence

Regarding virulence, the BLAST searches against a virulence gene database (PHAST) revealed the presence of 14 coding genes for P1, P2a and P2b prophage proteins, an alanine racemase and a DNA-binding ferritin-like protein similar to L. plantarum WCFS1 (>90% identity; Table 5). As such, Lb. pentosus MP-10 chromosome contained mostly P2b prophage elements, which were located in the predicted questionable prophage region (Region 1, Fig 3A; PHAGE_Strept_315.2_NC_004585(3)], Table 4), and included: DNA packaging genes (encoding small and large terminase, portal protein), head-tail genes (head-to-tail joining), helicase and DNA replication gene (Table 5). These results were in accordance of those reported in S2 Table for Region 1. Furthermore, several proteins of unknown functions of P2b (proteins 10 and 21) prophage from Lb. plantarum WCFS1 were also detected (Table 5); however, van Hemert et al. [39] showed that prophage P2b protein 21 was involved in modulating peripheral blood mononuclear cell (PBMC) cytokine interleukin 10 (IL-10) and IL-12 production, which might be responsible for the stimulation of anti- or pro-inflammatory immune responses in the gut. Comparing P2b prophage region of Lb. pentosus MP-10 and Lb. plantarum WCFS1, we observed a strong synteny between prophage regionss from the two distinct species of Lactobacillus, despite the comparison being done with proteins with >90% identity (Table 5). In this case, nine homologous proteins were shared, although each species occupies a different ecological niches: human saliva and olives [16, 40], respectively. Similar results were reported by Zhang et al. [41] for other lactobacilli.

Table 5

Characterization of virulence determinants predicted in Lactobacillus pentosus MP-10 genome against the MvirDB database of virulence factors.

Gene ID	Identity (%)	Query length	Subject length	E-value	Protein Description	Organism	Accession
XX999_00145	92.08	101	101	1E-60	Prophage P2b protein 21	L. plantarum WCFS1	CCC79635.1
XX999_00131	92.48	266	266	0.0	Prophage P2b protein 7, DNA replication	L. plantarum WCFS1	CCC79647.1
XX999_00596	92.53	375	375	0.0	Alanine racemase	L. plantarum WCFS1	UniProtKB—O08
XX999_02401	92.68	127	126	9e-83	Prophage P2a protein 24, endodeoxyribonuclease	L. plantarum WCFS1	CCC79612.1
XX999_00135	93.65	63	63	2e-36	Prophage P2b protein 10	L. plantarum WCFS1	CCC79644.1
XX999_00137	93.80	129	129	2e-88	Prophage P2b protein 12, endonuclease	L. plantarum WCFS1	CCC79642.1
XX999_02409	95.05	101	101	7e-69	Prophage P2a protein 12	L. plantarum WCFS1	YP_004890137.1
XX999_02999	95.48	155	155	5e-108	DNA-binding ferritin-like protein, DPS family	L. plantarum WCFS1	CCC80168.1
XX999_01408	95.83	170	169	2e-117	Prophage P2a protein 16	L. plantarum WCFS1	CCC79619.1
XX999_02421	96.00	138	138	6e-87	Prophage P1 protein 7	L. plantarum WCFS1	CCC78108.1
XX999_00141	96.72	368	366	0.0	Prophage P2b protein 17, portal protein	L. plantarum WCFS1	CCC79639.1
XX999_00138	96.82	157	157	1e-111	Prophage P2b protein 14, terminase small subunit	L. plantarum WCFS1	CCC79641.1
XX999_00132	96.98	464	464	0.0	Prophage P2b protein 8, helicase	L. plantarum WCFS1	CCC79646.1
XX999_00139	97.53	567	567	0.0	Prophage P2b protein 15, terminase large subunit	L. plantarum WCFS1	CCC79640.1
XX999_00143	97.70	89	89	2e-56	Prophage P2b protein 19, head-to-tail joining	L. plantarum WCFS1	CCC79637.1
XX999_02397	99.34	152	153	3e-111	Prophage P1 protein 33, phage transcription regulator	L. plantarum WCFS1	CCC78134.1

Concluding notes

The new annotated genome sequence of L. pentosus MP-10 is currently considered the largest genome among lactobacilli; their additional genes may reflect the microorganism’s ecological flexibility and adaptability. In silico analysis of the genome identified a CRISPR (clustered regularly interspaced short palindromic repeats)/cas (CRISPR-associated protein genes) system involved in bacterial resistance against mobile elements, which consisted of six arrays (4–12 repeats) and eleven predicted cas genes (CRISPR1 and CRISPR2 consisted of three TypeII-C and eight TypeI-E genes) with high similarity to L. pentosus KCA1. Bioinformatic evidence of L. pentosus MP-10 did not reveal any acquired antibiotic resistance genes, and most inherent resistance genes were antibiotic efflux genes. No virulence factors were found. Thus, we can suggest that L. pentosus MP-10 could be considered safe for food processing, and high their adaptation potential could facilitate their application as a probiotic and starter culture in industrial processes.

Materials and methods

Genome sequence of L. pentosus MP-10

The complete genome sequence of L. pentosus MP-10 was obtained by using PacBio RS II technology [17] and deposited at the EMBL Nucleotide Sequence Database (accession numbers FLYG01000001 to FLYG01000006). The assembled genome sequences were annotated at Lifesequencing S.L. (Valencia, Spain) using the Prokka annotation pipeline, version 1.11 [42]. This involved predicting tRNA, rRNA, and mRNA genes and signal peptides in the sequences using Aragorn, RNAmmer, Prodigal, and SignalP, respectively, [43-45].

To evaluate the alignment and the synteny of genes between the L. pentosus MP-10, L. pentosus KCA1 and L. pentosus IG1 genome data sets, comparison was done by using Mauve algorithm in Lasergene's MegAlign Pro software (Lasergene 14).

Genomic analysis of mobile genetic elements and safety aspects of Lactobacillus pentosus MP-10

The annotated genome sequence of L. pentosus MP-10 was screened for the presence of CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) loci and the mobile genetic elements (i.e., conjugative plasmid, transposase, transposon, IS elements and prophage). Furthermore, we used the CRISPR finder tool (available in the CRISPRs web server; http://crispr.i2bc.paris-saclay.fr/Server/) to identify CRISPRs and extract the repeated and unique sequences in the L. pentosus MP-10 genome. The localization of CRISPR RNAs targets was done by using CRISPR Target program (http://bioanalysis.otago.ac.nz/CRISPRTarget/crispr_analysis.html). For prophage region search and annotation, we screened chromosomal DNA of L. pentosus MP-10 against a phage finding tool (PHAST, PHAge Search Tool) considered as an accurate or slightly more accurate than most available phage finding tools, with sensitivity of 85.4% and positive predictive value of 94.2% [46].

The predicted CDSs were annotated by using BLAST (Basic Local Alignment Search Tool) against the CARD (Comprehensive Antibiotic Resistance Database) and the MvirDB (a microbial database of protein toxins, virulence factors and antibiotic resistance genes for bio-defence applications) databases for antibiotic resistance and virulence factor screening (last version downloaded on January, 2017), respectively, with the associated GO (Gene Ontology) terms obtained by using Swiss-Prot database. Furthermore, the Resistance Gene Identifier (RGI) software (as part of CARD tools) was used for prediction of L. pentosus MP-10 resistome from protein or nucleotide data based on homology and SNP (Single Nucleotide Polymorphism) models, based on the CARD′s curated AMR (antimicrobial resistance) detection models. Moreover, the ResFinder (acquired antimicrobial Resistance gene Finder) software version 2.1 (https://cge.cbs.dtu.dk//services/ResFinder/) was used for screening of acquired antibiotic resistance genes [47] with selected %ID threshold of 90.00% and Selected minimum length of 60% (last accessed in January, 2017).

COG distributions in Lactobacillus pentosus MP-10.

(PDF)

Click here for additional data file.

Characterization of CRISPR associated proteins predicted in Lactobacillus pentosus MP-10 genome.

(DOC)

Click here for additional data file.

Characteristics of prophage regions in Lactobacillus pentosus MP-10 genome according to the PHAST bioinformatic toolkit.

(DOC)

Click here for additional data file.

RGI results of AMR genes detected in Lactobacillus pentosus MP-10 genome.

(DOC)

Click here for additional data file.

AMR detected in Lactobacillus pentosus MP-10 genome by using hits with weak “loose” similarity in RGI software.

(DOC)

Click here for additional data file.