Literature DB >> 28368401

circRNA_100290 plays a role in oral cancer by functioning as a sponge of the miR-29 family.

L Chen1, S Zhang1, J Wu2, J Cui3, L Zhong1, L Zeng1, S Ge1.   

Abstract

Circular RNAs (circRNAs) represent a class of non-coding RNAs that are widely expressed in mammals. However, it is largely unknown about the function of human circRNAs and the roles of circRNAs in human oral squamous cell carcinomas (OSCC). Here we performed a comprehensive study of circRNAs in human OSCC using circRNA and mRNA microarrays, and identified many circRNAs that are differentially expressed between OSCC tissue and paired non-cancerous matched tissue. We further found a circRNA termed circRNA_100290 that served as a critical regulator in OSCC development. We discovered that circRNA_100290 was upregulated and co-expressed with CDK6 in OSCC tissue. Knockdown of circRNA_100290 decreased expression of CDK6 and inhibited proliferation of OSCC cell lines in vitro and in vivo. Via luciferase reporter assays, circRNA_100290 was observed to directly bind to miR-29 family members. Further EGFP/RFP reporter assays showed that CDK6 was the direct target of miR-29b. Taken together, we conclude that circRNA_100290 may function as a competing endogenous RNA to regulate CDK6 expression through sponging up miR-29b family members. Taken together, it indicates that circRNAs may exert regulatory functions in OSCC and may be a potential target for OSCC therapy.

Entities:  

Mesh:

Substances:

Year:  2017        PMID: 28368401      PMCID: PMC5558096          DOI: 10.1038/onc.2017.89

Source DB:  PubMed          Journal:  Oncogene        ISSN: 0950-9232            Impact factor:   9.867


Introduction

As the most frequently occurring oral malignancy, oral squamous cell carcinoma (OSCC) ranks eighth in cancer incidence worldwide.[1, 2] Each year approximately 540 000 new cases are diagnosed with only a 50% 5-year survival rate, and mortality rates have not been lowered significantly despite improved surgical and medical management in recent years.[2, 3] Furthermore, in some geographical regions such as Eastern Europe, the mortality rates of OSCC have increased for at least two decades. Thus this cancer type has gradually become a socioeconomic problem and a major public health concern.[4] It is well known that the initiation and progression of OSCC is a complex pathological process. Although a variety of oncogenes, anti-oncogenes and growth factors have been shown to be involved,[5] studies increasingly suggest that other types of biological molecules such as non-coding RNAs are considered to have important roles in this process. Over the past decade, microRNAs (miRNAs) and long non-coding RNAs (lncRNAs) have been found to serve as important players in a variety of physiology and pathological processes.[6, 7, 8, 9] So far, several studies have reported that miRNAs function as regulators in OSCC.[10, 11, 12, 13, 14] Recently, a handful of studies revealed that lncRNAs may also play a role in OSCC.[15, 16, 17] Circular RNAs (circRNAs) are another class of non-coding RNAs that are widely expressed in mammals.[18] They have covalently linked ends of a single RNA molecular and appear highly stable comparing to their linear types.[19, 20] In the past two decades, they were thought to be functionless owing to errors in splicing.[21] To date, a plenty of circRNAs have been identified in different cell lines and species.[22] However, their biogenesis process and potential function are poorly understood. Studies have showed that the sequences of circRNAs display some conservation and their expression profiles are cell type- or developmental stage-specific, suggesting some of them have regulatory functions in biological processes.[22, 23] Pandolfi et al.,[24] presented a hypothesis called the competing endogenous RNA (ceRNA) mechanism, which proposed that transcripts such as mRNAs, pseudogenes and lncRNAs can serve as natural miRNA sponges by competitive binding to miRNA response elements (MREs) to suppress their expression and function. However, there are very few such circRNAs that contain multiple MREs to decoy a particular miRNA.[25] lncRNAs functioning as ceRNAs have been confirmed by several early studies,[26, 27, 28, 29] while only three circRNAs, ciRs-7 (also termed CDR1as), Sry and circHIPK3 have thus far been confirmed to function through a ceRNA mechanism.[22, 30, 31] However, the function of circRNAs in tumour initiation and progression is unclear. Moreover, there are currently no reports describing the role of circRNAs in OSCC. In this study, we analysed the expression profiles of circRNAs and mRNAs in OSCC tissue through microarrays. ceRNA networks and potential targeting relationships were constructed according to the microarray results and bioinformatics predictions. Expression levels of a significantly upregulated circRNA, circRNA_100290, and its predicted ceRNA, CDK6, were detected by quantitative polymerase chain reaction (qPCR) in OSCC tissue and several OSCC cell lines. Then, we examined the functions and mechanisms of circRNA_100290 using OSCC cell lines. We found that knockdown of circRNA_100290 could induce G1/S arrest, inhibit cell proliferation and reduce the expression of CDK6. In addition, we performed a luciferase assay and observed that circRNA_100290 could bind to miR-29 family members, including miR-29a, miR-29b and miR-29c. Furthermore, using miR-29b as a representative of this miRNA family, we found that CDK6 was the direct target of miR-29b via EGFP/RFP reporter assays. Taken together, we can conclude that circRNA_100290 may act as a ceRNA to regulate CDK6 expression by decoying the miR-29b family. Our findings indicate that circRNAs may exert regulatory functions in OSCC and can be used as potential targets in OSCC therapy.

Results

circRNA expression profiles in OSCC

Hierarchical clustering of all expressed circRNAs revealed circRNA expression profiling in OSCC and non-cancerous matched tissue (NCMT) samples (five OSCC and five NCMT samples). The scatter and volcano plots showed the variation of circRNA expression between OSCC and NCMT samples (Figures 1a and b). In total, 280 differentially expressed circRNAs with fold-changes of greater than 2.0 were identified. Of these, 139 circRNAs were upregulated and 141 were downregulated (Supplementary Data 1). The cluster heat map demonstrates the differentially expressed circRNAs over 2.5-fold change (Figure 1c). Thereinto, the top 10 upregulated circRNAs and top 10 downregulated circRNAs were listed in Figure 1d. The expression of circRNA_100290 in OSCC was upregulated by nearly sevenfold. To verify the microarray results, qPCR was performed. In accordance with the microarray results, results of qPCR showed that the expression of circRNA_100290 was upregulated 3.98-fold in OSCC tissue compared with NCMT (data not shown). According to human reference genome (GRCh37/hg19) obtained from UCSC genome database (http://genome.ucsc.edu/), we further assumed that the genomic length of the circRNA_100290 is 6955 bp and the spliced length is 473 bp. It is located at chr1: 101372407–101379362, and its associated gene symbol is SLC30A7.
Figure 1

circRNA expression profile in OSCC. (a) The scatter plot was used for assessing the variation in circRNA expression between OSCC and NCMT samples. The values of x and y axes in the scatter plot were the normalized signal values of the samples (log2 scaled). The green lines are fold-change lines. The circRNAs above the top green line and below the bottom green line indicated more than 2.0-fold change of circRNAs between the two compared samples. (b) The volcano plot was constructed using fold-change values and P-values. The vertical lines correspond to 2.0-fold up and down, respectively, and the horizontal line represents a P-value of 0.05. The red point in the plot represents the differentially expressed circRNAs with statistical significance. (c) The cluster heat map showed the differentially expressed circRNAs over 2.5-fold change. Red colour indicates high expression level, and green colour indicates low expression level. The blue arrow indicates circRNA_100290. (d) The top 10 upregulated circRNAs and top 10 downregulated circRNAs. The expression of circRNA_100290 in OSCC was upregulated by nearly sevenfold.

ceRNA analysis for circRNA_100290 according to microarray data

Supposing that circRNA_100290 plays a role in OSCC through the proposed ceRNA mechanism, we constructed a circRNA_100290-miRNA-target gene network using Cytoscape to visualize their interactions based on our circRNA microarray data and mRNA microarray data. In the network, the circRNA/miRNA interaction was predicted using Arraystar’s home-made miRNA target prediction software and the target genes of the putative miRNAs were identified using TargetScan, miRanda and RNA22. In the network, 46 miRNAs ranked relatively higher, and 11 of the most likely target genes of these miRNAs were collected (Figure 2). Of these, miR-29b-3p, miR-29c-3p and miR-29a-3p were the top three predicted miRNA targets of circRNA_100290. And CDK6, which is a member of the cyclin-dependent kinase family that plays a role on G1 phase progression and G1/S transition of the cell cycle,[32, 33] was one of the most likely predicted targets of the above three miRNAs. The predicted miRNAs binding to circRNA_100290 and predicted ceRNAs for circRNA_100290 are shown in Supplementary Data 2 and 3.
Figure 2

ceRNA analysis for circRNA_100290. Cytoscape was used to visualize circRNA_100290-miRNA-target gene interactions based on the circRNA microarray and mRNA microarray data. In the network, 46 miRNAs that ranked relatively higher and 11 most possible target genes of these miRNAs were collected. The octagon represents circRNA_100290, the circle represents miRNAs and the round rectangle represents target genes of miRNAs (including mRNAs, lncRNAs and other transcripts). The relationship between the nodes was connected with solid lines. The enlarged and red marked solid lines show circRNA_100290-miR-29 family–CDK6 interactions.

circRNA_100290 and CDK6 are upregulated in OSCC

To validate the results of ceRNA analysis, mRNA microarray assay was further performed (five OSCC and five NCMT samples). As expected, we found that the expression of CDK6 in OSCC tissue was over three times the level of that in NCMT (Figure 3a, Supplementary Data 4). Immunochemistry detection also showed that the number of CDK6-positive cells in OSCC was much higher than that of NCMT (Figures 3b and c). qPCR further confirmed the expression levels of circRNA_100290 and CDK6 and showed that they were upregulated in OSCC (Figure 3d). To ensure whether circRNA_100290 is co-expressed with CDK6, the expression levels of circRNA_100290 and CDK6 in 17 OSCC tissue samples were measured by qPCR. According to the CDK6 expression levels, we sorted the samples into a low CDK6 expression group (n=7) and a high CDK6 expression group (n=10; Figure 3e). Then, the expression level of circRNA_100290 was detected in the two subsets. As shown in Figure 3f, the level of circRNA_100290 in the high CDK6 group was significantly higher than that in the low CDK6 group. In addition, we found that the levels of circRNA_100290 and CDK6 in several OSCC cell lines such as SCC9, CAL27 and NH4 were much higher than that in oral keratinocytes (Figure 3g). All of these results suggest that circRNA_100290 and CDK6 may be interrelated and associated with the occurrence of OSCC.
Figure 3

circRNA_100290 and CDK6 are upregulated in OSCC. (a) The cluster heat map showed some of the differentially expressed mRNAs over twofold change between OSCC and NCMT samples. Red colour indicates high expression level, and blue colour indicates low expression level. The expression of CDK6 in OSCC tissue was over three times the level of that in NCMT. (b) Immunochemistry staining showed that the number of CDK6-positive cells in OSCC was much higher than that of NCMT. Scale bar, 200 μm. (c) The percentage of CDK6-positive cells in OSCC and NCMT. The presented values are the means±s.d. from five different visions under 400 times magnification, **P<0.01. (d) The expression levels of circRNA_100290 and CDK6 were analysed using qPCR. ΔCt values were used to measure gene expression, which was normalized according to GAPDH expression levels. The presented values are the means±s.d., *P<0.05. (e) Expression levels of CDK6 in 17 OSCC samples were detected by qPCR. According to the CDK6 expression levels, the samples were sorted into a low CDK6 expression group (n=7) and a high CDK6 expression group (n=10), *P<0.05. (f) Expression levels of circRNA_100290 in the ‘CDK6 high’ and ‘CDK6 low’ subsets, **P<0.01. (g) Expression levels of circRNA_100290 and CDK6 in several OSCC cell lines such as SCC9, CAL27 and NH4, **P<0.01. All the data were presented as means±s.d.

Knockdown of circRNA_100290 inhibits expression of CDK6

To analyse the role of circRNA_100290 in CDK6 regulation in OSCC, we used circRNA_100290-specific small interfering RNAs (siRNAs) to knock down the expression levels of circRNA_100290 and then detected the expression levels of CDK6 in several OSCC cell lines. Thus, an siRNA that targets the backsplice junction sequence of circRNA_100290 and an siRNA that only targets the sequence in the linear transcript of its homologous gene SLC30A7 were designed (Figure 4a). We found that siRNA targeting the backsplice junction knocked down only the circular transcript and did not affect the expression of linear species. Contrarily, siRNA targeting linear transcript knocked down only the SLC30A7 linear transcript but not the circular transcript (Figures 4b and c). Simultaneously, we detected the mRNA levels of CDK6, and found that knockdown of circRNA_100290 decreased the expression of CDK6 (Figure 4d). To prove whether circRNA_100290 functions as a ceRNA, we co-transfected inhibitors of the miR-29 family and siRNA against circRNA_100290 into CAL27 and HN4 cell lines, and observed that the repression was reversed (Figure 4d). We further detected the protein levels of CDK6 using immunofluorescence and western blot assays. The results of the immunofluorescence assay showed that the expression of CDK6 was significantly decreased by siRNA treatment, and it was also reversed through co-transfection with inhibitors of the miR-29 family and siRNA against circRNA_100290 (Figure 4e). Similar results were obtained using HN4 cell lines (Supplementary Figure 1). Except for CDK6, as a substrate of CDK6, the expression of phosphorylated retinoblastoma protein followed the same trend in HN4 cell lines (Figure 4f).
Figure 4

Knockdown of circRNA_100290 inhibits expression of CDK6. (a) Schematic model of the siRNAs. si-SLC30A7 targets the SLC30A7 linear transcript, si-circRNA_100290 targets the back-splice junction of circRNA_100290. (b) and (c) si-circRNA_100290 knocked down only the circular transcript and did not affect the expression of linear species. si-SLC30A7 knocked down only the SLC30A7 linear transcript but not the circular transcript. NC, negative control. (d) The expression levels of CDK6 were detected following knockdown of circRNA_100290 using si-circRNA_100290 or co-transfection with si-circRNA_100290 and the miR-29 inhibitor. (e) Immunofluorescence staining for CDK6 after transfection with si-circRNA_100290 or co-transfection with si-circRNA_100290 and the miR-29 inhibitor. Scale bar, 100 μm. (f) CDK6 protein expression levels were analysed by western blotting. GAPDH was used as a loading control. The presented values are the means±s.d. of three different preparations, **P<0.01.

Effects of circRNA_100290 on cell cycle and cell proliferation

CDK6 plays critical roles in the cell division cycle. It is helpful in driving the progression of cells into the DNA synthesis phase (S phase).[32] As knockdown of circRNA_100290 clearly inhibits expression of CDK6, we inferred that circRNA_100290 might be functional in cell cycle regulation and cell proliferation. Flow cytometry demonstrated that silencing of circRNA_100290 induced G1/S arrest in SCC9 cell lines (Figures 5a and b). As shown in Figure 5c, BrdU incorporation assay indicated that cell proliferation was significantly reduced in the circRNA_100290 knockdown group and miR-29 mimics group, while the effect was reversed when inhibitors of the miR-29 family and siRNA against circRNA_100290 were co-transfected. Cell proliferation was also assessed by 3-(4,5-dimethylthizol-2-yl)22,5-diphenyltetrazolium bromide (MTT) assay and bromodeoxyuridine (BrdU) labelling. Similar results were obtained in CAL27 cell lines when labelled with Ki67 (Supplementary Figure 2). MTT assay showed that knockdown of circRNA_100290 and transfection of miR-29 mimics led to a marked decrease in CAL27 cell numbers after 48-h cell culture (Figure 5d).
Figure 5

Effects of circRNA_100290 on cell cycle and cell proliferation. (a, b) Cell cycle was analysed using flow cytometry after transfection with siRNA of circRNA_100290, miR-29 mimics or co-transfection with siRNA and the miR-29 inhibitor. Knockdown of circRNA_100290 induced G1/S arrest. This is the representative result derived from three independent experiments, *P<0.05. (c) Fluorescence due to BrdU incorporation. Scale bar, 100 μm. (d) MTT assay was also performed to assess cell proliferation, *P<0.05 and **P<0.01. (e) In vivo models in nude mice. Tumour volume was monitored once a week for 3 weeks. The average values±s.d. of three separate experiments are plotted, **P<0.01.

To confirm these findings in in vivo models, HN4 cell lines were implanted subcutaneously into the pectoral region of nude mice (three mice for negative control group, three mice for si-circRNA_100290 group and three mice for si-circRNA_100290+miR-29 inhibitor group). The volumes of the tumours were monitored once a week and for 3 weeks. As expected, silencing of circRNA_100290 markedly decreased the growth of the tumours in vivo (Figure 5e). Taken together, these results suggest that circRNA_100290 may be capable of modulating the progression of OSCC.

circRNA_100290 serves as a sponge for the miR-29 family

According to the MREs analysis, circRNA_100290 was observed to act as sponge for 58 miRNAs with 62 potential binding sites (Supplementary Data 3). In total, 17 miRNAs that rank in the foremost place were listed in accordance with the positions of putative binding sites in the 3′-untranslated region (3′UTR) of circRNA_100290 sequence (Figure 6a, Supplementary Figure 3). Subsequently, luciferase reporter assays were used to determine whether these miRNAs can directly target the 3′UTR of circRNA_100290. The information of the vector used in the luciferase reporter assays was shown in Supplementary Figure 4a. We co-transfected each miRNA mimic and luciferase reporters into 293T cells, and then detected the luciferase intensity. Results showed that luciferase intensity was reduced by more than 40% when mimics of miR-29b, miR-29a, miR-29c and miR-299 were transfected (Figure 6b). As an example, the alignment of miR-29b and the 3′UTR of circRNA_100290 was constructed by bioinformatic analysis and is illustrated in Figure 6c. Co-transfection of luciferase reporters containing a 3′UTR sequence and miR-29b mimics into 293T cells reduced over 60% of the luciferase intensity (Figure 6d). To confirm the direct interaction between miR-29b and circRNA_100290, the MREs of miR-29b in the luciferase reporter were mutated (Supplementary Figures 4b and c). We found that co-transfection of miR-29b mimics and the mutated luciferase reporter had no significant effect on luciferase activity (Figure 6e). Additionally, we measured the relative expression levels of circRNA_100290 and miR-29b in CAL27 cell lines by ΔΔCt method. The results showed that the mean ΔCt value between circRNA_100290 and GAPDH is 9.711, and the mean ΔCt value between miR-29b and GAPDH is 8.883 (Figure 6f). Hence the ΔΔCt between circRNA_100290 and miR-29b is 0.828. According to the formula 2−ΔΔCt, we can calculate that the expression level of miR-29b is almost 1.775 times the level of circRNA_100290 in a same sample. In view of the fact that there are two binding sites for miR-29b in each circRNA_100290 molecular (Figures 6a and c and Supplementary Figure 4b and c), it suggests that the number of MREs in circRNA_100290 per cell is sufficient to sponge miR-29. Taken together, these evidences suggest that circRNA_100290 may serve as a sponge for the miR-29 family.
Figure 6

circRNA_100290 serves as a sponge for the miR-29 family. (a) A schematic model showing the putative binding sites for miRNAs and 3′UTR of circRNA_100290. (b) Luciferase reporter assay revealed that miR-29b, miR-29a, miR-29c and miR-299 were able to reduce the luciferase intensity more than 40%. (c) Binding sites of miR-29b in 3′UTR of circRNA_100290. (d, e) miR-29b or negative control oligonucleotide was co-transfected with pmiR-RB-Report vector with or without the 3′UTR sequence of circRNA_100290. The RLU of hRluc and hLuc+ were determined, and the hRluc values were normalized to the corresponding hLuc+ values, **P<0.01. (f) The relative expression levels of circRNA_100290 and miR-29b in CAL27 cell lines. ΔCt values were used to measure gene expression, which was normalized by GAPDH expression levels. The presented values are the means±SD.

CDK6 is directly targeted by miR-29b

To confirm whether CDK6 is also the direct binding target of miR-29 family members, miR-29b was selected as a representative and an enhanced green fluorescent protein (EGFP) reporter assay was applied to validate that the expression of CDK6 is reduced by miR-29b. The alignment of miR-29b and the 3′UTR of CDK6 was constructed (Figure 7a). Then the wild-type 3′UTR sequence and the mutant 3′UTR sequence of CDK6 were cloned downstream from the EGFP-coding sequence to construct a reporter plasmid and a mutant vector, respectively. We found that co-transfection of miR-29b mimics and the wide-type reporter plasmid into 293T cells strongly reduced the EGFP expression. However, co-transfection of miR-29b mimics and mutated vector into 293T cells did not affect the expression of EGFP (Figures 7b and c). These results indicated that CDK6 is able to directly bind to miR-29b. In summary, it strongly suggests that circRNA_100290 may serve as a ceRNA for CDK6 by harbouring miR-29 family members to modulate the level of CDK6 expression and function in OSCC.
Figure 7

CDK6 is directly targeted by miR-29b. (a) A sequence within the CDK6 mRNA that is complementary to miR-29b was identified using publicly available algorithms. (b) 293T cells were co-transfected with an EGFP reporter plasmid (containing 3′UTR of CDK6) or the mutant vector (containing mutant 3′UTR of CDK6) and the pDsRed-C1 plasmid, either alone or in combination with a miR-29b mimic. Forty-eight hours post-transfection, EGFP and RFP levels were measured using an F-4500 fluorescence spectrophotometer. Scale bar, 50 μm. (c) Histograms show normalized means±s.d. of fluorescence intensity from three independent experiments. The fluorescence value in the control group was set to 1, **P<0.01.

Discussion

A great number of studies have shown that the expression profiles of non-coding RNAs including miRNAs and lncRNAs are abnormal in many types of cancer, and many of them have focused on their epigenetic regulation in cancer development.[34, 35] Recent studies have reported that many miRNAs and some lncRNAs may serve as regulators in OSCC development.[10, 11, 12, 13, 14] However, whether circRNAs play a role in OSCC is unknown. This is the first report on the expression profile and regulatory function of circRNAs in OSCC. In this study, a number of aberrantly expressed circRNAs in OSCC compared with NCMT were identified. We found through loss-of-function and rescue assays that circRNA_100290 was capable of sustaining cell cycle and proliferation of OSCC cell lines. Further studies showed that circRNA_100290 exerts its regulatory functions through harbouring miR-29 family members to reduce the expression of CDK6, which is also directly targeted by the miR-29 family. It suggests that circRNA_100290 and CDK6 mRNA is a couple of ceRNAs that are linked by the miR-29 family. The ceRNA hypothesis was based on numerous evidences[36, 37, 38, 39, 40] and described how different types of coding and non-coding members of the transcriptome communicate with each other via miRNAs, competing for binding to miRNAs and then regulating the expression of each other to construct a complex post-transcriptional regulatory network.[24, 26, 29] A study reported that 7000 transcripts were predicted to act as ceRNAs in glioblastoma.[28] In earlier studies, the ceRNA interaction was found mainly in mRNAs.[26, 27] Further studies showed that many non-coding RNAs were thought to be highly effective ceRNAs, such as linc-MD1,[29] lincRNA-RoR,[41, 42] H19,[43] HOTAIR,[44, 45] CARL,[46] lncRNA-ATB[47] and lncRNA-BGL3.[48] circRNAs were first observed by Hsu and Coca-Prados in eucaryote cells using electron microscopy and subsequently were found in mitochondria of yeast.[49, 50] Over 20 years ago, circRNAs that constructed by exons of a few transcribed genes were discovered in human cells.[51] It is considered that circRNAs are produced by aberrant splicing, gene rearrangement or non-linear reverse splicing.[52] Owing to their sequence conservation, biological stability and tissue specificity compared with miRNAs and lncRNAs, circRNAs are thought to be promising biomarkers, therapy targets, and may exert potential functions in the regulation of gene expression.[22, 23, 52, 53] In fact, most circRNAs are not functional and only a few circRNAs have been confirmed as functional miRNA sponges.[22, 25, 30] A circRNA named ciRS-7, which contains more than 70 MREs, was first reported to function as a sponge of miR-7.[22] Another testis-specific circRNA called sex-determining region Y (Sry) was also reported to serve as a sponge for miR-138.[30] In a recent study, another circRNA termed circHIPK3, which is derived from exon 2 of the HIPK3 gene, was observed to act as a sponge for miR-124.[31] In this study, we found that circRNA_100290 functioned as a decoy of the miR-29 family to regulate CDK6 expression through the same mechanism. By MREs analysis, multiple miRNA-binding sites were predicted in circRNA_100290 sequence, indicating that circRNA_100290 might also function as an miRNA sponge. Six binding sites were predicted for circRNA_100290 and the miR-29 family. Unlike CDR1as that contains 70 binding sites for miR-7, circRNA_100290 only has two target sites for each miR-29 family member. Indeed, only a few of circRNAs or ceRNAs have multiple binding sites for a particular miRNA, most of them contain only one or two miRNA binding sites.[25, 54] miR-29 serving as a regulator in the progression of tumours has been reported in several models including cholangiocarcinoma,[55] nasopharyngeal carcinomas,[56] acute myeloid leukemia,[57] lung cancer,[58] oesophageal carcinoma and lymphoma.[59, 60] Cell-cycle inhibition has been found to be a possible mechanism for miR-29 in some studies.[59, 60] As a crucial regulator in G1 phase, CDK6 is pivotal in cell cycle progression. Studies have reported that cyclinCDK6 complexes are capable of driving transition from G1 phase to S phase in cell cycle by retinoblastoma tumour suppressor (Rb) phosphorylation, while CDK6 inhibition blocks cell cycle and suppresses tumour growth.[32, 61] In our study, we found that miR-29 could target both circRNA_100290 and CDK6, suggesting that circRNA_100290 may function as an miR-29 sponge to modulate OSCC cell cycle and proliferation via regulating CDK6 expression. There are several lines of evidence implicating that circRNA_100290 functions as a ceRNA to CDK6 in oral cancer by functioning as a sponge of miR-29 family members. First, bioinformatic analyses showed that the 3′UTR of both circRNA_100290 and CDK6 mRNA contain binding sites for miR-29 family members. Second, luciferase and EGFP/RFP reporter assays verified this prediction. Third, the number of MREs in circRNA_100290 per cell is sufficient to sponge miR-29. Fourth, circRNA_100290 was co-expressed with CDK6 in OSCC tissue with different levels of CDK6. Fifth, CDK6 was co-expressed with circRNA_100290 in OSCC cell lines such that knockdown of circRNA_100290 reduced expression of CDK6. Finally, inhibition of miR-29 reversed the effect of circRNA_100290 knockdown. All of the above results suggest that circRNA_100290 and CDK6 may be a couple of ceRNAs that harbour miR-29 family competitively. Taken together, the accumulating evidence indicates that circRNAs may also functional in OSCC progression and exert regulatory functions by sponging up miRNAs. However, due to the difficulty of designing siRNA at the back-splice junction of circRNA, in this study, only one siRNA can specifically target the circular form of SLC30A7 but do not affect its linear form, thus off-target effects have to be considered. Therefore, more effective, accurate and specific methods of RNA interference remain to be exploited. Additionally, further specific studies are needed to decipher whether circRNA_100290 plays a role in some other pathological process in OSCC progression such as tumour invasion and metastasis. Revealing the role of circRNAs will be critical for understanding OSCC pathogenesis and offering a novel insight into the identification of new biomarkers or new potential therapeutic targets of OSCC.

Materials and methods

Tissue specimens

Tissue samples of OSCC and paired NCMT were obtained from patients who received surgical treatment at the Second Xiangya Hospital (Changsha, China). All of the patients enrolled in this study had not undergone previous surgery, radiotherapy and chemotherapy. All tissues were processed to be examined histologically. Tumour formation experiment in nude mice (BALB/C-nu/nu, female and 5-week-old) was accomplished at experimental animal centre of Central South University. The study was approved by the institutional review board of the Second Xiangya Hospital of Central South University for scientific and ethical integrity.

Cell culture

The human OSCC cell lines SCC9 and CAL27 were obtained from the Cancer Research Institute of Central South University (Changsha, China). Another OSCC cell line HN4 was donated by Dr Zhenhu Ren of Shanghai Ninth People’s Hospital (Shanghai, China). The source of the three cell lines were derived from tongue cancer and have been authenticated in oral cancer research. Human oral keratinocytes were obtained from patients attending the oral medicine outpatient clinic of the Second Xiangya Hospital (Changsha, China). DMEM/F12 medium supplemented with 0.4 μg/ml hydrocortisone was used to incubate the OSCC cell lines and α-MEM medium was used to culture the oral keratinocytes.

Microarray analysis

After being obtained from surgical specimens, samples (five OSCC and five NCMT) were immediately frozen using liquid nitrogen. Sample preparation and microarray hybridization were performed according to the protocols of Arraystar (Rockville, MD, USA). circRNAs were enriched through removing linear RNAs with Rnase R (Epicentre, Madison, WI, USA), and then amplified and labelled using Arraystar Super RNA Labeling Kit (Arraystar). mRNAs were purified using rRNA removal kit (Arraystar). Subsequently, Arraystar Human circRNA Array (8 × 15 K) and LncPath Human Cancer Array were used for hybridization, and then scanned by the Agilent Scanner G2505C (Jamul, CA, USA). circRNAs and mRNAs demonstrating fold-changes of ⩾2 and P-values of <0.05 were regarded as significantly differentially expressed.

ceRNA analysis and target prediction

We constructed a has_circRNA_100290-miRNA-target gene network using Cytoscape to visualize their interactions based on our circRNA microarray data and mRNA microarray data. In the network, we predicted the circRNA/miRNA interaction with miRNA target prediction software (Arraystar’s home-made) established from TargetScan and miRanda. The triple network was based on the theory of ceRNA that the circRNA shared the same miRNA with mRNA or other non-coding RNAs in one triplet.

Quantitative real-time RT–PCR

Quantification of circRNA and mRNA was performed using an ABI PRISM7500 system, and miRNA concentrations were determined using an ABI PRISM7900 system (Applied Biosystems, Carlsbad, CA, USA). Before calculation using the ΔΔCt method, the levels of GAPDH were used to normalize the relative expression levels of circRNA and mRNA, and the levels of small nuclear U6 were used to normalize the miRNA expression levels. Primers used for quantitative real-time PCR were listed as follows: hsa_circRNA_100290, 5′GTCATTCCCTCTTTAATGGTG3′ (forward) and 5′CAGAACTTCCGCTCTAACATAC3′ (reverse); CDK6, 5′TGCACAGTGTCACGAACAGA3′ (forward) and 5′ACCTCGGAGAAGCTGAAACA3′ (reverse); SLC30A7, 5′TTGCCATAGCCATGAAGTGA3′ (forward) and 5′GTCTGCTGGGTCCTGTTGTT3′ (reverse); and GAPDH, 5′GGAAAGCTGTGGC GTGAT3′ (forward) and 5′AAGGTGGAAGAATGGGAGTT3′ (reverse); has-miR-29a, 5′ACAGGATATCGCATTGTTGG3′ (forward) and 5′TATACCACATGCAATTCAG3′ (reverse); has-miR-29b, 5′CCCAGGCATGCTCTCCCATC3′ (forward) and 5′CATTTGTGATATATGCCACC-3′ (reverse); has-miR-29c, 5′GTGCCGAAAGGAAGAC3′ and 5′TCTTTAGGGGTGTGCGTAGG3′ and U6, 5′GCTTCGGCAGCACATATACTAAAAT3′ (forward) and 5′CGCTTCACGAATTTGCGTGTCAT3′ (reverse).

Immunohistochemistry and immunofluorescence analysis

Detection of CDK6 was performed on 5-μm thick paraffin sections with the indicated antibodies. Briefly, the sections were incubated with primary antibodies (sc-7961, dilution 1:200, Santa Cruz Biotechnology, Santa Cruz, CA, USA) overnight at 4 °C, followed by incubation with an secondary antibody (dilution 1:100, Beyotime, Shanghai, China) at 37 °C for 30 min. After that, the sections were stained with chromogen (DAB, ZLI-9018, Zhong Shan Jin Qiao, Beijing, China) for 5 min. For immunofluorescence staining, briefly, cells were incubated with anti-CDK6 (dilution 1:200, Santa Cruz Biotechnology) at 4 °C overnight after fixation with 4% paraformaldehyde. Subsequently, they were incubated with secondary antibody (1:100 dilution) for 1 h. 4′,6-diamidino-2-phenylindole (DAPI) was used to counterstain nuclei. Finally, the cells were incubated for 5 min with chromogen and examined using an inverted microscope.

Western blot analysis

Total proteins were extracted using lysis buffer, separated on 12% SDS-PAGE gels and blotted on cellulose membranes. Following hybridization with a monoclonal antibody at 4 °C overnight, the membranes were immunoblotted with a secondary antibody at room temperature for 1 h. Finally, enhanced chemiluminescence (ECL kit, Santa Cruz Biotechnology) was used for visualization and Quantity One system (Bio-Rad, Hercules, CA, USA) was applied for analysis. Primary antibodies used in this study were as follows: anti-CDK6 (dilution 1:200, Santa Cruz Biotechnology), anti-phosphorylated retinoblastoma protein (Ser 780) (dilution 1:100, Santa Cruz Biotechnology) and anti-GAPDH (dilution 1:1000, Santa Cruz Biotechnology).

RNA interference and transfection assay

Small interfering RNAs (siRNAs) targeting the back-splice junction of circRNA_100290 (si-circRNA_100290) and siRNAs targeting the SLC30A7 linear transcript only (si-SLC30A7) were designed and synthesized by RiboBio (Guangzhou, China; Supplementary Tables 1 and 2). For si-circRNA_100290, the sequence of the sense strand of the functional siRNA was 5′CUCAUGCUUAGGCUUGAUU dTdT3′ and the sequence of antisense strand was 3′dTdT GAGUACGAAUCCGAACUAA5′. For si-SLC30A7, the sequence of the functional siRNA was GGTCTATACTGTCCGACAA. According to the manufacturer’s protocol, cells were transfected using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA).

Cell cycle analysis

Twenty-four hours after transfection, cells were collected by centrifugation (1200 rpm, 5 min). A haemocytometer was used to count the cell number and the final cell density was adjusted to 1 × 106 per milliliter. Then, 70% ethanol was used to fix those cells and RNase A was used to remove RNAs. Finally, propidium iodide (20 mg/ml) was used to stain DNA and its content was determined using flow cytometry (Beckman FC500, Los Angeles, CA, USA).

MTT assay and BrdU incorporation assay

At indicated time point post-transfection, cells were collected by centrifugation after incubation with 5.0 mg/ml MTT. After that, 200 μl of dimethyl sulfoxide was added into the sediments, and then the absorbance was measured by spectrophotometry at 490 nm. For BrdU incorporation assay, 30 μg/ml BrdU was used to treat cells and BrdU Cell Proliferation ELISA Kit (Abcam, Cambridge, MA, USA) was used to measure BrdU incorporation. DAPI was used to counterstain nuclei.

Luciferase and EGFP/RFP reporter assay

Luciferase reporter assay was used to detect the direct binding between circRNA-100290 and miRNAs. pmiR-RB-Report vector (Saierbio, Tianjin, China) containing renilla luciferase gene (hRluc) and firefly luciferase gene (hLuc+) was applied in this experiment. The 3′ UTR sequence of circRNA_100290 was cloned downstream of hRluc cassette. Mutations were performed in the binding sites. The miRNA mimics were obtained from GenePharma (Shanghai, China). hLuc+ cassette was used as internal control. Each miRNA or negative control oligonucleotide was co-transfected with pmiR-RB-Report vector with or without the 3′UTR sequence of circRNA_100290. Finally, the relative light units (RLU) of hRluc and hLuc+ were determined by Veritas 9100-002 (Turner BioSystems, Sunnyvale, CA, USA), and the hRluc values were normalized to the corresponding hLuc+ values. An EGFP/RFP reporter assay was used to confirm that CDK6 is a direct target of the miR-29 family. miR-29b mimics or negative control oligonucleotide was co-transfected with pcDNA3 reporter vector containing the wild-type 3′UTR of CDK6 or a mutant version of the 3′UTR of CDK6. The expression levels of EGFP were normalized by the RFP values. The expression values of EGFP and RFP were determined by an F-4500 fluorescence spectrophotometer (Hitachi, Tokyo, Japan).

Statistical analysis

The means±standard deviation (SD) was used to show quantitative data. One-way analysis of variance was applied to compare difference between two groups. A value of P<0.05 indicated that the difference was statistically significant. Fold-changes of ⩾2 and P-values of <0.05 in microarray data were regarded as significantly differentially expressed.
  60 in total

1.  A long noncoding RNA activated by TGF-β promotes the invasion-metastasis cascade in hepatocellular carcinoma.

Authors:  Ji-hang Yuan; Fu Yang; Fang Wang; Jin-zhao Ma; Ying-jun Guo; Qi-fei Tao; Feng Liu; Wei Pan; Tian-tian Wang; Chuan-chuan Zhou; Shao-bing Wang; Yu-zhao Wang; Yuan Yang; Ning Yang; Wei-ping Zhou; Guang-shun Yang; Shu-han Sun
Journal:  Cancer Cell       Date:  2014-04-24       Impact factor: 31.743

2.  Circular RNA is enriched and stable in exosomes: a promising biomarker for cancer diagnosis.

Authors:  Yan Li; Qiupeng Zheng; Chunyang Bao; Shuyi Li; Weijie Guo; Jiang Zhao; Di Chen; Jianren Gu; Xianghuo He; Shenglin Huang
Journal:  Cell Res       Date:  2015-07-03       Impact factor: 25.617

3.  Endogenous miRNA sponge lincRNA-RoR regulates Oct4, Nanog, and Sox2 in human embryonic stem cell self-renewal.

Authors:  Yue Wang; Zhenyu Xu; Junfeng Jiang; Chen Xu; Jiuhong Kang; Lei Xiao; Minjuan Wu; Jun Xiong; Xiaocan Guo; Houqi Liu
Journal:  Dev Cell       Date:  2013-03-28       Impact factor: 12.270

4.  Salivary lncRNA as a potential marker for oral squamous cell carcinoma diagnosis.

Authors:  Haikuo Tang; Zhiyuan Wu; Jianping Zhang; Bing Su
Journal:  Mol Med Rep       Date:  2012-12-28       Impact factor: 2.952

5.  Detecting and characterizing circular RNAs.

Authors:  William R Jeck; Norman E Sharpless
Journal:  Nat Biotechnol       Date:  2014-05       Impact factor: 54.908

Review 6.  The multilayered complexity of ceRNA crosstalk and competition.

Authors:  Yvonne Tay; John Rinn; Pier Paolo Pandolfi
Journal:  Nature       Date:  2014-01-16       Impact factor: 49.962

Review 7.  MicroRNAs--micro in size but macro in function.

Authors:  Sunit K Singh; Manika Pal Bhadra; Hermann J Girschick; Utpal Bhadra
Journal:  FEBS J       Date:  2008-08-27       Impact factor: 5.542

8.  A mammalian microRNA expression atlas based on small RNA library sequencing.

Authors:  Pablo Landgraf; Mirabela Rusu; Robert Sheridan; Alain Sewer; Nicola Iovino; Alexei Aravin; Sébastien Pfeffer; Amanda Rice; Alice O Kamphorst; Markus Landthaler; Carolina Lin; Nicholas D Socci; Leandro Hermida; Valerio Fulci; Sabina Chiaretti; Robin Foà; Julia Schliwka; Uta Fuchs; Astrid Novosel; Roman-Ulrich Müller; Bernhard Schermer; Ute Bissels; Jason Inman; Quang Phan; Minchen Chien; David B Weir; Ruchi Choksi; Gabriella De Vita; Daniela Frezzetti; Hans-Ingo Trompeter; Veit Hornung; Grace Teng; Gunther Hartmann; Miklos Palkovits; Roberto Di Lauro; Peter Wernet; Giuseppe Macino; Charles E Rogler; James W Nagle; Jingyue Ju; F Nina Papavasiliou; Thomas Benzing; Peter Lichter; Wayne Tam; Michael J Brownstein; Andreas Bosio; Arndt Borkhardt; James J Russo; Chris Sander; Mihaela Zavolan; Thomas Tuschl
Journal:  Cell       Date:  2007-06-29       Impact factor: 41.582

9.  Long non-coding RNA HOTAIR, a c-Myc activated driver of malignancy, negatively regulates miRNA-130a in gallbladder cancer.

Authors:  Ming-Zhe Ma; Chun-Xiao Li; Yan Zhang; Ming-Zhe Weng; Ming-di Zhang; Yi-Yu Qin; Wei Gong; Zhi-Wei Quan
Journal:  Mol Cancer       Date:  2014-06-23       Impact factor: 27.401

10.  LincRNA-ROR induces epithelial-to-mesenchymal transition and contributes to breast cancer tumorigenesis and metastasis.

Authors:  P Hou; Y Zhao; Z Li; R Yao; M Ma; Y Gao; L Zhao; Y Zhang; B Huang; J Lu
Journal:  Cell Death Dis       Date:  2014-06-12       Impact factor: 8.469

View more
  157 in total

1.  Hsa_circ_0033155: A potential novel biomarker for non-small cell lung cancer.

Authors:  Xiaohua Gu; Gang Wang; Hui Shen; Xiaoyun Fei
Journal:  Exp Ther Med       Date:  2018-08-02       Impact factor: 2.447

Review 2.  Circular RNAs function as ceRNAs to regulate and control human cancer progression.

Authors:  Yaxian Zhong; Yajun Du; Xue Yang; Yongzhen Mo; Chunmei Fan; Fang Xiong; Daixi Ren; Xin Ye; Chunwei Li; Yumin Wang; Fang Wei; Can Guo; Xu Wu; Xiaoling Li; Yong Li; Guiyuan Li; Zhaoyang Zeng; Wei Xiong
Journal:  Mol Cancer       Date:  2018-04-07       Impact factor: 27.401

3.  Construction of ceRNA network and identification of two differentially expressed circRNAs in hepatocellular carcinoma by bioinformatic analysis.

Authors:  Hongwei He; Zhong Shen; Qiyun Gu; Rong Xie
Journal:  Int J Clin Exp Pathol       Date:  2020-11-01

4.  Analysis of the complex interaction of CDR1as-miRNA-protein and detection of its novel role in melanoma.

Authors:  Lihuan Zhang; Yuan Li; Wenyan Liu; Huifeng Li; Zhiwei Zhu
Journal:  Oncol Lett       Date:  2018-05-11       Impact factor: 2.967

5.  Hsa_circ_0103809 promotes cell proliferation and inhibits apoptosis in hepatocellular carcinoma by targeting miR-490-5p/SOX2 signaling pathway.

Authors:  Huajie Cai; Bingren Hu; Ling Ji; Xiaojiao Ruan; Zhihai Zheng
Journal:  Am J Transl Res       Date:  2018-06-15       Impact factor: 4.060

6.  circRNA_0025202 Regulates Tamoxifen Sensitivity and Tumor Progression via Regulating the miR-182-5p/FOXO3a Axis in Breast Cancer.

Authors:  Yuting Sang; Bing Chen; Xiaojin Song; Yaming Li; Yiran Liang; Dianwen Han; Ning Zhang; Hanwen Zhang; Ying Liu; Tong Chen; Chen Li; Lijuan Wang; Wenjing Zhao; Qifeng Yang
Journal:  Mol Ther       Date:  2019-05-17       Impact factor: 11.454

Review 7.  Circular RNAs in digestive system cancer: potential biomarkers and therapeutic targets.

Authors:  Jia-Qi Sheng; Lian Liu; Mu-Ru Wang; Pei-Yuan Li
Journal:  Am J Cancer Res       Date:  2018-07-01       Impact factor: 6.166

8.  Role of Circular RNA DLEU2 in Human Acute Myeloid Leukemia.

Authors:  Dong-Mei Wu; Xin Wen; Xin-Rui Han; Shan Wang; Yong-Jian Wang; Min Shen; Shao-Hua Fan; Zi-Feng Zhang; Qun Shan; Meng-Qiu Li; Bin Hu; Gui-Quan Chen; Jun Lu; Yuan-Lin Zheng
Journal:  Mol Cell Biol       Date:  2018-09-28       Impact factor: 4.272

Review 9.  CircRNA accumulation: A new hallmark of aging?

Authors:  David Knupp; Pedro Miura
Journal:  Mech Ageing Dev       Date:  2018-05-16       Impact factor: 5.432

Review 10.  Non-coding RNAs: the new central dogma of cancer biology.

Authors:  Phei Er Saw; Xiaoding Xu; Jianing Chen; Er-Wei Song
Journal:  Sci China Life Sci       Date:  2020-09-11       Impact factor: 6.038

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.