T Yu1, T-D Shan1, J-Y Li1, C-Z Huang1, S-Y Wang1, H Ouyang1, X-J Lu1, J-H Xu1, W Zhong1, Q-K Chen1. 1. Department of Gastroenterology and Guangdong Provincial Key Laboratory of Malignant Tumor Epigenetics and Gene Regulation, Sun Yat-Sen Memorial Hospital, Sun Yat-Sen University, Guangzhou, Guangdong, China.
Abstract
Long intergenic noncoding RNAs (lincRNAs) have important roles in biological functions, molecular mechanisms and prognostic values in colorectal cancer (CRC). In this context, the roles of linc-UFC1 remain to be elucidated. In this study, linc-UFC1 was overexpressed in CRC patient tissues and positively correlated with tumor grade, N stage and M stage. Inhibition of linc-UFC1 resulted in cell proliferation inhibition and G1 cell cycle arrest, which was mediated by cyclin D1, CDK4, Rb and phosphorylated Rb. In addition, inhibition of linc-UFC1 induced cell apoptosis through the intrinsic apoptosis signaling pathway, as evidenced by the activation of caspase-9 and caspase-3. An investigation of the signaling pathway revealed that the effects on proliferation and apoptosis following linc-UFC1 knockdown were mediated by suppression of β-catenin and activation of phosphorylated P38. Furthermore, the P38 inhibitor SB203580 could attenuate the apoptotic effect achieved by linc-UFC1 knockdown, confirming the involvement of P38 signaling in the induced apoptosis. Taken together, linc-UFC1 might have a critical role in pro-proliferation and anti-apoptosis in CRC by regulating the cell cycle, intrinsic apoptosis, and β-catenin and P38 signaling. Thus, linc-UFC1 could be a potential therapeutic target and novel molecular biomarker for CRC.
Long intergenic noncoding RNAs (lincRNAs) have important roles in biological functions, molecular mechanisms and prognostic values in colorectal cancer (CRC). In this context, the roles of linc-UFC1 remain to be elucidated. In this study, linc-UFC1 was overexpressed in CRC patient tissues and positively correlated with tumor grade, N stage and M stage. Inhibition of linc-UFC1 resulted in cell proliferation inhibition and G1 cell cycle arrest, which was mediated by cyclin D1, CDK4, Rb and phosphorylated Rb. In addition, inhibition of linc-UFC1 induced cell apoptosis through the intrinsic apoptosis signaling pathway, as evidenced by the activation of caspase-9 and caspase-3. An investigation of the signaling pathway revealed that the effects on proliferation and apoptosis following linc-UFC1 knockdown were mediated by suppression of β-catenin and activation of phosphorylated P38. Furthermore, the P38 inhibitor SB203580 could attenuate the apoptotic effect achieved by linc-UFC1 knockdown, confirming the involvement of P38 signaling in the induced apoptosis. Taken together, linc-UFC1 might have a critical role in pro-proliferation and anti-apoptosis in CRC by regulating the cell cycle, intrinsic apoptosis, and β-catenin and P38 signaling. Thus, linc-UFC1 could be a potential therapeutic target and novel molecular biomarker for CRC.
Colorectal cancer (CRC) is the fourth leading cause of cancer-related death in the world and the third most frequent cause of cancer-related death in western societies.[1, 2] As evidenced by studies on genetic modifications, environmental impacts, diet and lifestyles, the underlying mechanisms of CRC have been intensively studied. Although efforts have been exerted to prevent CRC, the incidence of CRC has continued increasing for decades.[3] An early diagnosis and a more accurate preoperative evaluation of postoperative survival would greatly improve the prognosis of CRC.In recent years, growing evidence has suggested that epigenetic alterations have a significant role in carcinogenesis and the progression of malignancies.[4, 5] Long noncoding RNAs (lncRNAs), a subgroup of noncoding RNAs, are nonprotein-coding transcripts with a length >200 nucleotides.[6, 7] Based on their structural or functional characteristics, lncRNAs can be classified further into several subgroups, including natural antisense, transcripts, circular RNAs, pseudogenes and long intergenic noncoding RNAs (lincRNAs).[8] LincRNAs are transcribed from DNA loci positioned between protein-coding genes.[9] LincRNAs are transcribed abundantly in mammalian cells and generally show developmental stage-, tissue- or disease-specific expression patterns.[10, 11, 12] These findings underscore the need for a further search for lincRNAs that are aberrantly expressed during colorectal carcinogenesis and the need for an intensive investigation of their role in tumor biology.Recently, numerous efforts have been applied to systematically identify cancer lincRNAs and explore their functions in tumorigenesis. The accumulation of genetic and epigenetic alterations mediates CRC formation and progression by deregulating key signaling pathways in cancer cells. For example, WNT signaling, which is overexpressed in a number of cancers including CRC, has a key role in tumor pathogenesis and growth.[13] Moreover, mitogen-activated protein kinase (MAPK) signal transduction pathways are evolutionarily conserved among eukaryotes and have been implicated as having key roles in a number of biological processes, including cell growth, differentiation, apoptosis, inflammation and responses to environmental stresses.[14, 15]In this report, we identified a novel lincRNA, termed linc-UFC1, and we showed that altered linc-UFC1 expression could interact with the mRNA-stabilizing protein HuR to increase levels of β-catenin in hepatocellular carcinoma (HCC) cells.[16] Despite the above findings, linc-UFC1 expression has not been investigated in CRC. In this study, we investigated linc-UFC1 expression in CRC tissues and cancer cell lines. Next, the associations of linc-UFC1 expression with the β-catenin and P38 signaling pathway were assessed. Taken together, we determined that linc-UFC1 might have a critical role in promoting the tumorigenesis and progression of CRC through the regulation of proliferation and apoptosis.
Results
Linc-UFC1 expression was upregulated in human CRC tissues
The expression level of linc-UFC1 was assessed in 65 paired CRC samples and histologically normal adjacent tissues by real-time quantitative polymerase chain reaction (QPCR), which was normalized to GAPDH. When compared with their normal counterparts, linc-UFC1 expression levels were upregulated in cancerous tissues (fold change of ≥1.5) in 42 cases (64.6%), whereas its expression levels were downregulated or without significant difference in 23 cases (35.4% Figure 1a). The expression of linc-UFC1 was significantly elevated in the CRC tissues compared with the adjacent non-tumor tissues (P<0.01; Figure 1b). Examination of the correlations between linc-UFC1 expression and clinical pathological features showed that the upregulation of linc-UFC1 was correlated with the tumor histology grade, N grade and M grade (Table 1). However, linc-UFC1 expression was not correlated with patients' gender, age, tumor size or T grade (Table 1). These results implied that linc-UFC1 overexpression might be useful in the development of novel markers for CRC prognosis or progression.
Figure 1
Abnormal linc-UFC1 expression in CRC. (a) QPCR analysis of linc-UFC1 expression level in 65 cases of CRC and adjacent non-tumor tissues. Fold change of ≥1.5 was defined as overexpression (linc-UFC1 high), and the remaining samples were denoted as linc-UFC1 low. (b) Expression of linc-UFC1 in 65 cases of CRC tissues. The expression of linc-UFC1 was significantly elevated in the CRC tissues compared with the adjacent non-tumor tissues. Statistical difference was analyzed using the Wilcoxon signed-rank test (*P<0.01)
Table 1
Association between patients, characteristics and linc-UFC1 expression in 65 CRC cases
Characteristics
Patientsfrequency (%)
Linc-UFC1
Chi-square
P-value
Low
High
Total
65
23 (35.4%)
42 (64.6%)
Gender
Male
31
14
17
0.320
0.571
Female
34
13
21
Age (years)
<55
26
11
15
0.010
0.919
≥55
39
17
22
Tumor size (cm)
<5
30
12
18
0.215
0.643
≥5
35
16
19
Histology grade
Well and moderate
48
14
34
8.975
0.003
Poor
17
12
5
pT grade
Ta, Tis, T1
11
4
7
0.025
0.875
T2–T4
54
21
33
pN grade
N0
21
10
11
6.125
0.013
N1, N2
44
8
36
pM grade
M0
29
18
11
9.088
0.003
M1
36
9
27
Abbreviations: Poor: poorly differentiated; Well and moderate, well and moderately differentiated. Significant associations are shown in bold face in the p-value column (p-value <0.05)
Knockdown of linc-UFC1 levels in CRC cells
We next performed QPCR analysis to examine the expression levels of linc-UFC1 in various CRC cell lines (HCT-116, SW480, LOVO, DLD-1 and RKO) and the HEK293T cell line (a human non-CRC cell line). LOVO and SW480 cells showed higher expression levels of linc-UFC1 (n=6; P<0.05; Figure 2a); hence, we used LOVO and SW480 cells as a model to investigate the effects of linc-UFC1 on cell proliferation and apoptosis. We knocked down linc-UFC1 in LOVO and SW480cancer cells by transfecting the cells with short hairpin RNAs (shRNAs), sh-linc-UFC1. The knockdown efficiencies in LOVO cells by sh#1 and sh#2 were 79.6%±5.4% and 70.3%±7.2%, respectively (n=6, P<0.05; Figure 2b). In SW480 cells, the knockdown efficiencies by sh#1 and sh#2 were 72.8%±9.3% and 66.7%±8.9%, respectively (n=6, P<0.05; Figure 2b).
Figure 2
Knockdown of linc-UFC1 levels in CRC cells. (a) QPCR analysis to examine the expression levels of linc-UFC1 in various CRC cell lines (HCT-116, SW480, LOVO, DLD-1 and RKO) and the HEK293T cell line (mean±S.D., n=6; *P<0.05 versus 293T). (b) The knockdown efficiencies in LOVO cells and SW480 cells by transfected sh-linc-UFC1 (sh#1 and #2; mean±S.D., n=6; *P<0.05 versus NC)
Linc-UFC1 knockdown inhibited proliferation of CRC cells via cell cycle arrest
As shown in Figure 3a, shRNA-mediated knockdown of linc-UFC1 impaired proliferation in LOVO and SW480 cells, as revealed by CellTiter 96 AQueous One Solution Cell Proliferation assay. The number of live cells was significantly decreased after transfection with sh-linc-UFC1 compared with the negative controls (n=6, P<0.05; Figure 3a). Consistent with those results above, the colony-forming abilities of both cell lines were also suppressed significantly after downregulation of linc-UFC1 compared with that of the negative controls (n=6, P<0.05; Figures 3b and c).
Figure 3
Linc-UFC1 knockdown inhibited proliferation of CRC cells via cell cycle arrest. (a) Knockdown of linc-UFC1 impaired proliferation in LOVO and SW480 cells, as revealed by CellTiter 96 AQueous One Solution Cell Proliferation assay (n=6; *P<0.05 versus sh#1 and sh#2). (b and c) Histological analysis of the rates of colony formation in control (NC) and linc-UFC1 knockdown groups (sh#1 and sh#2; n=6; *P<0.05 versus NC). (d) The EdU incorporation assay to examine the effects of linc-UFC1 inhibition on DNA synthesis during cell growth. The images were taken at × 200. The result showed that the proportion of S phase cells (EdU-positive cells) was decreased in shRNA-treated groups (n=6, P<0.05 versus NC). (e) Flow cytometric analysis of cell cycle arrest 48 h after treatment with shRNAs (sh#1 and sh#2) and negative control (NC) in LOVO and SW480 cells (n=6, P<0.05 versus NC). (f and g) The expression levels of cell cycle-related proteins (cyclin D1, CDK4, Rb and p-Rb) indicated by western blotting in control (NC) and linc-UFC1 knockdown groups of LOVO and SW480 cells (n=6; *P<0.05 versus NC)
In order to better understand the role of linc-UFC1 in proliferation, a 5-ethynyl-2'-deoxyuridine (EdU) incorporation assay was used to examine the effects of linc-UFC1 inhibition on DNA synthesis during cell growth. The result showed that the proportion of S phase cells (EdU-positive cells) was decreased in shRNA-treated groups, suggesting that reduced DNA synthetic activity resulted from linc-UFC1 depletion (n=6, P<0.05; Figure 3d). Furthermore, we transfected the cancer cells with shRNAs before analyzing the cell cycle distribution by flow cytometry. Both LOVO and SW480 cells treated with shRNAs showed apparent increases in the percentage of cells in G1 phase with concomitant decreases in the percentage of cells in the S phase compared with cells treated with negative controls (n=6, P<0.05; Figure 3e), which was consistent with the EdU assay. These results proved that linc-UFC1 knockdown could lead to cell cycle arrest in G1 phase, which might be responsible for the suppressed proliferation.Based on our finding that linc-UFC1 regulated cell cycle distribution, we next examined the expression of several important cell cycle-related proteins in linc-UFC1 knockdown CRC cells. The knockdown of linc-UFC1 led to a decreased expression of cyclin D1, cyclin-dependent kinase 4 (CDK4), retinoblastoma (Rb) and phosphorylated Rb (p-Rb; n=6, P<0.05; Figures 3f and g). In particular, changes in these cell cycle regulatory factors were well correlated with the G1 cell cycle arrest as shown in the flow cytometry and EdU incorporation assays. Therefore, these data suggested that linc-UFC1 might be capable of promoting cell proliferation in CRC by regulating the cell cycle.
Knockdown of linc-UFC1 resulted in intrinsic apoptosis in CRC cells
We next investigated the involvement of linc-UFC1 in cell death of CRC cells by inhibiting linc-UFC1 expression with shRNAs. As shown by flow cytometry analysis in Figures 4a and b, when compared with the control cells, shRNA treatment led to increased apoptotic rates in LOVO and SW480 cells (n=6, P<0.05). To explore the potential mechanisms accounting for the apoptosis-induced anticancer behaviors triggered by linc-UFC1 depletion, western blotting was used to investigate the alteration of apoptosis-related proteins. Cleavages of caspase-9 and caspase-3 are known to be prominent markers of the mitochondria-mediated caspase-dependent pathway. In this study, the rate of increase of apoptosis after linc-UFC1 knockdown was consistent with the enhanced levels of cleavages of caspase-9 and caspase-3 in both LOVO and SW480 cells (n=6, P<0.05; Figures 4c and d), indicating that the activation of the intrinsic apoptotic pathway was involved in the apoptosis induced by linc-UFC1 downregulation.
Figure 4
Knockdown of linc-UFC1 resulted in intrinsic apoptosis in CRC cells. (a and b) Flow cytometry analysis of the apoptotic rates in LOVO and SW480 cells after shRNA treatment (sh#1 and sh#2). (c and d) Western blotting was used to investigate alterations in apoptosis-related proteins (caspase-9 and caspase-3) in both LOVO and SW480 cells. (n=6; *P<0.05 versus NC)
Linc-UFC1 knockdown induced inhibition of β-catenin
Next, we examined the expression of β-catenin, a key downstream effector of WNT signaling, to further uncover the alterations of proliferation abilities in LOVO and SW480 cells after transfection with shRNAs. As revealed by western blotting, linc-UFC1 knockdown inhibited the expression of β-catenin in both LOVO and SW480 cells (n=6, P<0.05; Figures 5a and b). In addition, we observed a positive relationship between linc-UFC1 and β-catenin mRNA by QPCR in 65 CRC specimens (P<0.01, r=0.706; Figure 5c). Linc-UFC1 knockdown also affected the expression levels of downstream effectors of β-catenin, such as the decreased levels of cyclin D1, Myc and MMP-7, and increased the Axin2 level (n=6, P<0.05; Figures 5a and b). In the samples with high linc-UFC1 expression, β-catenin was localized in both the nucleus and cytoplasm. However, in the samples with low linc-UFC1 expression, β-catenin was mainly localized in the cytoplasm (Figure 5d). These results showed that linc-UFC1 knockdown inhibited tumorigenesis by inhibition of β-catenin.
Figure 5
The involvement of the WNT/β-catenin pathway induced by linc-UFC1 knockdown. (a and b) Expression levels of β-catenin and its downstream effectors (Myc, MMP-7 and Axin2) were analyzed by western blots using LOVO and SW480 cells with linc-UFC1 knockdown (n=6; *P<0.05 versus NC). (c) The β-catenin mRNA levels were plotted against linc-UFC1 expression in 65 CRC specimens, and a significant positive correlation was obtained (two-tailed Pearson's correlation, r=0.706; P<0.01). (d) The localization of β-catenin was distributed in both the nucleus and the cytoplasm in the samples with high linc-UFC1 expression and primarily in the cytoplasm in the samples with low linc-UFC1 expression. The images were taken at × 200
Linc-UFC1 knockdown induced activation of P38 signaling
As MAPK signal, consisting of ERK1/2, JNK and P38, have critical roles in apoptosis, we examined the activation of the MAPK pathway to further uncover the mechanisms underlying the alterations of apoptosis in LOVO and SW480 cells after transfection with shRNAs. As revealed by western blotting, linc-UFC1 knockdown enhanced the phosphorylation level of P38 in both LOVO and SW480 cells (n=6, P<0.05; Figures 6a and b). In contrast, the levels of phosphorylated JNK and ERK1/2 were not obviously changed upon linc-UFC1 knockdown (n=6, P>0.05; Figures 6a and b).
Figure 6
The involvement of the P38 pathway induced by linc-UFC1 knockdown. (a and b) The levels of p-JNK, p-ERK1/2 and p-P38 in LOVO and SW480 cells after treatment with shRNAs (sh#1 and sh#2) and negative control (NC) were determined by western blotting analysis (n=6; *P<0.05 versus NC). (c and d) LOVO and SW480 cells were treated with shRNA transfection (sh#1 and sh#2) and SB203580 (SB) for 36 h. The levels of p-P38, caspase-9 and caspase-3 were evaluated by western blotting analysis. (n=6; *P<0.05 versus NC; #P<0.05 versus sh#2)
To verify in depth whether this apoptotic phenomenon was dependent on the activation of the P38 signaling pathway, the P38-specific inhibitor SB203580 was added to block P38 signaling before transfection with shRNAs. Western blotting analysis demonstrated that SB203580 reduced the levels of the cleavage fragments of caspase-9, caspase-3 and phosphorylated P38 efficiently in LOVO and SW480 cells (n=6, P<0.05; Figures 6c and d). Furthermore, SB203580 also reduced the levels of the cleavage fragments of caspase-9, caspase-3 and phosphorylated P38 efficiently in linc-UFC1 downregulation CRC cells (n=6, P<0.05; Figures 6c and d). These data further illustrated that the apoptosis induced by linc-UFC-1 depletion in CRC cells was mediated through the activation of P38 signaling.
Discussion
Because of the unlimited proliferation, defective apoptosis and metastasis of cancer cells, the treatment of cancer remains a huge challenge for human beings. In recent years, increasing studies have revealed that dysregulation of lncRNAs might affect epigenetic information and provide a cellular growth advantage, resulting in progressive and uncontrolled tumor growth.[17, 18, 19] However, for most of these lincRNAs, the detailed functions, mechanisms and signaling pathways through which they exert their biological functions have not been well understood. The interplay between proteins and lincRNAs is an important topic in the field of cancer biology, in which lincRNAs may provide the missing piece of the well-known oncogenic and tumor-suppressor network puzzle. Therefore, we conducted a series of experiments to clarify the possible relationships between CRC and linc-UFC1 and explore the potential application of linc-UFC1 in the diagnosis and treatment of CRC.In this study, it was demonstrated that linc-UFC1 was overexpressed in CRC tissues compared with adjacent non-tumor tissues and was positively correlated with the tumor histology grade, N grade and M grade, suggesting linc-UFC1 as a useful diagnostic biomarker or therapeutic target in CRC.[20] The role of linc-UFC1 in CRC was further investigated by detecting the alterations of biological behaviors in CRC cell lines after linc-UFC1 knockdown. It was found that linc-UFC1 downregulation effectively suppressed proliferation in vitro, concomitant with induction of cell cycle arrest, apoptosis and metastatic inability. However, we noticed that the presence of high linc-UFC1 is associated with well and moderately differentiated carcinoma in Table 1. We think this phenomenon might be related to the following factors. In comparison with Western countries, health care in our developing country is less comprehensive, and there is no medical routine screening system. Even citizens' health-related awareness is not good enough, as many people only go to the hospital after noticing blood in the stool or stool deformation, which causes many patients with well-differentiated carcinoma to present with tumor metastasis at diagnosis. The second reason might be that we did not have a sufficiently large number of specimens, which might have caused errors. We will pay attention to this aspect in future studies. Moreover, the association between linc-UFC1 expression levels and the overall survival of patients remains unclear, which might be owing to the limited number of cases and follow-up time. Prospective studies in larger cohorts are needed.Cancer progression is commonly associated with disorders in cell cycle control that lead to the unlimited proliferation of cancer cells.[21, 22] The cell cycle transition from the G1 phase to the S phase is the major regulatory checkpoint in cell proliferation. In this study, flow cytometry analysis and an EdU incorporation assay demonstrated that linc-UFC1 downregulation induced cell cycle arrest at the G1 phase and lowered the percentage of cancer cells in S phase. We next evaluated the expression of proteins that have crucial roles in G1 phase and the G1/S transition of the cell cycle to explore the mechanisms underlying the observed proliferation alterations after linc-UFC1 knockdown. We revealed that linc-UFC1 knockdown inhibited the expression levels of cyclin D1, CDK4 and p-Rb accompanied by a decrease in total Rb. Cyclin D1 could promote cell transition through G1 phase via activating CDK4, which leads to increased phosphorylation of Rb (p-Rb).[23, 24] Thus, a decreased level of CDK4-cyclin D complex can inhibit the phosphorylation of Rb and ultimately induce cell cycle arrest at the G1 phase.[25] The cell cycle arrest was attributed, at least in part, to the anticancer effect of linc-UFC1 knockdown on tumor growth. Collectively, the above results revealed the vital role of linc-UFC1 in promoting tumorigenesis and progression of CRC. Linc-UFC1 could be a potential therapeutic target for CRC.Defective apoptosis is one of the hallmarks of cancer cells. In the process of cell apoptosis, the caspase family is indispensable for the initiation and execution of cell death in response to various types of stimuli.[26, 27, 28] The upregulation of intrinsic apoptotic signaling recruits and activates initiator caspase-9 and effector caspase (caspase-3/6/7), which ultimately bring about cellular death. Our findings are consistent with the idea that the knockdown of linc-UFC1 by shRNAs induced apoptosis of CRC cells by the activation of caspase-9 and caspase-3, indicating that linc-UFC1 inhibition could enhance the chemosensitivity of CRC cells and that linc-UFC1 might be an attractive therapeutic target in CRC treatment.β-Catenin expression is well known to be required for WNT signaling to regulate the specificity of its signaling pathway activation and its biological effects. In this study, linc-UFC1 could regulate β-catenin expression in CRC, in agreement with a previous report showing that linc-UFC1 prevents β-catenin mRNA degradation in HCC.[16] In our study, a correlation between linc-UFC1 and β-catenin mRNA expression was observed in clinical CRC tissues, further supporting the role of linc-UFC1 in maintaining β-catenin expression. Moreover, the mechanism underlying this correlation, according to the previous reports, involved an interaction between linc-UFC1 and HuR, an RNA-binding protein that physically associates with β-catenin mRNA and prevents β-catenin mRNA degradation.[16, 29, 30] In addition, linc-UFC1 knockdown also affected the expression levels of cyclin D1, Myc, MMP-7 and Axin2, which were correlated with proliferation and apoptosis. These results suggest that linc-UFC1 downregulation could facilitate β-catenin translocation from the nucleus to the cytoplasm.Various factors may affect apoptosis of cancer cells through different signaling pathways.[31, 32] P38, as a serine–threonine kinase and a key member of the MAPK pathway, has an important role in a variety of physiological and pathological processes, including cell death or apoptosis.[33, 34] In this study, linc-UFC1 downregulation modulated the phosphorylation level of P38 and exerted its influence on apoptosis in CRC cells. The interplay between linc-UFC1 and P38 signaling was highlighted by using the JNK inhibitor SB203580, which attenuated the pro-apoptotic ability of linc-UFC1 knockdown. In this way, the WNT and P38 pathways have important roles in biological processes, including cell growth, differentiation and apoptosis. In many previous studies, activation of P38 signaling could depress the WNT/β-catenin pathway in different ways.[35, 36, 37] Based on the above evidence, P38 might be an upstream regulator of WNT signaling.In conclusion, our study showed that linc-UFC1 exhibited strong effects on CRC cells by promoting proliferation while attenuating apoptosis. The potential mechanisms underlying these effects included dysregulation of the cell cycle and inactivation of intrinsic apoptosis via regulation of the WNT/β-catenin and P38 signaling pathways. Moreover, positive correlations between linc-UFC1 expression and clinical parameters, including tumor grade, N stage and M stage, were detected. Thus, linc-UFC1 could be a promising therapeutic target and novel molecular biomarker for CRC.
Materials and Methods
Patients and tissue samples of CRC
Sixty-five paired samples of CRC and adjacent non-tumor tissues (>5 cm away from the tumor) were obtained from patients who underwent surgery at Sun Yat-Sen Memorial Hospital of Sun Yat-Sen University. The postoperative pathologic staging of each subject was determined according to the 7th edition of the Union for International Cancer Control (UICC) tumor-node-metastasis (TNM) staging system for CRC. Tissue samples were collected and immediately snap frozen in liquid nitrogen and stored at −80 °C until further analysis. Before the use of these clinical materials for research purposes, written consent from all patients and approval of the hospital ethics review committees were obtained.
Cell lines and culture conditions
Five CRC cell lines (DLD-1, HCT-116, LOVO, RKO and SW480) and HEK293T cells (a human non-CRC cell line) were purchased from the Institute of Biochemistry and Cell Biology of the Chinese Academy of Sciences (Shanghai, China). Cells were cultured in RPMI-1640 or DMEM (Gibco, Grand Island, NY, USA) medium supplemented with 10% fetal bovine serum (Gibco), 100 U/ml penicillin and 100 mg/ml streptomycin (Gibco) in humidified air at 37 °C with 5% CO2. SB203580, a P38 inhibitor, was purchased from Sigma-Aldrich (St. Louis, MO, USA). SB203580 was dissolved in DMSO as a 10 mmol/l stock solution and stored at −20 °C. To avoid precipitation of SB203580, DMSO was added to a final concentration of 0.1% in the media. LOVO and SW480 cells were treated with 5 μmol/l SB203580 for 1 h before transfection with shRNAs.
RNA extraction and QPCR
Total RNA was extracted from cell lines and tissue samples using TRIzol reagent (Invitrogen, Carlsbad, CA, USA). First-strand cDNA was synthesized with PrimeScript RT Master Mix (TAKARA, Dalian, China). After reverse transcription of the total RNA, QPCR was conducted to examine the expression of linc-UFC1 using SYBR Green PCR Master mix (TAKARA, Dalian, China) on a Bio-Rad Real-Time PCR instrument (Bio-Rad, Hercules, CA, USA). GAPDH was used as an internal reference gene to normalize RNA levels between different samples for an exact comparison of transcription levels. The sequences of the primers were as follows (in the 5' to 3' orientation): GAPDH forward, GGGAGCCAAAAGGGTCAT; GAPDH reverse, GAGTCCTTCCACGATACCAA; linc-UFC1 forward, TCCAACCTGAGTGACATAGCGA; linc-UFC1 reverse, CTGACCTCCAACTCCAACGAAT; β-catenin forward, ACAGGGAAGACATCACTGAGCC; and β-catenin reverse, CAGTGGGATGGTGGGTGTAAGA. Data were analyzed using the ΔΔCt method with GAPDH as the constitutive marker.
Knockdown of linc-UFC1 expression
In the transient transfection experiments, the shRNAs targeting linc-UFC1 (sh#1: 5'-CCGGAAGCACAGTGGTCTAAAAGTACTCGAGTACTTTTAGACCACTGTGCTTTTTTTG-3'; sh#2: 5'-CCGGCTGTAGAAGGTTGAAGGGAAACTCGAGTTTCCCTTCAACCTTCTACAGTTTTTG-3') and the negative control shRNA (5'-UUCUCCGAACGUGUCACGUTTACGUGACACGUUCGGAGAATT-3') were synthesized by GenePharma (Shanghai, China). LOVO and SW480 cells were seeded in six-well plates 1 day before transfection. Cells were transfected with shRNAs using Lipofectamine 3000 Transfection Reagent (Life Technologies, Grand Island, NY, USA) following the manufacturer's instructions.
EdU incorporation assay
To assess cell proliferation, cells were seeded in 24-well plates. The cells were incubated under standard conditions in complete media. Forty-eight hours after transfection, cell proliferation was detected using the incorporation of EdU with the EdU Cell Proliferation Assay Kit (Ribobio, Guangzhou, China). Briefly, the cells were incubated with 50 mM EdU for 3 h before fixation, permeabilization and EdU staining, which were performed according to the manufacturer's protocol. The cell nuclei were stained with DAPI (Sigma-Aldrich) at a concentration of 1 mg/ml for 10 min. The proportion of cells that incorporated EdU was determined by fluorescence microscopy.
CellTiter 96 AQueous One solution cell proliferation assay
To detect cell proliferation, a cell counting kit (CellTiter 96 AQueous One Solution Cell Proliferation Assay kit) purchased from Promega (Madison, WI, USA) was used. One thousand cells per well were seeded in 96-well plates and treated with shRNAs. Starting on the second day, CellTiter 96 AQueous One Solution was added to at least five replicate wells at one-fifth of the total volume, and the cells were incubated for 2 h at 37 °C. Absorbance was measured with the multifunctional microplate reader SpectraMax M5 (Molecular Devices, Sunnyvale, CA, USA) at 490 nm. The measurement of cell proliferation was conducted every 24 h and lasted 4 days.
Colony formation assay
LOVO and SW480 cells, treated with shRNAs and negative control for 24 h, were routinely trypsinized and seeded in six-well plates (1000 cells per well). The medium was changed every 3 days. After 1 week, cells were washed with PBS, fixed with 4% paraformaldehyde for 30 min and then stained with crystal violet for 30 min for visualization and counting.
Flow cytometry assay
Flow cytometry analysis was performed to determine whether linc-UFC1 regulates the growth phase of CRC cells. LOVO and SW480 cells were seeded into six-well plates. Forty-eight hours after transfection, the cells were harvested and stained with annexin V-FITC and propidium iodide (PI), according to the manufacturer's instructions. Cellular apoptotic rate was evaluated using a FACSVerse flow cytometer (Becton Dickinson, CA, USA). Cells for growth phase analysis were resuspended in 200 μl PBS, fixed with 70% ice-cold ethanol overnight and stained with PI. The cell cycle was detected using a FACSVerse flow cytometer.
Protein extraction and western blotting
Cells were rinsed twice with cold PBS and lysed with RIPA buffer (Thermo Fisher Scientific, Waltham, MA, USA) containing protease inhibitor cocktail (Roche, South San Francisco, CA, USA). Protein (40 μg per sample) was separated by SDS-PAGE on a 10% polyacrylamide gel. The protein was transferred electrophoretically onto a PVDF membrane. Blotted membranes were blocked in 5% skimmed milk diluted in TBS-T, followed by incubation with appropriate primary antibodies (anti-cyclin D1, CDK4, Rb, p-Rb, caspase-9, caspase-3, β-catenin, p-P38, p-ERK1/2, p-JNK, Myc, MMP-7, Axin2 and β-actin), which were obtained from Cell Signaling Technology (Beverly, MA, USA) and diluted 1:1000, overnight at 4 °C. Then, the membranes were washed with TBS-T three times for 5 min and subsequently incubated for 1 h with HRP-linked secondary antibody (Cell Signaling Technology) at room temperature. β-Actin was used as an internal control. The blots were detected using an enhanced chemiluminescence kit (Millipore, Billerica, MA, USA) and autoradiography with X-ray film.
Immunohistochemistry
Segments were fixed with 4% paraformaldehyde overnight at 4 °C, embedded in paraffin and cut at a thickness of 4 μm. Sections were incubated with primary antibodies against β-catenin (Cell Signaling Technology). After washing with PBS, tissue sections were incubated with EnVision+/HRP/Rb (DAKO, Glostrup, Denmark) for 30 min at room temperature. The sections were then incubated in 3, 3'-DAB (Maxim, Fuzhou, China) for 5 min and then counterstained with hematoxylin for 30 s. All sections were photographed with a Nikon TE2000-U camera (Nikon, Tokyo, Japan) equipped with Nikon optics.
Statistical analysis
All the experiments were performed at least three times, and the mean values and S.D. were calculated. Differences between two groups were analyzed using Student's t-test. The correlations between linc-UFC1 and the clinical characteristics of the CRC samples were determined using SPSS 22.0 (IBM, Armonk, NY, USA) Pearson chi-square test. A value of P<0.05 was considered to be statistically significant.
Authors: David Cunningham; Wendy Atkin; Heinz-Josef Lenz; Henry T Lynch; Bruce Minsky; Bernard Nordlinger; Naureen Starling Journal: Lancet Date: 2010-03-20 Impact factor: 79.321
Authors: Hyun-Soo Kim; Sung-Im DO; Byeong-Joo Noh; Young In Jeong; Sun Jin Park; Youn Wha Kim Journal: Oncol Lett Date: 2015-01-14 Impact factor: 2.967
Authors: Felipe C Beckedorff; Murilo Sena Amaral; Carlos Deocesano-Pereira; Sergio Verjovski-Almeida Journal: Biosci Rep Date: 2013-08-30 Impact factor: 3.840