Cervical cancer is one of the most common gynecologic cancers around the world. Long noncoding RNAs (lncRNAs) are considered to be important regulators of some biological processes. Recently, it has been reported that linc-UFC1 is a putative oncogene in some cancers. However, the functional roles of linc-UFC1 have not been investigated in cervical cancer. Here, it was demonstrated that linc-UFC1 expression was significantly increased in cervical cancer tissues, and its overexpression was associated with the poor survival of patients with cervical cancer. Loss-of-function assays indicated that linc-UFC1 exerted as an oncogene because it promoted the growth and metastasis of cervical cancer cells in vitro and in vivo. Mechanistic investigations revealed that linc-UFC1 upregulated FOXP3 expression through competitively binding miR-34a. Finally, luciferase reporter and chromatin immunoprecipitation (ChIP) assays provided evidence that E2F1 could directly bind to the linc-UFC1 promoter region and enhance its transcription. Taken together, our findings indicate that the linc-UFC1 expression signature may serve as a novel biomarker for the diagnosis and prognosis of cervical cancer, and it is also highlighted that the E2F1-linc-UFC1/miR-34a/FOXP3 axis may be a potentially therapeutic target of cervical cancer.
Cervical cancer is one of the most common gynecologic cancers around the world. Long noncoding RNAs (lncRNAs) are considered to be important regulators of some biological processes. Recently, it has been reported that linc-UFC1 is a putative oncogene in some cancers. However, the functional roles of linc-UFC1 have not been investigated in cervical cancer. Here, it was demonstrated that linc-UFC1 expression was significantly increased in cervical cancer tissues, and its overexpression was associated with the poor survival of patients with cervical cancer. Loss-of-function assays indicated that linc-UFC1 exerted as an oncogene because it promoted the growth and metastasis of cervical cancer cells in vitro and in vivo. Mechanistic investigations revealed that linc-UFC1 upregulated FOXP3 expression through competitively binding miR-34a. Finally, luciferase reporter and chromatin immunoprecipitation (ChIP) assays provided evidence that E2F1 could directly bind to the linc-UFC1 promoter region and enhance its transcription. Taken together, our findings indicate that the linc-UFC1 expression signature may serve as a novel biomarker for the diagnosis and prognosis of cervical cancer, and it is also highlighted that the E2F1-linc-UFC1/miR-34a/FOXP3 axis may be a potentially therapeutic target of cervical cancer.
As one of the most common gynecologic cancers, cervical cancer accounts for a large proportion of cancer‐related mortality among women around the world. Totally, approximately 99 000 new cases of cervical cancer and 30 000 deaths occurred in China, 2015.1 Due to the progress in cervical cytological and pathological detection, early‐ and advanced‐stage cancers could be diagnosed accurately. However, despite great advancement in cervical cancer therapies, such as surgical resection, chemotherapy, and radiotherapy, the prognoses of patients with cervical cancer were still poor. Therefore, it is necessary to identify the molecular mechanisms underlying the initiation and development of cervical cancer.With the progress of high‐throughput genome‐wide sequencing technology, emerging evidences have indicated that the vast majority of noncoding RNAs (ncRNAs) in the genome are widely transcribed.2, 3 These ncRNAs are thought to play critical regulatory roles in the carcinogenesis and cancer progression. Long noncoding RNAs (lncRNAs) can regulate gene expression via multiple mechanisms, including transcriptional and posttranscriptional regulation and chromatin modification.4, 5 LncRNAs are also involved in some significant biological processes, including cell proliferation, cell apoptosis, cell motility, cell autophagy, and cell differentiation.6, 7 With the exception of lncRNAs identified in preliminary cervical cancer studies, such as LNC473,8 HOTAIR,9 LincRNA‐p21,10 and PVT1,11 the overall pathophysiological contributions and the underlying mechanisms of specific lncRNAs remain largely unknown.Long intergenic noncoding RNA UFC1 (linc‐UFC1) is a putative oncogene lncRNA. linc‐UFC1 caused the increase in the β‐catenin level via interaction with the mRNA‐stabilizing protein HuR in liver cancer cells.12 Moreover, linc‐UFC1 was upregulated in colorectal cancer. linc‐UFC1 also promoted proliferation while inhibited apoptosis by activating phosphorylated P38 and suppressing β‐catenin.13 However, the expression pattern and functions of linc‐UFC1 have not been studied in cervical cancer. In this study, the clinical significance of linc‐UFC1 expression in cervical cancer tissue was analyzed. Then, the critical role of linc‐UFC1 in modulating growth and metastasis was further demonstrated. Generally, in our present study, the E2F1/linc‐UFC1/miR‐34a/FOXP3 axis was identified as a molecular mechanism in the tumorigenesis and progression of cervical cancer.
MATERIALS AND METHODS
Tissue samples
Eighty‐two patients with cervical cancer were included in this study. Patients were staged using 2009 International Federation of Gynecology and Obstetrics (FIGO) Clinical Staging system. The samples were pathologically confirmed to contain cancerous tissue. All tumor specimens were immediately frozen in liquid nitrogen and stored at −80°C refrigerator. All patients gave their informed consent before gaining the specimens. The study was performed in accordance with the Declaration of Helsinki and has been approved by the ethical committee of the Cangzhou Central hospital.
Cell lines and cell culture
Cervical cancer cell lines Hela and Siha were obtained from the American Type Culture Collection (ATCC). Authentication of these cell lines was performed using the GenePrint10 System (Promega Biotech Co.) and via comparisons to the STR database. Hela and Siha were cultured in Dulbecco modified Eagle medium (DMEM, Hycline) supplemented with 10% fetal bovine serum (FBS, Gibco) and 1% streptomycin/penicillin at 37°C in a humidified incubator with 5% CO2.
RNA isolation and quantitative real‐time PCR (qRT‐PCR)
Total RNA was isolated using TRIzol™ reagent (Invitrogen) as the manufacturer's instructions. cDNA was synthesized using the ReverTra Ace® qPCR RT kit (Toyobo, Osaka, Japan). Real‐time PCR was performed using a StepOne Plus Real‐Time PCR System (Applied Biosystems), and fold changes in gene expression were calculated using the 2−ΔΔ method. GAPDH was used as a reference gene for qPCR. The primer sequences for the genes used were provided as follow: GAPDH: AGAAGGCTGGGGCTCATTTG, AGGGGCCATCCACAGTCTTC; UFC1: TCCAACCTGAGTGACATAGCGA, CTGACCTCCAACTCCAACGAAT; FOXP3: CTCCAGAGAGAGATGGTACAGT, CGGATGATGCCACAGATGAA.
Lentiviral vector construction, production, and transfection
The Human linc‐UFC1 was inserted into pLV vector. The shRNA targeting linc‐UFC1 was designed and cloned into pLKO.1 vector. The target sequence of UFC1 shRNA was shown as follow: sh1: AAGCACAGTGGTCTAAAAGTA, sh2: CTGTAGAAGGTTGAAGGGAAA. The constructed vectors and the lentivirus packaging vectors (pMD.2G, pMDL, pVSV‐G) were cotransfected into 293T cells. Lentiviruses were produced, harvested, and then purified. Cells were transfected with above lentivirus using 8 μg/mL polybrene (Sigma, USA). Stable clones were selected by 2 μg/mL puromycin (Sigma, USA).
Western blot
Cells were lysed using a RIPA lysis buffer with a protease inhibitor cocktail (Roche). The protein samples were separated by SDS‐PAGE and transferred onto PVDF membranes (Millipore, USA). The PVDF membranes were incubated with primary antibodies at 4°C overnight. The primary antibodies used were shown as follow: the anti‐FOXP3 (1:1000; Abcam, ab20034, USA), and anti‐GAPDH antibody (1:5000, Santa Cruz Biotechnology, sc‐32233, USA). The HRP‐conjugated secondary antibodies were used to incubate the treated PVDF membranes for 1 hour at room temperature.
Proliferation assay
Cells were counted and seeded in a 96‐well plate. At different time point, CCK8 solution (Dojindo, Japan) was added to each well and incubated for 1.5 hours. A microplate reader (Biorad, USA) was used to measure the OD values at 450 nm.
Migration and invasion assays
Transwell chambers (Corning, USA) were used to detect the cell migration and invasion. The cells in a serum‐free medium were added to the top of each well, and 500 μL full medium containing 10% FBS was added to the lower chamber. After 24 hours, the migratory or invasive cells were fixed and stained with crystal violet solution for 1 hour.
Flow cytometric analysis
For cell cycle analysis, cells were fixed in 70% ethanol and then stained with propidium iodide (PI) solution. For cell apoptosis analysis, the cells were stained with FITC‐Annexin V and PI. The cell apoptosis and cell cycle were detected and analyzed using the FACS Calibur (BD Biosciences, USA) and the Flowjo software (Tree Star Corp, USA).
RNA immunoprecipitation (RIP)
The interaction between linc‐UFC1 and miR‐34a was confirmed by RIP assay as previously described.14 In brief, cells were cotransfected with pcDNA‐MS2 or pcDNA‐UFC1‐MS2 or pcDNA‐UFC1‐mut‐MS2 and pMS2‐GFP (Addgene). After transfection, cells were subjected to anti‐GFP RIP assay using RNA Immunoprecipitation Kit (Millipore) as the manufacturer's instructions. For anti‐AGO2 RIP, cells were transfected with miR‐NC or miR‐34a mimics and then subjected to an anti‐AGO2 RIP assay according to the manufacturer's instructions.
Dual‐luciferase assays
The wild‐type linc‐UFC1 and mutant linc‐UFC1 (lincUFC1‐mut) were cloned into pmirGLO reporter vector, respectively. The pmirGLO‐UFC1 or pmirGLO‐UFC1‐mut was cotransfected with miR‐NC or miR‐34a mimics into cells. Luciferase activity was determined by the Dual‐luciferase Reporter Assay System (Promega) as the manufacturer's instructions.
Statistical analysis
All data are expressed as the mean ± SD. All experiments were repeated 3 times. All data were analyzed by SPSS 17.0 software (IBM). P < .05 was considered significant. Comparison between different groups was analyzed by a Student's t test or ANOVA. The survival rates of cervical cancerpatients were analyzed by the Kaplan‐Meier estimator.
RESULTS
linc‐UFC1 expression is frequently increased in cervical cancer, and it is also associated with the poor survival of patients
qRT‐PCR analysis was performed to investigate the linc‐UFC1 expression levels in 82 pairs of cervical cancer samples and matched adjacent normal tissues. linc‐UFC1 expression was significantly upregulated (P < .001) in cancerous tissues compared with normal tissues (Figure 1A). To determine the correlation between clinicopathologic significance and linc‐UFC1 expression, linc‐UFC1 expression was divided into a high‐level group (n = 41) and a low‐level group (n = 41) by the median of linc‐UFC1 expression. The results showed that linc‐UFC1 expression was correlated with the tumor size (P = .001), the FIGO stage (P = .002), lymph metastasis (P = .004), and distant metastasis (P = .009) in cervical cancer (Table 1). Furthermore, overall survival analysis showed a worse survival rate in the cervical cancerpatients with high expression of linc‐UFC1 (P = .007) (Figure 1B). Together, these data suggest that linc‐UFC1 expression is significantly increased in cervical cancer, and its expression signature may be a novel biomarker for the diagnosis and prognosis of cervical cancer.
Figure 1
linc‐UFC1 expression is frequently increased in cervical cancer and is associated with the poor survival of patients. A, The expression levels of linc‐UFC1 in 82 pairs of cervical cancer samples and matched adjacent normal tissues were detected by qRT‐PCR. B, The overall survival of cervical cancer patients with different level of linc‐UFC1 expression was determined by Kaplan‐Meier survival curve and log‐rank test. Patients were segregated into UFC1‐high group and UFC1‐low according to the median of linc‐UFC1 expression in cervical cancer tissues
Table 1
The correlation between linc‐UFC1 expression and clinicopathological features in patients with cervical cancer
Clinical parameters
linc‐UFC1
P value
High
Low
Age (y)
≤40
19
23
.383
>40
23
19
Size (cm)
≥4
27
10
.001
<4
15
32
FIGO stages
I‐II
15
29
.002
III‐IV
27
13
Lymphatic metastasis
Yes
26
13
.004
No
16
29
Distant metastasis
Yes
28
16
.009
No
14
26
linc‐UFC1 expression is frequently increased in cervical cancer and is associated with the poor survival of patients. A, The expression levels of linc‐UFC1 in 82 pairs of cervical cancer samples and matched adjacent normal tissues were detected by qRT‐PCR. B, The overall survival of cervical cancerpatients with different level of linc‐UFC1 expression was determined by Kaplan‐Meier survival curve and log‐rank test. Patients were segregated into UFC1‐high group and UFC1‐low according to the median of linc‐UFC1 expression in cervical cancer tissuesThe correlation between linc‐UFC1 expression and clinicopathological features in patients with cervical cancer
linc‐UFC1 promotes cell proliferation, migration, and invasion and inhibits the apoptosis of cervical cancer cells
Given that linc‐UFC1 is overexpressed in cervical cancer tissues, we further investigated whether linc‐UFC1 could affect the malignant phenotypes of cervical cancer cells. Three shRNAs targeting linc‐UFC1 were tested for their knockdown efficiency, and among them, the most efficient two (sh1 and sh2) (Figure 2A) were selected for further experiments. From CCK‐8 assays and colony formation assays, it was concluded that the inhibition of linc‐UFC1 suppressed cell viability and proliferation in both Siha and Hela cells (Figure 2B,C). Moreover, the significantly increased percentage of apoptotic cells was observed (Figure 2D) in linc‐UFC1‐silencing cells compared with control cells. Meanwhile, the cell cycle assay demonstrated that linc‐UFC1 knockdown induced cell cycle arrest at the G0/G1 phase in Siha and Hela cells compared with their control cells (Figure 2E).
Figure 2
linc‐UFC1 promotes cell proliferation, migration, and invasion and inhibits apoptosis of cervical cancer cells. A, Three shRNAs targeting linc‐UFC1 were tested for their knockdown efficiency by qRT‐PCR. B, The cell proliferation induced by linc‐UFC1 shRNA was tested by CCK‐8 assay. C, The cell proliferation induced by linc‐UFC1 shRNA was tested by colony formation assay. D, Cervical cancer cells with linc‐UFC1 knockdown were stained with a combination of annexin V and 7‐AAD and analyzed by FACS. Cells positive for annexin V staining were counted as apoptotic cells, and the percentage of apoptotic cells is shown. E, The effect of linc‐UFC1 on cell cycle distribution was detected by FACS assay. F, The migration and invasion of control and linc‐UFC1‐silencing cells were determined by Transwell assay. Data are shown as mean ± SD; *P < .05
linc‐UFC1 promotes cell proliferation, migration, and invasion and inhibits apoptosis of cervical cancer cells. A, Three shRNAs targeting linc‐UFC1 were tested for their knockdown efficiency by qRT‐PCR. B, The cell proliferation induced by linc‐UFC1 shRNA was tested by CCK‐8 assay. C, The cell proliferation induced by linc‐UFC1 shRNA was tested by colony formation assay. D, Cervical cancer cells with linc‐UFC1 knockdown were stained with a combination of annexin V and 7‐AAD and analyzed by FACS. Cells positive for annexin V staining were counted as apoptotic cells, and the percentage of apoptotic cells is shown. E, The effect of linc‐UFC1 on cell cycle distribution was detected by FACS assay. F, The migration and invasion of control and linc‐UFC1‐silencing cells were determined by Transwell assay. Data are shown as mean ± SD; *P < .05Cell motility was measured by migration assays, and the results showed that the knockdown of linc‐UFC1 inhibited the migration of Siha and Hela cells (Figure 2F). In addition, we found that invasion of Siha and Hela cells was significantly reduced when following silence of linc‐UFC1 expression as shown by Matrigel Transwell assays (Figure 2F). These data showed that the knockdown expression of linc‐UFC1 could suppress cervical cancer cell growth and metastasis.
Knockdown of linc‐UFC1 inhibits tumor growth and metastasis in vivo
Next, the effect of linc‐UFC1 on tumor growth in vivo was determined. Hela/con and Hela/sh1 cells were subcutaneously inoculated into the hind limb of nude mice. It was found that mice in the Hela/sh1 group developed smaller tumors than those in the Hela/con group (Figure 3A). Moreover, IHC assays showed that the Ki‐67 staining in the Hela/sh1‐xenografted tumors was much weaker than that in the control group (Figure 3B).
Figure 3
Knockdown of linc‐UFC1 inhibits tumor growth and metastasis in vivo. A, Comparison was made between the control group and the linc‐UFC1 knockdown group at the weekly time points. B, The tumor sections were subjected to H&E and IHC staining using antibodies against Ki‐67. C, Representative image of lung metastases in mice injected with control and the linc‐UFC1 knockdown Hela cells. D, The numbers of lung metastases per mouse were calculated (n = 5). Comparison was made between the control group and the linc‐UFC1 knockdown group
Knockdown of linc‐UFC1 inhibits tumor growth and metastasis in vivo. A, Comparison was made between the control group and the linc‐UFC1 knockdown group at the weekly time points. B, The tumor sections were subjected to H&E and IHC staining using antibodies against Ki‐67. C, Representative image of lung metastases in mice injected with control and the linc‐UFC1 knockdown Hela cells. D, The numbers of lung metastases per mouse were calculated (n = 5). Comparison was made between the control group and the linc‐UFC1 knockdown groupBesides, the Hela/con and Hela/sh1 cells were injected into the tail vein of mice to detect the linc‐UFC1‐mediated metastasis in vivo. After 8 weeks, the pulmonary metastases were examined by hematoxylin‐eosin staining. 20% (1 of 5) of mice in the Hela/sh1 group had lung metastatic nodules, while 100% (5 of 5) of mice in the Hela/con group were featured with lung metastatic nodules (Figure 3C). The linc‐UFC1 knockdown also decreased the number of lung metastatic nodules in mice (Figure 3D). These results show that linc‐UFC1 enhances tumor growth and metastasis in vivo.
linc‐UFC1 modulates FOXP3 expression
Moreover, the molecular mechanism of linc‐UFC1 in the cervical cancer progress was investigated. Then, RNA sequencing was performed to identify the target genes of linc‐UFC1 (Figure 4A). Among these genes, FOXP3 is of particular interest for its remarkable change upon linc‐UFC1 inhibition and its critical role in growth and metastasis of cancer cells.14 To validate the result, the mRNA and the protein expression of FOXP3 in control and linc‐UFC1 silencing cells were detected. As shown in Figure 4B,C, both mRNA and protein levels of FOXP3 were significantly decreased after the depletion of linc‐UFC1. Meanwhile, restoring FOXP3 almost reversed cell proliferation, cell migration, and invasion suppressed by linc‐UFC1 knockdown (Figure 4D‐F).
Figure 4
linc‐UFC1 modulates FOXP3 expression. A, RNA sequencing was performed. Expression heatmap of transcripts whose expressions were regulated by linc‐UFC1 knockdown. B, The mRNA level of FOXP3 expression was detected by qRT‐PCR in control and linc‐UFC1‐downregualted cells. C, The protein level of FOXP3 expression was detected by Western blot in control and linc‐UFC1 knockdown cells. D, The full‐length FOXP3 was transfected into linc‐UFC1‐silencing Hela cells. Then, the FOXP3 expression was detected by Western blot. E, Restoration of FOXP3 expression rescued the proliferation decreased by linc‐UFC1 knockdown in HeLa cells. F, Restoration of FOXP3 expression rescued the migration, and invasion decreased by linc‐UFC1 knockdown in HeLa cells. G, The correlation between linc‐UFC1 and FOXP3 expression was determined in cervical cancer tissues. Data are shown as mean ± SD; *P < .05
linc‐UFC1 modulates FOXP3 expression. A, RNA sequencing was performed. Expression heatmap of transcripts whose expressions were regulated by linc‐UFC1 knockdown. B, The mRNA level of FOXP3 expression was detected by qRT‐PCR in control and linc‐UFC1‐downregualted cells. C, The protein level of FOXP3 expression was detected by Western blot in control and linc‐UFC1 knockdown cells. D, The full‐length FOXP3 was transfected into linc‐UFC1‐silencing Hela cells. Then, the FOXP3 expression was detected by Western blot. E, Restoration of FOXP3 expression rescued the proliferation decreased by linc‐UFC1 knockdown in HeLa cells. F, Restoration of FOXP3 expression rescued the migration, and invasion decreased by linc‐UFC1 knockdown in HeLa cells. G, The correlation between linc‐UFC1 and FOXP3 expression was determined in cervical cancer tissues. Data are shown as mean ± SD; *P < .05To further confirm the pathological correlation between linc‐UFC1 and FOXP3 in cervical cancer samples, we detected the linc‐UFC1 and FOXP3 expression in the same set of 82 pairs of cervical cancer tissues. Besides, a positive correlation between linc‐UFC1 and FOXP3 in cervical cancer tissue was observed (r
2 = .4668, P < .0001; Figure 4G). In a word, our results demonstrate that linc‐UFC1 exerts its function at least in part via regulating linc‐UFC1 expression.
linc‐UFC1 directly associates with miR‐34a
lncRNAs can function as a natural miRNA sponge to inhibit the binding of microRNAs to its target mRNAs. Previous study indicated that miR‐34a was featured with putative binding sites with linc‐UFC1.12 To confirm the association between linc‐UFC1 and miR‐34a, RNA pull‐down assays were performed. The results showed that endogenous miR‐34a could be pulled down by biotin‐labeled in vitro transcribed biotin‐labeled linc‐UFC1 (Figure 5A). Then, MS2‐RIP assays were performed to pull down endogenous microRNAs interacted with linc‐UFC1 for further confirmation. It was also found that the linc‐UFC1 RIP in Hela and Siha cells was significantly enriched for miR‐34a compared with the empty vector, IgG, and linc‐UFC1 with mutations in miR‐34a targeting sites (linc‐UFC1‐mut) (Figure 5B). In addition, luciferase reporters containing the wild‐type or mutant linc‐UFC1 were constructed. The results showed that miR‐34a upregulation significantly decreased the luciferase activities of the wild‐type linc‐UFC1 reporter vector but not pmirGLO or linc‐UFC1‐mut (Figure 5C). To determine whether linc‐UFC1 was regulated by miR‐34a in an AGO2‐dependent manner, we performed anti‐AGO2 RIP in Hela and Siha cells with miR‐34a overexpression. Endogenous linc‐UFC1 was significantly pulled down by anti‐AGO2 antibodies in miR‐34a overexpressed cells (Figure 5D), indicating that miR‐34a is the bona fide linc‐UFC1‐targeting microRNA. Moreover, overexpressing wild‐type linc‐UFC1 rather than mutant linc‐UFC1 decreased the miR‐34a expression (Figure 5E). The overexpression of linc‐UFC1 instead of the mutant also significantly increased the proliferation, migration, and invasion potential of Hela and Sila cells, and these phenotypes were completely abolished when miR‐34a was overexpressed (Figure 5F,G).
Figure 5
linc‐UFC1 directly associates with miR‐34a. A, Hela cell lysates were incubated with biotin‐labeled linc‐UFC1, and the pull‐down miR‐34a was assessed by qRT‐PCR. B, The RIP assay was performed to pull down the miR‐34a interacted with linc‐UFC1 or mutant linc‐UFC1. C, Luciferase activity in Hela cells cotransfected with miR‐NC or miR‐34a and luciferase reporters containing wild‐type or mutant linc‐UFC1. D, Anti‐AGO2 RIP was performed in Hela cells with overexpression of miR‐NC or miR‐34a and followed by qRT‐PCR to detect linc‐UFC1 associated with AGO2. E, The relative expression of miR‐34a in wild‐type or mutant linc‐UFC1 overexpressed Hela cells. F, The cell proliferation was determined by CCK‐8 assay in the indicated clones. G, The cell migration and invasion were determined by Transwell assay in the indicated clones. Data are shown as mean ± SD; *P < .05
linc‐UFC1 directly associates with miR‐34a. A, Hela cell lysates were incubated with biotin‐labeled linc‐UFC1, and the pull‐down miR‐34a was assessed by qRT‐PCR. B, The RIP assay was performed to pull down the miR‐34a interacted with linc‐UFC1 or mutant linc‐UFC1. C, Luciferase activity in Hela cells cotransfected with miR‐NC or miR‐34a and luciferase reporters containing wild‐type or mutant linc‐UFC1. D, Anti‐AGO2 RIP was performed in Hela cells with overexpression of miR‐NC or miR‐34a and followed by qRT‐PCR to detect linc‐UFC1 associated with AGO2. E, The relative expression of miR‐34a in wild‐type or mutant linc‐UFC1 overexpressed Hela cells. F, The cell proliferation was determined by CCK‐8 assay in the indicated clones. G, The cell migration and invasion were determined by Transwell assay in the indicated clones. Data are shown as mean ± SD; *P < .05
linc‐UFC1 upregulates FOXP3 expression by competitively binding miR‐34a
By adopting Targetscan and Microinspector software, it was found that FOXP3 3′UTR shared regulatory miR‐34a with linc‐UFC1, and we also wondered whether linc‐UFC1 could modulate FOXP3 through competitively binding miR‐34a. Ectopic expression of wild‐type linc‐UFC1, but not the mutant, upregulated FOXP3 levels, while miR‐34a reversed this increase (Figure 6A). In contrast, we silenced miR‐34a in linc‐UFC1‐silencing cells. The knockdown of linc‐UFC1 decreased FOXP3 expression, whereas knockdown of miR‐34a overcame the decrease of FOXP3 expression (Figure 6B).
Figure 6
linc‐UFC1 upregulates FOXP3 expression by competitively binding miR‐34a. A, miR‐34a attenuated the upregulation of FOXP3 mediated by linc‐UFC1 overexpression. B, miR‐34a inhibitor rescued the downregulation of FOXP3 induced by linc‐UFC1 knockdown. C, miR‐34a attenuated the luciferase activity of FOXP3 3′UTR increased by linc‐UFC1 overexpression. D, miR‐34a inhibitor rescued the luciferase activity of FOXP3 3′UTR decreased by linc‐UFC1 knockdown. Data are shown as mean ± SD; *P < .05
linc‐UFC1 upregulates FOXP3 expression by competitively binding miR‐34a. A, miR‐34a attenuated the upregulation of FOXP3 mediated by linc‐UFC1 overexpression. B, miR‐34a inhibitor rescued the downregulation of FOXP3 induced by linc‐UFC1 knockdown. C, miR‐34a attenuated the luciferase activity of FOXP3 3′UTR increased by linc‐UFC1 overexpression. D, miR‐34a inhibitor rescued the luciferase activity of FOXP3 3′UTR decreased by linc‐UFC1 knockdown. Data are shown as mean ± SD; *P < .05To confirm whether this effect depends on FOXP3 3′UTR, luciferase reporters containing the FOXP3 3′UTR (pmirGLO‐FOXP3) were constructed. linc‐UFC1 overexpression of, but not the linc‐UFC1‐mut, increased the luciferase activity of pmirGLO‐FOXP3, while restoring expression of miR‐34a abolished this upregulation (Figure 6C). On the contrary, knockdown of linc‐UFC1 reduced the luciferase activity of pmirGLO‐FOXP3, which were rescued by miR‐34a knockdown (Figure 6D). Together, these results suggest an important role of linc‐UFC1 in regulating FOXP3 expression via competitively binding miR‐34a.
E2F1 activates linc‐UFC1 transcription
Although a lot of lncRNA dysregulation has been reported in cancers, the regulators involved in misregulation of these molecules are not properly understood. With the JASPAR online prediction tool, we found that the transcription factor E2F1 is predicted to be bind to the linc‐UFC1 promoter region with high scores. Then, Hela and Sila cells were transfected with E2F1 siRNAs, and the qRT‐PCR results showed that linc‐UFC1 expression was downregulated after E2F1 knockdown (Figure 7A). Moreover, we designed 2 primers that contained the E2F1 binding sites. The chromatin immunoprecipitation (ChIP) assays showed that E2F1 could directly bind to these 2 sites (Figure 7B). Dual‐luciferase reporter assays showed that E2F1 could bind to the linc‐UFC1 promoter and activate luciferase (Figure 7C). These data indicate that some transcriptional factors contribute to tumor progression by regulating both mRNAs and lncRNA transcription.
Figure 7
E2F1 activates linc‐UFC1 transcription. A, qRT‐PCR analysis of linc‐UFC1 and E2F1 expression in Hela and Sila cells after transfection with E2F1 siRNA or the negative control. B, ChIP‐qPCR analysis of E2F1 occupancy in the linc‐UFC1 promoter in Hela and Sila cells. C, Luciferase assays of the cells indicated that were transfected with pGL3‐linc‐UFC1 vector, the E2F1 vector, or an empty vector. Data are shown as mean ± SD; *P < .05
E2F1 activates linc‐UFC1 transcription. A, qRT‐PCR analysis of linc‐UFC1 and E2F1 expression in Hela and Sila cells after transfection with E2F1 siRNA or the negative control. B, ChIP‐qPCR analysis of E2F1 occupancy in the linc‐UFC1 promoter in Hela and Sila cells. C, Luciferase assays of the cells indicated that were transfected with pGL3‐linc‐UFC1 vector, the E2F1 vector, or an empty vector. Data are shown as mean ± SD; *P < .05
DISCUSSION
In this study, we found that the expression of linc‐UFC1 was increased in cervical cancer. Overexpression of linc‐UFC1 was associated with the tumor size, the FIGO stage, lymph metastasis, distant metastasis, and poor prognosis. It was also reported that linc‐UFC1 promotes cervical cancer cell proliferation, migration, and invasion by competitively binding miR‐34a and upregulating FOXP3 expression. All these data can support our conclusion that linc‐UFC1 plays a significant role in cervical cancer growth and metastasis. Therefore, linc‐UFC1 was determined to have the oncogenic activity in cervical cancer.linc‐UFC1 has been reported as an oncogene in cancers, including colorectal cancer and liver cancer. In liver cancer, linc‐UFC1 promoted proliferation and reduced apoptosis in HCC cells through directly interacting with the mRNA‐stabilizing protein HuR to regulate levels of β‐catenin.12 In colorectal cancer, linc‐UFC1 silence induced cell proliferation inhibition and G1 cell cycle arrest via suppressing β‐catenin and activating phosphorylated P38.13 Recent studies reported that many RNA transcripts, such as lncRNA, function as competing endogenous RNAs (ceRNAs) by competitively binding common microRNAs.15, 16 However, to date, whether linc‐UFC1 functions as a ceRNA remains unknown. In our present study, we found that linc‐UFC1 shares miR‐34a response elements with FOXP3, an oncoprotein in cancers. It was also observed that the overexpression of linc‐UFC1 was sufficient to increase FOXP3 and facilitate cell proliferation, migration, and invasion. This role depends on the competitive binding of miR‐34a, indicating that linc‐UFC1 functions as a ceRNA. FOXP3 has been studied in several types of cancer cells. Most of these studies have shown that FOXP3 upregulation closely correlates with unfavorable prognosis, although there are some evidences indicating the opposite role of FOXP3.17, 18 Overexpression of FOXP3 is a bad predictor of survival for patients with cervical cancer. The upregulation of FOXP3 in cervical cancer tissues is also correlated with the FIGO stage, lymph node metastasis, and tumor size. FOXP3 stimulated proliferation, inhibited apoptosis, increased cell invasion, and reduced cells in the S and G2 phases of the cell cycle.19 Previous study showed that the hypomethylation of the FOXP3 promoter was involved in FOXP3 increase.20 However, the other regulatory mechanism of FOXP3 expression is still unknown. Our present study showed that FOXP3 expression was regulated by linc‐UFC1. linc‐UFC1 functioned upstream of FOXP3 in cellular proliferation, migration, and invasion of cervical cancer through acting as a ceRNA of FOXP3.The regulators responsible for lncRNA deregulation in different cancers remain elucidated. Recently, emerging evidence has shown that lncRNA expression can be regulated in a manner similar to protein coding genes. For example, the transcription factor E2F1 activates ANRIL expression in gastric cancer.21 Our current study demonstrated that E2F1 could activate linc‐UFC1 transcription by binding to its promoter region for the first time. These results indicate that the lncRNA expression pattern found in different cancers may be related to the regulation of different transcription factors.In conclusion, our study showed that the upregulation of linc‐UFC1 in cervical cancer tissues was closely correlated with malignant clinical features and poor prognosis of patients with cervical cancer. Functional assays demonstrated a novel oncogenic role of linc‐UFC1 in tumor growth and metastasis of cervical cancer. The functions of linc‐UFC1 in cervical cancer resulted from the regulation of FOXP3 expression through the association of miR‐34a. Together, our findings suggested that linc‐UFC1 may be a promising and effective target for cervical cancer therapies.
Authors: Mitchell Guttman; Ido Amit; Manuel Garber; Courtney French; Michael F Lin; David Feldser; Maite Huarte; Or Zuk; Bryce W Carey; John P Cassady; Moran N Cabili; Rudolf Jaenisch; Tarjei S Mikkelsen; Tyler Jacks; Nir Hacohen; Bradley E Bernstein; Manolis Kellis; Aviv Regev; John L Rinn; Eric S Lander Journal: Nature Date: 2009-02-01 Impact factor: 49.962