| Literature DB >> 26047338 |
Longjian Niu1,2, Yan-Bin Tao3, Mao-Sheng Chen4, Qiantang Fu5, Chaoqiong Li6, Yuling Dong7, Xiulan Wang8, Huiying He9, Zeng-Fu Xu10,11.
Abstract
Real-time quantitative PCR (RT-qPCR) is a reliable and widely used method for gene expression analysis. The accuracy of the determination of a target gene expression level by RT-qPCR demands the use of appropriate reference genes to normalize the mRNA levels among different samples. However, suitable reference genes for RT-qPCR have not been identified in Sacha inchi (Plukenetia volubilis), a promising oilseed crop known for its polyunsaturated fatty acid (PUFA)-rich seeds. In this study, using RT-qPCR, twelve candidate reference genes were examined in seedlings and adult plants, during flower and seed development and for the entire growth cycle of Sacha inchi. Four statistical algorithms (delta cycle threshold (ΔCt), BestKeeper, geNorm, and NormFinder) were used to assess the expression stabilities of the candidate genes. The results showed that ubiquitin-conjugating enzyme (UCE), actin (ACT) and phospholipase A22 (PLA) were the most stable genes in Sacha inchi seedlings. For roots, stems, leaves, flowers, and seeds from adult plants, 30S ribosomal protein S13 (RPS13), cyclophilin (CYC) and elongation factor-1alpha (EF1α) were recommended as reference genes for RT-qPCR. During the development of reproductive organs, PLA, ACT and UCE were the optimal reference genes for flower development, whereas UCE, RPS13 and RNA polymerase II subunit (RPII) were optimal for seed development. Considering the entire growth cycle of Sacha inchi, UCE, ACT and EF1α were sufficient for the purpose of normalization. Our results provide useful guidelines for the selection of reliable reference genes for the normalization of RT-qPCR data for seedlings and adult plants, for reproductive organs, and for the entire growth cycle of Sacha inchi.Entities:
Keywords: Plukenetia volubilis; RT-qPCR; biofuels; flower development; reference gene; seed development
Mesh:
Substances:
Year: 2015 PMID: 26047338 PMCID: PMC4490458 DOI: 10.3390/ijms160612513
Source DB: PubMed Journal: Int J Mol Sci ISSN: 1422-0067 Impact factor: 5.923
Selected candidate reference genes, primer sequences and PCR amplification characteristics.
| Gene/GenBank Accession Number | Description | Function | Forward (F) and Reverse (R) Primer Sequences (5′→3′) | Amplicon Length | Amplification Efficiency (%) | Correlation Coefficient | |
|---|---|---|---|---|---|---|---|
| 18S ribosomal RNA | ribosomal structure | F: ACCAGGTCCAGACATAGTAAGGATTGA | 140 bp | 81.73 | 106.40 | 0.999 | |
| R: AGTTAGCAGGCTGAGGTCTCGTT | |||||||
| actin | cytoskeletal structural protein | F: CCAGAAGTCTTGTTCCAGCCATCTC | 185 bp | 80.66 | 105.78 | 0.999 | |
| R: GCGGTGATCTCCTTGCTCATACG | |||||||
| cyclophilin | protein folding | F: GGCAAGATACGAACGGATCACAGTT | 145 bp | 82.95 | 108.93 | 0.999 | |
| R: GGCACTCCACTCCGACTTCCTT | |||||||
| elongation factor 1-alpha | protein biosynthesis | F: GGTATTCTCAAGCCTGGTATGGTTGT | 102 bp | 80.48 | 94.98 | 0.999 | |
| R: GAGAGCCTCCTGAAGAGCCTCAT | |||||||
| glyceraldehyde-3-phosphate dehydrogenase | glucose metabolism | F: TGGCAAGCATATTCAGGCAGGAG | 116 bp | 81.63 | 94.98 | 0.999 | |
| R: TTGGCTCATCAGGATTGTAGGTATCAG | |||||||
| phospholipase A22 | lipid catabolic process | F: ATACCATACAGAACGCAGCTTGTGAA | 101 bp | 79.92 | 103.33 | 0.998 | |
| R: TTCCGCCAGTTCCAACCTATCCA | |||||||
| RNA polymerase II subunit | mRNA process | F: GCCTCGGTCTCATTCCTCTTACAAG | 109 bp | 82.44 | 104.17 | 0.999 | |
| R: AACTCAACAGAACAATACTCGCACTGA | |||||||
| 30S ribosomal protein S13 | DNA-templated transcription | F: TAATGCACAGCTTCCAGATGAC | 202 bp | 81.47 | 90.55 | 0.999 | |
| R: AACCAGTCGCTTTGATTCTTCT | |||||||
| transcription elongation factors-II | transcription | F: AGATTCAGAGCATGAAGAGGGAC | 182 bp | 82.18 | 104.17 | 0.996 | |
| R: CGATCGGTATTTGTTGCGATTT | |||||||
| Tubulin beta-4 chain | structural constituent of cytoskeleton | F: ACAATTCACTGCCATGTTCAGGAGAA | 169 bp | 82.05 | 97.83 | 0.999 | |
| R: GTCATCTTCGTAGTCACCTTCGTCATC | |||||||
| ubiquitin-like | protein binding | F: GCTACGTCTGCGTGGAGGAATG | 197 bp | 82.39 | 99.53 | 0.996 | |
| R: TGTAGTCTGCCAATGTGCGTCC | |||||||
| ubiquitin-conjugating enzyme | ubiquitin-dependent protein catabolic process | F: TGGAATGGATGACGGAGACGACAT | 142 bp | 78.74 | 100 | 0.997 | |
| R: AACACTTGGTGGCTTCTCTGGATAATC |
Figure 1Figure 1. Melting curves for the twelve candidate reference genes. The melting temperature of each amplicon is visualized by plotting the negative derivative of the change in fluorescence divided by the change in temperature in relation to the temperature (−(d/dT) Fluorescence (465–510)).
Figure 2Average cycle threshold (Ct) values for the twelve candidate reference genes. Boxes indicate the interquartile range. Lines across the boxes indicate the average Ct values. Whiskers represent 95% confidence intervals, and black dots represent outliers.
Stability ranking of candidate reference genes in different developmental stages.
| Analysis Tool | Ranking Order (The 1st is the most stable, and the 12th is the least stable) | ||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 | 9 | 10 | 11 | 12 | ||||||||||||||
|
| |||||||||||||||||||||||||
| Δ |
|
|
|
|
|
|
|
|
|
|
|
| |||||||||||||
| BestKeeper |
|
|
|
|
|
|
|
|
|
|
|
| |||||||||||||
| NormFinder |
|
|
|
|
|
|
|
|
|
|
|
| |||||||||||||
| geNorm |
|
|
|
|
|
|
|
|
|
| |||||||||||||||
| Recommended comprehensive ranking |
|
|
|
|
|
|
|
|
|
|
|
| |||||||||||||
|
| |||||||||||||||||||||||||
| Δ |
|
|
|
|
|
|
|
|
|
|
|
| |||||||||||||
| BestKeeper |
|
|
|
|
|
|
|
|
|
|
|
| |||||||||||||
| NormFinder |
|
|
|
|
|
|
|
|
|
|
|
| |||||||||||||
| geNorm |
|
|
|
|
|
|
|
|
|
| |||||||||||||||
| Recommended comprehensive ranking |
|
|
|
|
|
|
|
|
|
|
|
| |||||||||||||
|
| |||||||||||||||||||||||||
| Δ |
|
|
|
|
|
|
|
|
|
|
|
| |||||||||||||
| BestKeeper |
|
|
|
|
|
|
|
|
|
|
|
| |||||||||||||
| NormFinder |
|
|
|
|
|
|
|
|
|
|
|
| |||||||||||||
| geNorm |
|
|
|
|
|
|
|
|
|
| |||||||||||||||
| Recommended comprehensive ranking |
|
|
|
|
|
|
|
|
|
|
|
| |||||||||||||
|
| |||||||||||||||||||||||||
| Δ |
|
|
|
|
|
|
|
|
|
|
|
| |||||||||||||
| BestKeeper |
|
|
|
|
|
|
|
|
|
|
|
| |||||||||||||
| NormFinder |
|
|
|
|
|
|
|
|
|
|
|
| |||||||||||||
| geNorm |
|
|
|
|
|
|
|
|
|
| |||||||||||||||
| Recommended comprehensive ranking |
|
|
|
|
|
|
|
|
|
|
|
| |||||||||||||
|
| |||||||||||||||||||||||||
| Δ |
|
|
|
|
|
|
|
|
|
|
|
| |||||||||||||
| BestKeeper |
|
|
|
|
|
|
|
|
|
|
|
| |||||||||||||
| NormFinder |
|
|
|
|
|
|
|
|
|
|
|
| |||||||||||||
| geNorm |
|
|
|
|
|
|
|
|
|
| |||||||||||||||
| Recommended comprehensive ranking |
|
|
|
|
|
|
|
|
|
|
|
| |||||||||||||
Figure 3Relative quantification of the AGAMOUS homolog (PvoAG) in Sacha inchi using the validated reference genes for normalization. (A) PvoAG expression pattern in adult plants. The four kinds of bars indicate PvoAG expression levels normalized by different reference genes RPS13, CYC, GAPDH and 18S respectively; and (B) PvoAG expression pattern during flower development. The four kinds of bars indicate PvoAG expression levels normalized by different reference genes PLA, ACT, RPS13 and TUB respectively. YL, young leaf; R, root; S, stem; ML, mature leaf; YI, young inflorescence; SD, seed (90 DAP); IB, inflorescence bud; FF, female flower; MF, male flower.