| Literature DB >> 28966627 |
Mengmeng Duan1,2, Jinglei Wang1, Xiaohui Zhang1, Haohui Yang1, Haiping Wang1, Yang Qiu1, Jiangping Song1, Yangdong Guo2, Xixiang Li1.
Abstract
Radish (Raphanus sativus) is an important cruciferous root crop with a close relationship to Chinese cabbage (Brassica rapa). RT-qPCR is used extensively to evaluate the expression levels of target genes, and accurate measurement of target gene expression with this method is determined by the valid reference genes used for data nomalization in different experimental conditions. Screening for appropriate reference genes with stable expression based on RT-qPCR data is important for gene expression and functional analysis research in radish and its relatives. However, many researches have thought that almost no single reference gene is widely suitable for all experimental conditions, and few researchers have paid attention to the validation of reference genes in radish gene expression analysis. In the present study, 12 candidate reference genes were selected for analysis. Their expression in 28 samples, including 20 radish samples from different organs and conditions, four Chinese cabbage organs and four organs of their distant hybrid, was assessed by RT-qPCR and then five software tools-ΔCt, geNorm, NormFinder, BestKeeper and RefFinder-were used to compare their expression stability. The results showed that the most suitable reference genes were different in different organs and conditions. GAPDH, DSS1, and UP2 were optimal reference genes for gene expression analysis in all organs and conditions in radish. UPR, GSNOR1, and ACTIN2/7 were the most stable reference genes in different radish organs. UP2 and GAPDH were suitable reference genes for radish pistil development studies. RPII, UBC9, and GAPDH had the most stable expression in radish under various stresses. DSS1, UP2, and TEF2 were the optimal reference genes for Chinese cabbage organs, whereas TUA was optimal for the distant hybrid. UP2, and TEF2 were appropriate reference genes for all of the samples together. The optimal reference genes we identified, UP2, GAPDH, UPR, and GSNOR1 were verified by normalizing the expression patterns of YAB3, RPL, and FUL. These results will provide important information for selecting target reference genes in different research contexts and improve the accuracy and precision of gene expression analysis for radish, Chinese cabbage and their distant hybrid.Entities:
Keywords: Chinese cabbage; RT-qPCR; distant hybrid; organs; pistil development; radish; reference gene; stress
Year: 2017 PMID: 28966627 PMCID: PMC5605625 DOI: 10.3389/fpls.2017.01605
Source DB: PubMed Journal: Front Plant Sci ISSN: 1664-462X Impact factor: 5.753
Candidate reference genes and primers used for RT-qPCR in radish, Chinese cabbage, and their distant hybrid.
| GroES-like zinc-binding dehydrogenase family protein | At5g43940 | AAGGTTCGGTCCGCTAC | GAAGGCAGACTTTCTCCAA | 181 | 83.4 | 0.90 | 0.94 | 0.91 | ||
| Uncharacterized protein family (UPF0041) | At4g22310 | GTTCAAGTGGGGAATAAGC | GCAATCTGTTGAGGGTAGG | 81 | 76.8 | 0.90 | 0.89 | 0.91 | ||
| deletion of SUV3 suppressor 1(I) | At1g64750 | AAGATTGGGTTGAGAAAGAG | GAAGCGAGAAGTCGTCATT | 93 | 80.6 | 1.03 | 0.91 | 0.91 | ||
| Glyceraldehyde-3-phosphate dehydrogenase | At1g13440 | GAAATCAAGAAGGCTATCAAGGAG | TTGTCACCAACGAAGTCAGT | 101 | 83.6 | 0.87 | 0.87 | 0.91 | ||
| Actin 2/7 | At5g09810 | GCATCACACTTTCTACAAC | CCTGGATAGCAACATACAT | 155 | 80 | 0.93 | 0.95 | 0.94 | ||
| RNA polymerase-II transcription factor | At2g15430 | ATCACGCTAAATGGTCTCCT | GCTGCTCTCAATCAAGTCAATC | 122 | 80.5 | 1.12 | 0.92 | 0.90 | ||
| Translation elongation factor 2 | At1g56070 | AAGAAGATTTGGGCGTTTGG | CCAGCAACAACAGAATCCTT | 107 | 81.5 | 0.96 | 0.93 | 0.90 | ||
| Tubulin alpha-5 | At5g19780 | TTCCCTATCCTCGCATCCATTTCA | CCTCGGGTCACACTTAGCCATCA | 146 | 84 | 0.93 | 0.94 | 0.90 | ||
| Tubulin beta-1 | At1g75780 | GTCCGGTGCTGGTAATAACTGG | GTGGCATACTTGAAACCCTTGAA | 130 | 84 | 0.93 | 0.92 | 0.92 | ||
| Ubiquitin conjugating enzyme 9 | At4g27960 | GCATCTGCCTCGACATCTTGA | GACAGCAGCACCTTGGAAATG | 68 | 82 | 1.03 | 0.90 | 0.96 | ||
| Uncharacterized conserved protein UCP022280 | At4g26410 | AAATTCCTGGGAGGGAAGCTAT | TTCTGTCTCAGGAGCGAAGTCAT | 70 | 80.6 | 1.00 | 0.86 | 0.92 | ||
| 18S ribosomal RNA | At3g41768 | TACCGTCCTAGTCTCAACCATAA | TTTCAGCCTTGCGACCATAC | 130 | 84.6 | 0.90 | 0.92 | 0.91 | ||
| At4g00180 | GTAGTTTGTTCAAGACCGTAA | GGAGGGAAGAAGAAGAGC | 92 | 81.5 | 0.92 | – | – | |||
| MADS-box gene negatively regulated by | At5g60910 | TCAATAGGCAAGTTACTTTCTC | AACCCAATTTTCACTCTGTG | 233 | 82.8 | 0.94 | – | – | ||
| Has sequence similarity to the Arabidopsis ovule development regulator Bell1 | At5g02030 | GGTTTTCTCGGTGGGC | ATCGTAAGTAGGTCTAGGGTG | 150 | 84.3 | 0.91 | – | – | ||
Figure 1Boxplot analysis of the expression profiles of 12 candidate reference genes across all 28 samples. The line across the box represents the median. The boxes represent the 25/75 percentiles. The whiskers show the maximum and minimum values. The circles indicate outliers.
Stability rankings of candidate reference genes in seven sets by ΔCt, BestKeeper, NormFinder, geNorm, and RefFinder.
| Delta CT | ||||||||||||
| BestKeeper | ||||||||||||
| Normfinder | ||||||||||||
| geNorm | ||||||||||||
| Recommended comprehensive ranking | ||||||||||||
| Delta CT | ||||||||||||
| BestKeeper | ||||||||||||
| Normfinder | ||||||||||||
| geNorm | ||||||||||||
| Recommended comprehensive ranking | ||||||||||||
| Delta CT | ||||||||||||
| BestKeeper | ||||||||||||
| Normfinder | ||||||||||||
| geNorm | ||||||||||||
| Recommended comprehensive ranking | ||||||||||||
| Delta CT | ||||||||||||
| BestKeeper | ||||||||||||
| Normfinder | ||||||||||||
| geNorm | ||||||||||||
| Recommended comprehensive ranking | ||||||||||||
| ΔCt | ||||||||||||
| BestKeeper | ||||||||||||
| Normfinder | ||||||||||||
| geNorm | ||||||||||||
| Recommended comprehensive ranking | ||||||||||||
| ΔCt | ||||||||||||
| BestKeeper | ||||||||||||
| Normfinder | ||||||||||||
| geNorm | ||||||||||||
| Recommended comprehensive ranking | ||||||||||||
| ΔCt | ||||||||||||
| BestKeeper | ||||||||||||
| Normfinder | ||||||||||||
| geNorm | ||||||||||||
| Recommended comprehensive ranking | ||||||||||||
RsOs, radish organs under normal conditions; RsPs, radish pistils at different developmental stages; RsSs, radish seedlings under biotic (diamondback moth) and abiotic (cold, Tumv) stresses, RsAll: all radish samples; BrOs, of Chinese cabbage organs; Hos, organs of the distant hybrid; All, all samples.
Figure 2Determination of the optimal number of reference genes. Pairwise variation (Vn/n + 1) was calculated by geNorm to determine the number of reference genes required for accurate normalization in different sample sets. The dashed lines indicate 0.15 was the cut-off value to determine the optimal number of reference genes for gene normalization. RsOs, radish organs under normal conditions; RsPs, radish pistils at different developmental stages; RsSs, radish seedlings under biotic (diamondback moth) and abiotic (cold, TuMV) stresses; RsAll, all radish samples; BrOs, Chinese cabbage organs; HOs, organs of the distant hybrid; All, all samples.
Figure 3Relative expression levels of YAB3 (A), FUL (B), and RPL (C) in radish pistil development. The three top-ranked genes (UP2, GAPDH, and UPR) and the last-ranked genes GSNOR1 by RefFinder were used for expression normalization. Error bars indicate the standard deviation of three biological replicates.