| Literature DB >> 27148337 |
Jian Li1, Jigang Han2, Yonghong Hu2, Ji Yang3.
Abstract
Tree peony (Paeonia suffruticosa) is a perennial plant indigenous to China known for its elegant and vibrantly colorful flowers. A few genes involved in petal pigmentation have been cloned in tree peony. However, to date, there have been few studies on the comparison and selection of stable reference genes for gene expression analysis by quantitative reverse-transcription PCR (qRT-PCR) in this species. In this study, 10 candidate reference genes were evaluated for the normalization of qRT-PCR in three tree peony cultivars. GAPDH and UBC were identified as the top two most stable reference genes in 'Feng Dan' and 'Xi Shi,' and EF-1α/UBC was recommended to be the best combination for 'Que Hao.' The expression stability of various reference genes differed across cultivars, suggesting that selection and validation of reliable reference genes for quantitative gene expression analysis was necessary not only for different species but also for different cultivars. The results provided a list of reference genes for further study on gene expression in P. suffruticosa. However, in any case, a preliminary check on the accuracy of the best performing reference genes is requested for each qRT-PCR experiment.Entities:
Keywords: flower development; gene expression normalization; qRT-PCR; reference genes; tree peony
Year: 2016 PMID: 27148337 PMCID: PMC4838814 DOI: 10.3389/fpls.2016.00516
Source DB: PubMed Journal: Front Plant Sci ISSN: 1664-462X Impact factor: 5.753
Primer sequences and amplification characteristics for 10 candidate reference genes and 1 gene of interest.
| comp39032_c0_seq1 | Actin | Actin | AT3G27000.1 | AAGGTGATGGAATGGCTGAC/CAAGAACTGCTCCTCCAAGG | 264 | 60 | 96.48 | 0.997 | |
| comp72555_c2_seq1 | α-TUB | α-tubulin | AT1G50010.1 | AAAACTGTTGGTGGAGGCGA/TCTGGGTGAAAGAGTTGGCG | 152 | 60 | 95.71 | 0.999 | |
| comp78934_c0_seq1 | β-TUB | β-tubulin | AT5G23860.2 | AGAACGCCGACGAGTGTATG/AGGGAAACGAAGGCAGCAAG | 149 | 60 | 90.51 | 0.994 | |
| comp21853_c0_seq1 | UBC | Ubiquitin conjugating enzyme | AT3G46460.1 | TACCCAAACAGCCCTCCAAC/AGCAGCTTCAATGTTTGCCG | 234 | 59 | 98.82 | 0.994 | |
| comp72593_c0_seq1 | GAPDH | Glyceraldehyde 3-phosphate dehydrogenase | AT1G13440.1 | CTGGAGTTTTCACCGACAAGG/CCAATGGGGCAAGACAGTTAG | 186 | 60 | 92.78 | 0.998 | |
| comp21491_c1_seq1 | PP2A | Protein phosphatase 2A | AT1G10430.1 | TGATTACTTGCCCCTCACAGCC/CATAACAGGTCGCACATTGGTC | 150 | 60 | 91.46 | 0.995 | |
| comp62257_c0_seq1 | TIP41 | TIP41-like protein | AT4G34270.1 | ACGTTCCATTCTCACCTCCC/GCTTCCAACCAGTAAGAGCG | 164 | 59 | 101.45 | 0.993 | |
| comp54677_c1_seq1 | SAMS | s-adenosylmethionine synthetase | AT4G01850.2 | TCTTCCACCTCAACCCATCTG/TAAGCACCACTCCTGTCCAC | 166 | 59 | 104.74 | 0.991 | |
| comp82277_c2_seq1 | EF-1α | Elongation factor 1 alpha | AT5G60390.2 | TCCTGGGCATCGTGACTTTA/TTCATCATACCGAGCCTTTG | 232 | 60 | 94.57 | 0.997 | |
| comp62008_c0_seq1 | CYP | cyclophilin | AT2G36130.1 | GTTCTTCATTACCTTGGCACCT/TGACCGTTGACCGTAGTATCTT | 161 | 58 | 99.23 | 0.995 | |
| comp63583_c0_seq1 | F3H | flavanone 3-hydroxylase | AT3G51240.1 | GCTCTACCGCCTGATGACAAG/GTTACTCGCTTCCACCCCTCC | 191 | 60 | 98.58 | 0.996 |
Unigenes were selected from the transcriptome of tree peony. The mean efficiency (E) of PCR amplification and the regression coefficient (R2) for each primer pair were calculated by the LightCycler 96 SW Software.
Figure 1The ranking order of reference genes. Expression stability values (M) of candidate reference genes calculated by GeNorm. Lower M-value indicates more stable expression. FD, ‘Feng Dan’; XS, ‘Xi Shi’; QH, ‘Que Hao.’
Figure 2Pairwise variation (V) of 10 candidate reference genes calculated by GeNorm. The cutoff value to determine the optional number of reference genes for normalization is 0.15. FD, ‘Feng Dan’; XS, ‘Xi Shi’; QH, ‘Que Hao.’
Expression stability of the candidate reference genes calculated by NormFinder.
| 1 | GAPDH | 0.082 | GAPDH | 0.1 | TIP41 | 0.0 | UBC | 0.219 |
| 2 | UBC | 0.131 | TIP41 | 0.1 | EF-1α | 0.1 | TIP41 | 0.222 |
| 3 | EF-1α | 0.149 | UBC | 0.2 | UBC | 0.1 | GAPDH | 0.243 |
| 4 | PP2A | 0.236 | EF-1α | 0.3 | GAPDH | 0.3 | PP2A | 0.326 |
| 5 | TIP41 | 0.386 | PP2A | 0.4 | PP2A | 0.3 | EF-1α | 0.464 |
| 6 | ACTIN | 0.439 | CYP | 0.6 | ACTIN | 0.7 | ACTIN | 0.58 |
| 7 | α-TUB | 0.517 | ACTIN | 0.7 | α-TUB | 0.8 | CYP | 0.719 |
| 8 | β-TUB | 0.68 | α-TUB | 0.7 | CYP | 0.9 | α-TUB | 0.747 |
| 9 | CYP | 0.719 | β-TUB | 0.9 | SAMS | 1.0 | β-TUB | 0.918 |
| 10 | SAMS | 1.019 | SAMS | 1.0 | β-TUB | 1.2 | SAMS | 0.949 |
FD, ‘Feng Dan’; XS, ‘Xi Shi’; QH, ‘Que Hao.’
Expression stability of 10 candidate reference genes calculated by BestKeeper.
| 1 | PP2A | 1.42 ± 0.34 | UBC | 0.60 ± 0.10 | CYP | 1.70 ± 0.50 | UBC | 2.03 ± 0.48 |
| 2 | α-TUB | 1.96 ± 0.45 | GAPDH | 1.00 ± 0.20 | UBC | 2.40 ± 0.60 | EF-1α | 2.22 ± 0.52 |
| 3 | TIP41 | 1.75 ± 0.45 | TIP41 | 1.00 ± 0.30 | EF-1α | 2.60 ± 0.60 | TIP41 | 2.16 ± 0.56 |
| 4 | GAPDH | 2.25± 0.48 | PP2A | 1.50 ± 0.40 | TIP41 | 2.30 ± 0.60 | CYP | 2.37 ± 0.62 |
| 5 | UBC | 2.28 ± 0.53 | EF-1α | 1.70 ± 0.40 | α-TUB | 3.10 ± 0.80 | PP2A | 2.64 ± 0.66 |
| 6 | ACTIN | 2.04± 0.53 | ACTIN | 2.10 ± 0.60 | GAPDH | 3.50 ± 0.80 | GAPDH | 3.34 ± 0.74 |
| 7 | EF-1α | 2.46 ± 0.58 | α-TUB | 2.40 ± 0.60 | β-TUB | 3.30 ± 0.80 | α-TUB | 3.55 ± 0.85 |
| 8 | CYP | 2.77 ± 0.71 | CYP | 2.20 ± 0.60 | PP2A | 3.30 ± 0.80 | ACTIN | 3.17 ± 0.85 |
| 9 | SAMS | 3.67 ± 0.76 | β-TUB | 2.60 ± 0.70 | ACTIN | 3.70 ± 1.00 | β-TUB | 3.53 ± 0.86 |
| 10 | β-TUB | 3.84 ± 0.90 | SAMS | 3.20 ± 0.70 | SAMS | 5.70 ± 1.20 | SAMS | 4.37 ± 0.91 |
FD, ‘Feng Dan’; XS, ‘Xi Shi’; QH, ‘Que Hao.’
Expression stability ranking of 10 candidate reference genes.
| geNorm | GAPDH/EF-1α | UBC | PP2A | TIP41 | ACTIN | α-TUB | β-TUB | CYP | SAMS | |
| NormFinder | GAPDH | UBC | EF-1α | PP2A | TIP41 | ACTIN | α-TUB | β-TUB | CYP | SAMS |
| Bestkeeper | PP2A | α-TUB | TIP41 | GAPDH | UBC | ACTIN | EF-1α | CYP | SAMS | β-TUB |
| RefFinder | GAPDH | UBC | EF-1α | PP2A | TIP41 | α-TUB | ACTIN | β-TUB | CYP | SAMS |
| geNorm | UBC/GAPDH | TIP41 | EF-1α | PP2A | CYP | α-TUB | β-TUB | ACTIN | SAMS | |
| NormFinder | GAPDH | TIP41 | UBC | EF-1α | PP2A | CYP | ACTIN | α-TUB | β-TUB | SAMS |
| Bestkeeper | UBC | GAPDH | TIP41 | PP2A | EF-1α | ACTIN | α-TUB | CYP | β-TUB | SAMS |
| RefFinder | GAPDH | UBC | TIP41 | EF-1α | PP2A | CYP | ACTIN | α-TUB | β-TUB | SAMS |
| geNorm | UBC/EF-1α | TIP41 | GAPDH | PP2A | ACTIN | SAMS | α-TUB | CYP | β-TUB | |
| NormFinder | TIP41 | EF-1α | UBC | GAPDH | PP2A | ACTIN | α-TUB | CYP | SAMS | β-TUB |
| Bestkeeper | CYP | UBC | EF-1α | TIP41 | α-TUB | GAPDH | β-TUB | PP2A | ACTIN | SAMS |
| RefFinder | EF-1α | UBC | GAPDH | TIP41 | CYP | PP2A | ACTIN | α-TUB | SAMS | β-TUB |
| geNorm | PP2A/TIP41 | GAPDH | UBC | EF-1α | ACTIN | CYP | α-TUB | SAMS | β-TUB | |
| NormFinder | UBC | TIP41 | GAPDH | PP2A | EF-1α | ACTIN | CYP | α-TUB | β-TUB | SAMS |
| Bestkeeper | UBC | EF-1α | TIP41 | CYP | PP2A | GAPDH | α-TUB | ACTIN | β-TUB | SAMS |
| RefFinder | TIP41 | UBC | GAPDH | PP2A | EF-1α | CYP | ACTIN | α-TUB | β-TUB | SAMS |
FD, ‘Feng Dan’; XS, ‘Xi Shi’; QH, ‘Que Hao.’
Figure 3Normalized expression level of Normalized expression level of PsF3H in ‘Feng Dan’ (FD). Different reference genes (GAPDH, UBC, and SAMS) and gene combinations (GAPDH + UBC, GAPDH + SAMS, and UBC + SAMS) were used. (B) Normalized expression level of PsF3H in ‘Xi Shi’ (XS). The reference genes and gene combinations similar to ‘Feng Dan’ were used. (C) Normalized expression level of PsF3H in ‘Que Hao’ (QH). Individual genes: EF-1α, UBC and β-TUB; Combination genes: EF-1α + UBC, EF-1α + β-TUB, UBC + β-TUB.