Literature DB >> 30079349

Selection and Evaluation of Appropriate Reference Genes for RT-qPCR Normalization of Volvariella volvacea Gene Expression under Different Conditions.

Jiang Qian1, Yingnv Gao2, Ying Wáng2, Yingying Wu2, Ying Wāng2, Yucheng Zhao3, Hongyu Chen2, Dapeng Bao2, Jiyang Xu1, Xiaohong Bian1.   

Abstract

Volvariella volvacea (V. volvacea), commonly referred to as Chinese (paddy straw) mushroom, is a basidiomycete with a protein-rich volva and pileus. Selecting appropriate reference genes is a crucial step in the normalization of quantitative real-time PCR data. Therefore, 12 candidate reference genes were selected from the V. volvacea transcriptome based on previous studies and then BestKeeper, geNorm, and NormFinder were used to identify reference genes stably expressed during different developmental stages and conditions. Of the 12 candidate reference genes, SPRY domain protein (SPRYp), alpha-tubulin (TUBα), cyclophilin (CYP), L-asparaginase (L-asp), and MSF1-domain-containing protein (MSF1) were the most stably expressed under different experimental conditions, while 18S ribosomal RNA (18S), 28S ribosomal RNA (28S), and beta-actin (ACTB) were the least stably expressed. This investigation not only revealed potential factors influencing the suitability of reference genes, but also identified optimal reference genes from a pool of candidate genes under a wide range of conditions.

Entities:  

Mesh:

Year:  2018        PMID: 30079349      PMCID: PMC6069580          DOI: 10.1155/2018/6125706

Source DB:  PubMed          Journal:  Biomed Res Int            Impact factor:   3.411


1. Introduction

Quantitative real-time PCR (RT-qPCR) has emerged as a powerful and popular tool used for rapid and accurate assessment of changes in gene expression [1-3]. The reliability of gene expression measurements by RT-qPCR is strongly affected by technical factors, including template RNA quality, efficiency of complementary DNA (cDNA) synthesis, performance of primers, and normalization [4-6]. When normalizing target gene expression, selecting a stable reference gene is extremely important, especially for samples with fluctuating expression levels [7, 8]. The use of unsuitable reference genes in RT-qPCR analysis has yielded unreliable and confusing results [9, 10]. Certain reports have supported merging expression of at least three reference genes when normalizing RT-qPCR results [11, 12]. In addition, the same reference genes often cannot be used for different tissues and cells, even when the samples are derived from the same species. Therefore, selection of suitable reference genes based on a given experimental design or species is necessary [13, 14]. Volvariella volvacea (Bull.) Singer, i.e., straw mushroom or Chinese mushroom, is the world's third largest edible fungus and is a tropical and subtropical saprophytic fungus in the Pluteaceae family and Basidiomycota phylum [15-17]. This mushroom is an important healthy food source and valuable supplement with dietary and medicinal attributes due to being rich in certain nutrients, including proteins, vitamins, fats, and amino acids [18]. V. volvacea is the fastest growing species of edible fungi, requiring only 7 to 12 days from sowing to fruiting and 30 days to cultivation. In addition, it has a high economic efficiency owing to only requiring a simple planting method and ample availability of raw materials [17, 19]. Filamentous fungi are important organisms frequently studied by RT-qPCR; however, identification of suitable reference genes for RT-qPCR of fungal species has received little attention. Published reports on fungal internal control genes have mainly focused on relative expression stability [20-22] and failed to evaluate absolute expression levels. Moreover, these studies have mostly involved traditional housekeeping genes in Ascomycetes [20, 21, 23–25], with the exception of studies on Phakopsora pachyrhizi [26, 27] and Pleurotus ostreatus [28]. Little information is currently available on Basidiomycetes reference genes. Traditionally, 18S ribosomal RNA (18S), 28S ribosomal RNA (28S), β-actin (ACTB), cyclophilin (CYP), tubulin (TUBα and TUBβ1), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), and ubiquitin (UBQ), genes with housekeeping roles in basic cellular processes, have been used as reference genes [29, 30]. However, the stability of these housekeeping genes can restrict experimental design or the use of certain treatments. In addition, different materials tend to have different genes that are stable and expression levels may differ under different experimental conditions [30, 31]. In this study, we selected 12 candidate reference genes based on V. volvacea transcriptome RNA-seq datasets. The expression of these candidate reference genes following different treatments was profiled. The stability of expression of these genes was further validated using RT-qPCR and statistical algorithms, including geNorm, NormFinder, and BestKeeper. Comprehensive ranking of the stability of these reference genes under each specific experimental condition was also performed.

2. Materials and Methods

2.1. Sample Preparation and Treatment

V. volvacea homokaryon PYd15 (ACCC52631) was obtained from the Shanghai Academy of Agricultural Science and maintained on potato dextrose agar at 32°C with periodic transfers. Mycelial samples of this strain were cultivated in potato dextrose medium with shaking at 150 rpm at 32°C and incubated in the absence or presence of NaCl, CuSO4, H2O2, HCl, NaOH, heat, or cold for four days. For fruiting body production, solid cultures of the strain were cultivated on rice straw compost as described by Chen et al. [32]. Fruiting body samples were harvested at the primordium and fruiting developmental stages according to Tao et al. [29]. The entire fruiting body was harvested, chopped, and then mixed. Each sample was prepared using a mixture of multiple fruiting bodies. All samples were immediately frozen in liquid nitrogen and then RNA was extracted. Three independent biological replicates were tested for each sample and all samples in each biological replicate were harvested from a newly produced batch.

2.2. Isolation of Total RNA and cDNA Synthesis

Total RNA was extracted from samples using an RNAprep Pure Plant Kit (Tiangen Biotech, Beijing, China), treated with DNase I (Ambion, USA) to digest contaminating DNA, and then purified according to the manufacturer's protocol. The integrity of the RNA was verified by electrophoresis on 1.5% (w/v) agarose gels and the quantity and quality of the RNA were measured using a NanoDrop 2000 Spectrophotometer (NanoDrop Technologies, Thermo Scientific, USA). Only RNA samples with absorption ratios of A260/280 ranging from 1.8 to 2.2 and A260/230 >1.8 were used for cDNA synthesis. The cDNA was synthesized from 1 μg total RNA in a final volume of 20 μL using the PrimeScriptTM RT reagent Kit with gDNA Eraser (TaKaRa Bio Inc., Dalian, China) according to the manufacturer's instructions and then diluted 10-fold with nuclease-free water for RT-qPCR.

2.3. Selection and Validation of Candidate Reference Genes and Primer Design

Based on previous studies, the expression stability of the 12 candidate genes ACTB, CYP, GAPDH, TUBα, TUBβ1, UBQ, MSF1, SPRYp, L-asp, MAPK, 18S, and 28S, described in Table 1, was assessed to identify the most stable V. volvacea reference genes under different conditions. The primers were designed using Primer Premier 5.0 based on the following criteria: primer length of 20-27 bp, GC content of 45-55%, melting temperature ranging from 55 to 60°C, and amplicon length of 100-250 bp.
Table 1

Candidate reference genes evaluated for expression stability in V. volvacea.

Gene nameDescriptionAccessionPrimer sequence: forward/reverse(5′-3′)Length (bp)PCR efficiencyR2
ACTBbeta-actinKF528321TATCGATAATGGCTCCGGCATGTGC/ATACCACGCTTGGATTGGGCCTCAT165116.6290.998
CYPcyclophilinKF528322AGAATGGCTTTGGATACAAGGGGTC/CCTGAAGTTCTCATCTGCGAATCTCTC140114.9600.998
GAPDHglyceraldehyde-3-phosphate dehydrogenaseKF528323GATGCTTACGATCCCAAGTACACCG/CTACGACCACCACGCCAATCTTT191112.1991
TUBαalpha-tubulinKF528325GAGCCCAATGTTATCGATGAAGTGC/GTTCTTTGCCAATTGTGTAGTGCCC130110.3360.999
TUBβ1beta-tubulin 1KF525326GTTGATTTGGAGCCTGGAACTATGG/TCCTTCCGTATAGTGTCCTTTTGCC132128.8130.997
UBQubiquitinKF528328CAATCACCTTGGAAGTCGAGTCGTC/CTGGATGTTGTAGTCGGAAAGGGTG152107.6011
MSF1MSF1-domain-containing proteinKF528329TCTGTCGACCCCACAACTGGCATAA/TCTGTGTAGCTGGGTCGACGAATGA145111.6700.998
SPRYpSPRY domain proteinKF528330GCATTCTTCTTGATGTCGGTGGTCG/AACCCTGAAGTGTTGGATGCTCTGG130115.0970.997
LaspL-asparaginaseKF528333GTCACGTCAAGCCTCAAACCAAAAC/ATCGAATAGACTTCATACCACCTCCCC157109.3150.997
MAPKmitogen-activated protein kinaseFJ906769TCCGAACACAAGACCTATCCGACGA/ACAGTTGGCGTTCAGGGAGCAGATT163111.2010.999
18S18S ribosomal RNACCGACACGGGGAGGTAGTGACAATAA/CGCTATTGGAGCTGGAATTACCGC14997.6360.998
28S28S ribosomal RNAGAATGCAGCTCAAAATGGGGTGG/GCGACTGACTTCAAGCGTTTCCCT160111.0480.999

2.4. Amplification by RT-qPCR

Gene expression levels were examined by RT-qPCR on an Applied Biosystems 7500 Real-Time PCR system. Each reaction mixture contained 2 μl prepared cDNA template, 0.4 μl each forward, and reverse primers (10 nM), 6.8 μl of ddH2O, 0.4 μl ROX, and 10 μl of Power SYBR Green PCR Master Mix (Life Technologies, USA) in a final volume of 20 μl. Amplification cycles involved an initial denaturation step at 95°C for 5 min, followed by 40 cycles of 95°C for 15 s and 60°C for 1 min. A temperature ramp step with an initial temperature of 60°C and final temperature of 95°C was performed following the amplification for dissociation analysis. Each biological sample was tested in triplicate.

2.5. Gene Expression Stability Analysis

To analyze the expression stability of candidate reference genes, geNorm [33], NormFinder [34], and BestKeeper [35] were used based on the experimental design and manufacturers' instructions. For geNorm and NormFinder analysis, the raw Cp values were transformed into relative quantities using the formula 2-ΔCT (ΔCT = each corresponding Ct value - same gene's lowest Ct value in different samples, where Cp is an alternative designation for Ct). These values were imported into geNorm to obtain a gene expression stability value (M). Similar to geNorm, NormFinder was used to further investigate the expression stability values (M) for each gene and the pairwise variation (V) of that gene against other reference genes was evaluated. The reference gene with the highest M was considered to have the most unstable expression, while the lowest M indicated the most stable expression. BestKeeper analysis used the untransformed Cps, the coefficients of variance (CVs), and the standard deviations (SDs) of the Cps to evaluate the stability of the reference genes. BestKeeper was also used to rank candidate expression from the most to least stable. By combining these three types of Microsoft Excel-based software, the expression stability of the candidate reference genes under different conditions was easily ranked.

2.6. Statistical Analysis

The RT-qPCR data was obtained from three biological replicates tested in triplicate. Unless indicated otherwise, data are presented as mean ± standard error of the mean. Statistical analyses were performed using Student's t-test. Graphs were generated using GraphPad Prism 6 (GraphPad Software, Inc., La Jolla, CA, USA). Data analysis was performed using geNorm [33], NormFinder [34], and BestKeeper [35] according to the manufacturers' instructions.

3. Results

3.1. Selection of Candidate Reference Genes, Specificity of Amplification, and PCR Efficiency

Gene names, descriptions, accession numbers, primer sequences, PCR product lengths, PCR efficiencies, and regression coefficients for the 12 candidate genes are listed in Table 1. The gene sequences of beta-actin (ACTB), cyclophilin (CYP), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), alpha-tubulin (TUBα), beta-tubulin 1 (TUBβ1), ubiquitin (UBQ), MSF1-domain-containing protein (MSF1), SPRY domain protein (SPRYp), L-asparaginase (L-asp), mitogen-activated protein kinase (MAPK), and 18S (18S) and 28S ribosomal RNA (28S) were identified in the V. volvacea genome and confirmed by NCBI BLAST. The expression stability of these genes was assessed under various conditions, including in the presence of abiotic stresses (NaCl, CuSO4, H2O2, HCl, NaOH, heat, and cold) and different developmental stages. To calculate the amplification efficiency, standard curves were generated for the candidate genes using 10-fold serial dilutions of plasmid DNA containing the given genes. Based on the slopes of the standard curves (Fig. S3), PCR efficiencies (E) and regression coefficients (R2) were calculated and are listed in Table 1 and Fig. S3, respectively. Briefly, the R2 for all primers was >0.99 and the E ranged from 97.636% to 128.813%.

4. Expression Profiles of the Candidate Reference Genes

To evaluate the stability of the reference genes in all experimental samples, the transcript abundances of the 12 candidate reference genes were measured based on their mean cycle threshold values (Cps). The mean Cps ranged from 9 to 29 and most were between 18 and 23. Across all samples, 18S was the most abundantly expressed gene with the lowest average Cp (9.37±1.82), followed by 28S (10.96±2.04), UBQ (19.82±2.75), TUBα (21.53±3.17), GAPDH (21.69±2.16), ACTB (21.89±2.35), CYP (22.13±1.43), TUBβ1 (23.55±3.30), SPRYp (25.73±2.47), MSF1 (26.10±2.21), MAPK (27.95±2.82), and finally L-asp (29.56±2.17). These Cps, as well as gene expression variation, are presented in Figure 1 using box-plots. Larger Cp SDs indicate more variable expression. CYP displayed the least variation in gene expression (22.13±1.43), indicating that it is stably expressed under different conditions and could be the optimal reference gene. Meanwhile, MAPK had Cps ranging from 22.12 to 33.88 and should be avoided as a reference gene. In general, the Cps in box-plot form displayed the expression profiles of the reference genes and gave us a glimpse into gene stability. However, considering the complex surroundings of edible fungi, the stability of reference genes under different conditions needs to be investigated systematically (Figure 1).
Figure 1

Comparison of transcript abundances of the 12 candidate reference genes. Boxes indicate the 25th/75th percentiles, lines represent the median, and error bars represent the maximum and minimum Cp values. The 12 candidate reference genes are listed on the x-axis.

4.1. Expression Stability of Candidate Reference Genes

In order to further evaluate the expression stability of candidate reference genes, V. volvacea was exposed to different stresses (salt, oxidative, heavy metal, acid-base, and temperature stresses) or collected at different developmental growth stages. Gene expression was evaluated in these samples (three biological and technical replicates for a total of 972 Cps) using three Excel-based programs, geNorm [33], NormFinder [34], and BestKeeper [35].

4.2. Analysis Using geNorm

Analysis with geNorm measures reference gene expression stability (M) by calculating the pairwise variation for each reference gene against all other control genes and the SD of the logarithmically transformed expression ratios, where a high M means low stability [33]. For geNorm analysis, the Cps collected from the samples described above were processed on a linear scale using the ΔCp method [33]. As shown in Figure 2, different reference genes had different stabilities. The top two reference genes for RT-qPCR normalization were TUBα and UBQ for salt stress, TUBα and TUBβ1 for oxidative stress, CYP and UBQ for heavy metal stress, MSF1 and SPRYp for cold stress, UBQ and MSF1 for heat stress, SPRYp and MAPK for acid stress, MSF1 and MAPK for alkali stress, and TUBβ1 and MAPK for different developmental stages. Across all samples, TUBα and SPRYp were the most stably expressed genes (Figure 2). Therefore, these two reference genes were deemed the best reference genes for the widest range of test conditions based on this present study.
Figure 2

Expression stability of 12 Average expression stability (M) for each condition was calculated. The least stable gene with the highest M value is on the left, while the most stable gene is on the right. The treatments and group classifications are indicated in the figure.

4.3. NormFinder Analysis

NormFinder is an algorithm used to identify the optimal normalization gene in a given experimental design. Similar to geNorm, RT-qPCR data was first transformed [34]. The gene stabilities calculated using NormFinder are presented in Table 2 with gradually decreasing stabilities presented going from the top to the bottom in ranking order. UBQ, SPRYp, MSF1, 18S, and L-asp were the most stable reference genes in the presence of NaCl (as well as CuSO4 and heat), H2O2, cold (as well as acid), alkalinity, and during different developmental stages, respectively. Among the most stable reference genes, 18S had the lowest value and therefore could be considered the optimal reference gene. For all samples as a whole, SPRYp had the most stable expression. Interestingly, UBQ ranked near the top for 3 out of 8 tested conditions, similar to the outcomes of geNorm analysis (Figure 2). However, there were also slight differences between the geNorm and NormFinder results. For instance, L-asp, CYP, and MSF1 were the third, fourth, and sixth most stable reference genes in geNorm (Figure 2), but the fourth, fifth, and third in NormFinder (Table 2), respectively. Therefore, an additional method of analysis was utilized to mediate these differences.
Table 2

Expression stability of 12 V. volvacea reference genes as calculated by NormFinder.

RankNaClCuSO4H2O2HeatColdpH 4pH 9Developmental StageTotal
1UBQUBQSPRYpUBQMSF1MSF118SL-aspSPRYp
0.2440.1050.1640.0330.0700.1320.0290.2870.354
2SPRYpTUBαTUBβ1MSF1SPRYpTUBαL-aspTUBβ1TUBα
0.2530.180.2690.0830.0720.2260.1390.2880.373
3CYPSPRYpACTBCYPTUBαTUBβ1CYPMAPKMSF1
0.4250.2050.3670.3040.1040.2530.2500.3150.485
4L-aspL-aspTUBαTUBβ1ACTBACTBUBQTUBαL-asp
0.5240.2880.4030.3990.3650.3650.2670.3160.553
5TUBαTUBβ1UBQACTBL-aspMAPKMSF1GAPDHCYP
0.5340.3010.4670.4100.4000.3790.2970.3230.557
618SACTBMSF1TUBαUBQSPRYpMAPK18SGAPDH
0.6740.3960.5390.4390.4500.3900.3190.3370.752
7ACTBMSF1L-aspSPRYpCYPGAPDHTUBαSPRYpMAPK
0.7770.6230.6150.4970.4590.4360.3200.4170.826
8GAPDH18SMAPKGAPDH28S28STUBβ1MSF1UBQ
0.8030.6690.6450.6370.5500.4730.3650.4230.831
9MSF1GAPDHGAPDHL-aspMAPKCYPSPRYpCYPTUBβ1
0.8720.8050.8530.6710.6250.4800.4980.4550.838
10MAPKCYP18S18SGAPDH18SGAPDH28S28S
0.9450.8160.8720.8830.9020.4900.6010.5770.843
11TUBβ1MAPKCYP28STUBβ1UBQ28SUBQ18S
1.2210.8430.8991.1421.3150.5440.7691.2371.041
1228S28S28SMAPK18SL-aspACTBACTBACTB
1.2460.9020.9791.4681.7220.6611.0251.7021.207

4.4. BestKeeper Analysis

BestKeeper is an Excel-based tool that uses pairwise correlations to determine the stability of housekeeping genes, differentially regulated target genes, and sample integrity [35]. The CVs and SDs of the candidate reference genes were used to evaluate the stability of the candidate reference genes in all tested conditions. The gene with the lowest CV and SD was considered the most stably expressed [36]. This method differs from the geNorm and NormFinder analysis as it uses raw Cps for analysis. Similar to the results of NormFinder analysis, the CV±SD rank of the candidate genes increased gradually, suggesting the stability decreased gradually. For example, MAPK had a CV±SD value of 0.41±0.12 and was the most stable gene under H2O2-induced oxidative stress, while 18S was the least stable gene with a CV±SD of 12.98±1.15 (Figure 3). An SD>1 was considered inconsistent and any such values should be excluded [14]; therefore, none of the reference genes could be used under all conditions, as the lowest SD in this scenario was 1.16. Fortunately, in another 8 groups or experimental conditions, nearly all SD values were below 1.16, except for the most unstable one. Certain reference genes, namely, SPRYp, MAPK, and L-asp, had a tendency to be the most stable and were ranked among the top 3 reference genes. By contrast, 18S and 28S did not appear to be good reference genes.
Figure 3

Expression stability of 12 The CVs and SDs of the candidate reference genes were used to evaluate the stability of the candidate reference genes in all tested conditions. The gene with the lowest CV and SD was considered the most stably expressed, which is on the right, while the least stable gene is on the left. The treatments and group classifications are indicated in the figure.

5. Comprehensive Stability Analysis of Reference Genes

To obtain a consensus result of the most stable reference genes as recommended by the three methods, the geometric mean of three algorithms corresponding rankings for each candidate gene was calculated (Table 3 ). SPRYp, TUBα, CYP, L-asp, and MSF1 were ranked as the top five stable reference genes in the all samples stress; MSF1 also comprehensively ranked first in the Cold and Hot stress subset. In H2O2 stress subset, TUBβ1 was stably expressed most. For both the NaCl stress subset and the CuSO4 stress subset, UBQ was the most stable gene. Additionally, under acid treatment, MAPK was the best reference gene. The expression of L-asp was extremely stable under alkali stress and different developmental stages. 18S and 28S were unstably expressed in the majority of tested subsets. Owing to the geometric mean of three algorithms corresponding rankings, the results were more intuitive.
Table 3

Expression stability ranking of the 12 candidate reference genes.

Method 1 2 3 4 5 6 7 8 9 10 11 12
RANKING ORDER UNDER NaCl STRESS (BETTER-GOOD-AVERAGE)
geNorm CYPSPRYpTUBαL-aspGAPDHACTBMSF118SMAPK28STUBβ1
UBQ
NormFinder UBQSPRYpCYPL-aspTUBα18SACTBGAPDHMSF1MAPKTUBβ128S
BestKeeper SPRYpUBQMAPKL-aspMSF1CYPTUBαACTBTUBβ1GADPH18S28S
Comprehensive Ranking UBQSPRYpCYPL-aspTUBαMAPKMSF1ACTBGAPDH18STUBβ128S
RANKING ORDER UNDER H 2 O 2 STRESS (BETTER-GOOD-AVERAGE)
geNorm TUBαSPRYpACTBUBQMSF1MAPKL-aspGAPDHCYP18S28S
TUBβ1
NormFinder SPRYpTUBβ1ACTBTUBαUBQMSF1L-aspMAPKGAPDH18SCYP28S
BestKeeper MAPKMSF1UBQSPRYpTUBβ1L-aspACTBTUBαCYPGADPH28S18S
Comprehensive Ranking TUBβ1SPRYpTUBαMAPKMSF1UBQACTBL-aspGAPDHCYP18S28S
RANKING ORDER UNDER CuSO 4 STRESS (BETTER-GOOD-AVERAGE)
geNorm TUBαTUBβ1ACTBL-aspSPRYpCYPGAPDHMSF118SMAPK28S
UBQ
NormFinder UBQTUBαSPRYpL-aspTUBβ1ACTBMSF118SGAPDHCYPMAPK28S
BestKeeper SPRYpL-aspUBQTUBβ1TUBαMSF1MAPKACTBCYPGADPH18S28S
Comprehensive Ranking UBQTUBαSPRYpL-aspTUBβ1ACTBMSF1CYPGAPDHMAPK18S28S
RANKING ORDER UNDER COLD STRESS (BETTER-GOOD-AVERAGE)
geNorm MSF1TUBαACTBL-aspUBQCYP28SGAPDHMAPKTUBβ118S
SPRYp
NormFinder MSF1SPRYpTUBαACTBL-aspUBQCYP28SMAPKGAPDHTUBβ118S
BestKeeper GADPHUBQL-aspCYPMSF1SPRYpTUBαMAPKACTB28STUBβ118S
Comprehensive Ranking MSF1SPRYpTUBαUBQL-aspGAPDHACTBCY11P28SMAPKTUBβ118S
RANKING ORDER UNDER HOT STRESS (BETTER-GOOD-AVERAGE)
geNorm UBQCYPACTBTUBβ1TUBαL-aspGAPDHSPRYp18S28SMAPK
MSF1
NormFinder UBQMSF1CYPTUBβ1ACTBTUBαSPRYpGAPDHL-asp18S28SMAPK
BestKeeper MSF1TUBαL-aspGADPHSPRYpTUBβ1CYP18SACTBUBQMAPK28S
Comprehensive Ranking MSF1UBQCYPTUBαTUBβ1ACTBL-aspGAPDHSPRYp18S28SMAPK
RANKING ORDER UNDER ACID STRESS (BETTER-GOOD-AVERAGE)
geNorm SPRYpMSF1TUBβ1TUBα28S18SGAPDHACTBCYPUBQL-asp
MAPK
NormFinder MSF1TUBαTUBβ1ACTBMAPKSPRYpGAPDH28SCYP18SUBQL-asp
BestKeeper TUBβ1MAPKSPRYpMSF1TUBαL-aspCYPUBQACTBGADPH28S18S
Comprehensive Ranking MAPKMSF1TUBβ1SPRYpTUBαACTB728SGAPDHCYP18SL-aspUBQ
RANKING ORDER UNDER ALKALI STRESS (BETTER-GOOD-AVERAGE)
geNorm MSF118SL-aspCYPUBQTUBαTUBβ1SPRYpGAPDH28SACTB
MAPK
NormFinder 18SL-aspCYPUBQMSF1MAPKTUBαTUBβ1SPRYpGAPDH28SACTB
BestKeeper L-aspMSF1MAPKSPRYpGADPHCYPTUBαUBQTUBβ118SACTB28S
Comprehensive Ranking L-aspMSF1MAPK18SCYPUBQSPRYpTUBαGAPDHTUBβ128SACTB
RANKING ORDER UNDER DIFFERENT STAGES (BETTER-GOOD-AVERAGE)
geNorm TUBβ1TUBαL-asp18SGAPDHSPRYpMSF1CYP28SUBQACTB
MAPK
NormFinder L-aspTUBβ1MAPKTUBαGAPDH18SSPRYpMSF1CYP28SUBQACTB
BestKeeper SPRYpGADPHL-aspCYPUBQMAPKMSF1TUBαTUBβ118S28SACTB
Comprehensive Ranking L-aspTUBβ1MAPKSPRYpGAPDHTUBα18SCYPMSF1UBQ428SACTB
RANKING ORDER UNDER ALL SAMPLES (BETTER-GOOD-AVERAGE)
geNorm TUBαL-aspCYPGAPDHMSF1UBQ28SMAPKTUBβ118SACTB
SPRYp
NormFinder SPRYpTUBαMSF1L-aspCYPGAPDHMAPKUBQTUBβ128S18SACTB
BestKeeper CYPL-aspMSF1MAPKGADPHACTBSPRYpTUBβ1TUBαUBQ18S28S
Comprehensive Ranking SPRYpTUBαCYPL-aspMSF1GAPDHMAPKUBQTUBβ1ACTB28S18S

5.1. Optimal Number of Reference Genes for Accurate Normalization

In addition to using average pairwise expression ratios (M) to evaluate gene expression stability, geNorm can also be used to determine the optimal number of reference genes for normalization, where pairwise variation (Vn/Vn+1) between the normalization factors is calculated for all samples and 0.15 is the proposed cut-off [33]. Based on this, the pairwise variations were calculated and are listed in Figure 4. As indicated, the two most stable reference genes were sufficient for reliable normalization under all conditions, except during different developmental stages, and an additional reference gene was unnecessary. However, three genes were necessary for normalization when evaluating different developmental stages because V2/3>0.15. While including a third reference gene may increase the credibility of RT-qPCR analysis, the proposed 0.15 value should not be considered a strict cut-off in most cases, because using a combination of the two best reference genes was reliable enough for normalization [33], which is supported by the results of this study.
Figure 4

Determination of the optimal number of reference genes for normalization by pairwise variation using geNorm. Pairwise variation (Vn/n+1) analysis of the normalization factors (NFn and NFn+1) was performed for all samples. Different conditions are included and marked in square frames with different colors. “Total group” refers to all samples. V is the variation value, where >0.15 indicates that an additional reference gene does not improve normalization.

5.2. Reference Gene Validation

To evaluate the reliability of the selected reference genes, the relative expression levels of G6PDH were calculated. As depicted in Figure 5(a), enhanced expression of G6PDH was observed when normalized with the most stable reference gene, SPRYp. Meanwhile, when 28S, one of the least stable reference genes, was used, a notable reduction in expression was observed. To further evaluate the reliability of the selected reference genes, another stimulus was imposed and the three most stable reference genes were used to analyze the expression of G6PDH. The expression of G6PDH was enhanced to the same level when normalized with no significant differences between reference genes (Figure 5(b)). However, a significant difference (P<0.01) between reference genes was observed in G6PDH expression when using 28S, one of the most unstable reference genes. Using geNorm, the optimal number of reference genes for use in normalization was also investigated. While 28S was not a suitable reference gene, the accuracy of the results became satisfactory when normalization was performed using 28S in combination with other stable genes (Figure 5(c)).
Figure 5

Validation of reference gene quality. Relative (a) Expression levels were measured in the presence of (a) CuSO4 and (b) NaCl and normalized using the most and least stable reference genes. SPRYp, UBQ, and TUBα represent the three in five most stable reference genes and 28S the least stable gene in Cold and NaCl. (c) Expression levels were normalized using different combinations of reference genes. Data are displayed as mean ± standard error of the mean. Statistical analyses were performed using Student's t-test to compare two reference genes or combinations of reference genes for normalization. P<0.05; P<0.01; N.S.: no significant difference.

6. Discussion

Due to its high sensitivity and specificity, RT-qPCR is now commonly used in many laboratories for high-throughput analysis of gene transcription. Utilizing suitable reference genes is necessary to ensure the reliability and accuracy of the resulting data, as the use of unstable reference genes could yield inaccurate results. Therefore, numerous studies have been conducted to investigate reference gene stability under different conditions [29, 30, 37, 38]. In this present study, the stability of expression of 12 candidate V. volvacea reference genes was systematically analyzed using geNorm, NormFinder, and BestKeeper in the presence of salt (NaCl), oxidative (H2O2), metal (CuSO4), acid (pH 4), alkali (pH 9), cold (4°C), and heat stress (42°C), and during different developmental stages. Based on their differential stability, it was found different genes were optimal as references under different conditions. In this study, the 12 reference genes were first cloned from cDNA template, although PCR was also conducted using genomic DNA as template. As shown in Fig. S1, the primers were specific and the PCR products from different templates of different lengths. Primer pair specificity was also confirmed by melting curve analysis (Fig. S2), while amplification efficiency was calculated based on the slopes of the standard curves. The R2 >0.99 and E-values ranged from 92.34 to 109.23% (Table 1 and Fig. S3), where there was a good linear relationship based on the standard curves and acceptable PCR conditions. The expression levels of the selected genes were also investigated and the mean Cps are listed in Figure 1. The average expression levels ranged from 9.37 to 29.56, consistent with previous studies [29, 38]. Because moderate expression levels (e.g., Cp of 15 to 30) yield accurate normalization [39], the genes selected in this study were found to be sufficient for experimental needs. Low Cps correspond with high expression levels; therefore, some candidate genes in this study were abundantly distributed in V. volvacea. For instance, UBQ had a mean Cp value of 19 in V. volvacea, but a Cp of up to 27 in Ganoderma Lucidum [40, 41]. A narrow distribution range indicates low variability. Therefore, the variation in Cps observed in this study indicates CYP is the most optimal reference gene and MAPK is the least. However, these results are somewhat inconsistent with those from geNorm and NormFinder (Figure 2 and Table 2). Based on the differences in the stability and expression levels of the candidate reference genes, stability and expression analyses using different methods need to be combined. To increase accuracy when analyzing candidate gene stability, three Excel-based programs were used as previously described [29, 33–35]. Because different types of software have distinct methods of ranking candidate gene stability and there might be differences in results, at least two methods had to be used to analyze the data. In addition, because reference gene expression stability differs under different conditions, gene expression was assessed in the presence of salt, oxidative, metal, acid-base, and temperature stresses and during different developmental stages. The treatments conducted in the study included nearly all used in similar studies and, therefore, this present study was a systematic assessment of gene stability [9, 14, 29, 42]. According to the geNorm analysis, TUBα and SPRYp were the two most stable reference genes for all samples and conditions, which is consistent with the NormFinder, but not BestKeeper, results. For BestKeeper, CYP and L-asp had lower CVs and were the most stable reference genes. This may be because the geNorm and NormFinder analyses performed calculations of stability in a similar manner, while BestKeeper used CV ± SD to rank stability. This phenomenon was also reported by Zhao and Tian in their studies [14, 30]. However, there tended to be consistency when comparing the five most stable reference genes. For example, for NaCl-induced stress, geNorm, NormFinder, and BestKeeper analyses found UBQ> CYP> SPRYp> TUBα> L-asp, UBQ> SPRYp> CYP> L-asp> TUBα, and SPRYp> UBQ> MAPK> L-asp> MSF1, respectively. Furthermore, when normalized using SPRYp, UBQ, and TUBα, there were no significance differences in G6PDH expression (Figure 5(b)). Therefore, predicting reference gene stability using three types of software was sufficient and is a good strategy for selecting reference genes for normalization [43-45]. For example, when the three types of analyses were combined, SPRYp, TUBα, MSF 1, CYP, and L-asp were the most stable reference genes under the different conditions and were easily at the top of the lists in Figures 2 and 3 and Table 2, where one of these was the optimal reference gene in at least one condition. However, the candidate genes with low stability could also be used for normalization. For example, while GAPDH ranked nearly last among the candidate genes, it had a low CV and high expression under cold stress, making it a satisfactory reference under this specific condition. There have also been numerous studies indicating that GAPDH is among the most stably expressed genes and is usually used to analyze gene expression [46-49]. Overall, experimental conditions and expression abundance have equal importance when choosing a suitable reference gene. To the best of our knowledge, this present study was the second to survey V. volvacea reference gene stability and provides a basis for further exploration of metabolism and regulation in response to environmental stresses. This study focused on different developmental stages and abiotic stresses (NaCl, CuSO4, H2O2, HCl, NaOH, heat, and cold), while Tao et al. [29] performed the first study on V. volvacea internal control genes for different strains, fruiting body developmental stages, and growth stages. Interestingly, the results of these two studies were very similar as SPRYp, TUBα, CYP, L-asp, and MSF1 were the most stable reference genes in this present study, while SPRYp, Ras, Vps 26, and ACTB were most stable in Tao's study. Ras and Vps 26 were not included in the 12 candidate genes we selected, but L-asp, TUBα, and MSF1, which were assessed in this study, ranked among the top in Tao's study, supporting our results. Conversely, ACTB was among the least stable reference genes in our study, which is inconsistent with Tao et al. [29]. This may be a result of different experimental conditions, because no reference gene was universally stable. Ultimately, the choice of reference gene will depend on the specific set of experiments, to which our efforts are complementary. To determine how many reference genes are needed for accurate analysis, “pairwise variation (V)” was calculated in geNorm. A V score of 0.15 was used as a cut-off according to the manufacturer's instructions, below which the inclusion of an additional reference gene was not required [33]. Based on this, the optimal numbers of reference genes were calculated and are listed in Figure 3. When analyzing the 9 experimental groups, 7 had a V score <0.15, indicating there was no need for the use of a third reference gene. This is consistent with work by Zhao et al. [14], who saw no notable differences when two or three reference genes were used for normalization, and Ma et al. [9], who evaluated different combinations of reference genes for normalization. However, when the V score >0.15, an additional reference gene is recommended. As previously shown, when one of least stably expressed reference genes, ACTB, was combined with other stable genes, the results appeared credible [50, 51]. This also indicates that the proposed V of 0.15 value should not be considered a strict cut-off [33], which is in line with several reports that used higher V values [39, 52].

7. Conclusions

When characterizing gene expression, the most commonly used method is RT-qPCR, where a suitable reference gene is necessary for normalization of results. In this present study, 12 candidate reference genes in V. volvacea were investigated to determine the most stably expressed under different conditions. Analysis of gene expression stability using geNorm, NormFinder, and BestKepper revealed that SPRYp, TUBα, CYP, L-asp, and MSF1 were the most stably expressed reference genes and were optimal for normalization (Table 3). By contrast, 18S and 28S were the least stably expressed genes. The optimal number of reference genes for normalization was also calculated based on pairwise variation (Vn/Vn+1) using geNorm and it was found the two most stable reference genes were sufficient for normalization under most conditions. Since gene expression varies in different experiment conditions, this study is the first survey of reference gene stability and providing a basis for further research in V. volvacea, it also provides guidelines for obtaining more accurate RT-qPCR results for other edible fungal species.
  47 in total

1.  How to do successful gene expression analysis using real-time PCR.

Authors:  Stefaan Derveaux; Jo Vandesompele; Jan Hellemans
Journal:  Methods       Date:  2009-12-05       Impact factor: 3.608

2.  Evaluation of internal control genes for qRT-PCR normalization in tissues and cell culture for antiviral studies of grass carp (Ctenopharyngodon idella).

Authors:  Jianguo Su; Rongfang Zhang; Jie Dong; Chunrong Yang
Journal:  Fish Shellfish Immunol       Date:  2011-01-19       Impact factor: 4.581

3.  The Accordant Trend of Both Parameters (rgs Expression and cAMP Content) Follows the Pattern of Development of Fruiting Body in Volvariella volvacea.

Authors:  Yuanping Lu; Lingdan Lian; Lixian Guo; Bin Xie; Wei Wang; Bingzhi Chen; Arend Frans van Peer; Shaojie Li; Taju Wu; Baogui Xie
Journal:  Curr Microbiol       Date:  2015-08-12       Impact factor: 2.188

4.  Evaluation of reference genes for real-time quantitative PCR studies in Candida glabrata following azole treatment.

Authors:  Qingdi Quentin Li; Jeff Skinner; John E Bennett
Journal:  BMC Mol Biol       Date:  2012-06-29       Impact factor: 2.946

5.  Selection of suitable reference genes for qPCR normalization under abiotic stresses and hormone stimuli in carrot leaves.

Authors:  Chang Tian; Qian Jiang; Feng Wang; Guang-Long Wang; Zhi-Sheng Xu; Ai-Sheng Xiong
Journal:  PLoS One       Date:  2015-02-06       Impact factor: 3.240

6.  Validation of suitable reference genes for gene expression analysis in the halophyte Salicornia europaea by real-time quantitative PCR.

Authors:  Xinlong Xiao; Jinbiao Ma; Junru Wang; Xiaomeng Wu; Pengbo Li; Yinan Yao
Journal:  Front Plant Sci       Date:  2015-01-21       Impact factor: 5.753

7.  Selection and evaluation of reference genes for expression studies with quantitative PCR in the model fungus Neurospora crassa under different environmental conditions in continuous culture.

Authors:  Kathleen D Cusick; Lisa A Fitzgerald; Russell K Pirlo; Allison L Cockrell; Emily R Petersen; Justin C Biffinger
Journal:  PLoS One       Date:  2014-12-04       Impact factor: 3.240

8.  Identification of novel and robust internal control genes from Volvariella volvacea that are suitable for RT-qPCR in filamentous fungi.

Authors:  Yongxin Tao; Arend Frans van Peer; Qianhui Huang; Yanping Shao; Lei Zhang; Bin Xie; Yuji Jiang; Jian Zhu; Baogui Xie
Journal:  Sci Rep       Date:  2016-07-12       Impact factor: 4.379

9.  Validation of potential reference genes for qPCR in maize across abiotic stresses, hormone treatments, and tissue types.

Authors:  Yueai Lin; Chenlu Zhang; Hai Lan; Shibin Gao; Hailan Liu; Jian Liu; Moju Cao; Guangtang Pan; Tingzhao Rong; Suzhi Zhang
Journal:  PLoS One       Date:  2014-05-08       Impact factor: 3.240

10.  Selection of Reference Genes for Gene Expression Normalization in Peucedanum praeruptorum Dunn under Abiotic Stresses, Hormone Treatments and Different Tissues.

Authors:  Yucheng Zhao; Jun Luo; Sheng Xu; Wei Wang; Tingting Liu; Chao Han; Yijun Chen; Lingyi Kong
Journal:  PLoS One       Date:  2016-03-29       Impact factor: 3.240

View more
  5 in total

Review 1.  The NADPH oxidase in Volvariella volvacea and its differential expression in response to mycelial ageing and mechanical injury.

Authors:  Jun-Jie Yan; Zong-Jun Tong; Yuan-Yuan Liu; Zi-Yan Lin; Ying Long; Xing Han; Wei-Nan Xu; Qian-Hui Huang; Yong-Xin Tao; Bao-Gui Xie
Journal:  Braz J Microbiol       Date:  2019-10-30       Impact factor: 2.476

2.  Selection of suitable reference genes for qRT-PCR analysis of Begonia semperflorens under stress conditions.

Authors:  Yanman Li; Ying Qu; Yang Wang; Xue Bai; Geng Tian; Zhirou Liu; Yonghua Li; Kaiming Zhang
Journal:  Mol Biol Rep       Date:  2019-08-30       Impact factor: 2.316

3.  Selection and Validation of Reference Genes for qRT-PCR in Lentinula edodes under Different Experimental Conditions.

Authors:  Yi Luo; Gangzheng Wang; Chen Wang; Yuhua Gong; Yinbing Bian; Yan Zhou
Journal:  Genes (Basel)       Date:  2019-08-27       Impact factor: 4.096

4.  Selection and evaluation of appropriate reference genes for RT-qPCR based expression analysis in Candida tropicalis following azole treatment.

Authors:  Saikat Paul; Shreya Singh; Arunaloke Chakrabarti; Shivaprakash M Rudramurthy; Anup K Ghosh
Journal:  Sci Rep       Date:  2020-02-06       Impact factor: 4.379

5.  Reference genes for gene expression analysis in the fungal pathogen Neonectria ditissima and their use demonstrating expression up-regulation of candidate virulence genes.

Authors:  Liz M Florez; Reiny W A Scheper; Brent M Fisher; Paul W Sutherland; Matthew D Templeton; Joanna K Bowen
Journal:  PLoS One       Date:  2020-11-13       Impact factor: 3.240

  5 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.