| Literature DB >> 30079349 |
Jiang Qian1, Yingnv Gao2, Ying Wáng2, Yingying Wu2, Ying Wāng2, Yucheng Zhao3, Hongyu Chen2, Dapeng Bao2, Jiyang Xu1, Xiaohong Bian1.
Abstract
Volvariella volvacea (V. volvacea), commonly referred to as Chinese (paddy straw) mushroom, is a basidiomycete with a protein-rich volva and pileus. Selecting appropriate reference genes is a crucial step in the normalization of quantitative real-time PCR data. Therefore, 12 candidate reference genes were selected from the V. volvacea transcriptome based on previous studies and then BestKeeper, geNorm, and NormFinder were used to identify reference genes stably expressed during different developmental stages and conditions. Of the 12 candidate reference genes, SPRY domain protein (SPRYp), alpha-tubulin (TUBα), cyclophilin (CYP), L-asparaginase (L-asp), and MSF1-domain-containing protein (MSF1) were the most stably expressed under different experimental conditions, while 18S ribosomal RNA (18S), 28S ribosomal RNA (28S), and beta-actin (ACTB) were the least stably expressed. This investigation not only revealed potential factors influencing the suitability of reference genes, but also identified optimal reference genes from a pool of candidate genes under a wide range of conditions.Entities:
Mesh:
Year: 2018 PMID: 30079349 PMCID: PMC6069580 DOI: 10.1155/2018/6125706
Source DB: PubMed Journal: Biomed Res Int Impact factor: 3.411
Candidate reference genes evaluated for expression stability in V. volvacea.
| Gene name | Description | Accession | Primer sequence: forward/reverse(5′-3′) | Length (bp) | PCR efficiency | R2 |
|---|---|---|---|---|---|---|
| ACTB | beta-actin | KF528321 | TATCGATAATGGCTCCGGCATGTGC/ATACCACGCTTGGATTGGGCCTCAT | 165 | 116.629 | 0.998 |
| CYP | cyclophilin | KF528322 | AGAATGGCTTTGGATACAAGGGGTC/CCTGAAGTTCTCATCTGCGAATCTCTC | 140 | 114.960 | 0.998 |
| GAPDH | glyceraldehyde-3-phosphate dehydrogenase | KF528323 | GATGCTTACGATCCCAAGTACACCG/CTACGACCACCACGCCAATCTTT | 191 | 112.199 | 1 |
| TUB | alpha-tubulin | KF528325 | GAGCCCAATGTTATCGATGAAGTGC/GTTCTTTGCCAATTGTGTAGTGCCC | 130 | 110.336 | 0.999 |
| TUB | beta-tubulin 1 | KF525326 | GTTGATTTGGAGCCTGGAACTATGG/TCCTTCCGTATAGTGTCCTTTTGCC | 132 | 128.813 | 0.997 |
| UBQ | ubiquitin | KF528328 | CAATCACCTTGGAAGTCGAGTCGTC/CTGGATGTTGTAGTCGGAAAGGGTG | 152 | 107.601 | 1 |
| MSF1 | MSF1-domain-containing protein | KF528329 | TCTGTCGACCCCACAACTGGCATAA/TCTGTGTAGCTGGGTCGACGAATGA | 145 | 111.670 | 0.998 |
| SPRYp | SPRY domain protein | KF528330 | GCATTCTTCTTGATGTCGGTGGTCG/AACCCTGAAGTGTTGGATGCTCTGG | 130 | 115.097 | 0.997 |
| Lasp | L-asparaginase | KF528333 | GTCACGTCAAGCCTCAAACCAAAAC/ATCGAATAGACTTCATACCACCTCCCC | 157 | 109.315 | 0.997 |
| MAPK | mitogen-activated protein kinase | FJ906769 | TCCGAACACAAGACCTATCCGACGA/ACAGTTGGCGTTCAGGGAGCAGATT | 163 | 111.201 | 0.999 |
| 18S | 18S ribosomal RNA | ∖ | CCGACACGGGGAGGTAGTGACAATAA/CGCTATTGGAGCTGGAATTACCGC | 149 | 97.636 | 0.998 |
| 28S | 28S ribosomal RNA | ∖ | GAATGCAGCTCAAAATGGGGTGG/GCGACTGACTTCAAGCGTTTCCCT | 160 | 111.048 | 0.999 |
Figure 1Comparison of transcript abundances of the 12 candidate reference genes. Boxes indicate the 25th/75th percentiles, lines represent the median, and error bars represent the maximum and minimum Cp values. The 12 candidate reference genes are listed on the x-axis.
Figure 2Expression stability of 12 Average expression stability (M) for each condition was calculated. The least stable gene with the highest M value is on the left, while the most stable gene is on the right. The treatments and group classifications are indicated in the figure.
Expression stability of 12 V. volvacea reference genes as calculated by NormFinder.
| Rank | NaCl | CuSO4 | H2O2 | Heat | Cold | pH 4 | pH 9 | Developmental Stage | Total |
|---|---|---|---|---|---|---|---|---|---|
| 1 | UBQ | UBQ | SPRYp | UBQ | MSF1 | MSF1 | 18S | L-asp | SPRYp |
| 0.244 | 0.105 | 0.164 | 0.033 | 0.070 | 0.132 | 0.029 | 0.287 | 0.354 | |
| 2 | SPRYp | TUB | TUB | MSF1 | SPRYp | TUB | L-asp | TUB | TUB |
| 0.253 | 0.18 | 0.269 | 0.083 | 0.072 | 0.226 | 0.139 | 0.288 | 0.373 | |
| 3 | CYP | SPRYp | ACTB | CYP | TUB | TUB | CYP | MAPK | MSF1 |
| 0.425 | 0.205 | 0.367 | 0.304 | 0.104 | 0.253 | 0.250 | 0.315 | 0.485 | |
| 4 | L-asp | L-asp | TUB | TUB | ACTB | ACTB | UBQ | TUB | L-asp |
| 0.524 | 0.288 | 0.403 | 0.399 | 0.365 | 0.365 | 0.267 | 0.316 | 0.553 | |
| 5 | TUB | TUB | UBQ | ACTB | L-asp | MAPK | MSF1 | GAPDH | CYP |
| 0.534 | 0.301 | 0.467 | 0.410 | 0.400 | 0.379 | 0.297 | 0.323 | 0.557 | |
| 6 | 18S | ACTB | MSF1 | TUB | UBQ | SPRYp | MAPK | 18S | GAPDH |
| 0.674 | 0.396 | 0.539 | 0.439 | 0.450 | 0.390 | 0.319 | 0.337 | 0.752 | |
| 7 | ACTB | MSF1 | L-asp | SPRYp | CYP | GAPDH | TUB | SPRYp | MAPK |
| 0.777 | 0.623 | 0.615 | 0.497 | 0.459 | 0.436 | 0.320 | 0.417 | 0.826 | |
| 8 | GAPDH | 18S | MAPK | GAPDH | 28S | 28S | TUB | MSF1 | UBQ |
| 0.803 | 0.669 | 0.645 | 0.637 | 0.550 | 0.473 | 0.365 | 0.423 | 0.831 | |
| 9 | MSF1 | GAPDH | GAPDH | L-asp | MAPK | CYP | SPRYp | CYP | TUB |
| 0.872 | 0.805 | 0.853 | 0.671 | 0.625 | 0.480 | 0.498 | 0.455 | 0.838 | |
| 10 | MAPK | CYP | 18S | 18S | GAPDH | 18S | GAPDH | 28S | 28S |
| 0.945 | 0.816 | 0.872 | 0.883 | 0.902 | 0.490 | 0.601 | 0.577 | 0.843 | |
| 11 | TUB | MAPK | CYP | 28S | TUB | UBQ | 28S | UBQ | 18S |
| 1.221 | 0.843 | 0.899 | 1.142 | 1.315 | 0.544 | 0.769 | 1.237 | 1.041 | |
| 12 | 28S | 28S | 28S | MAPK | 18S | L-asp | ACTB | ACTB | ACTB |
| 1.246 | 0.902 | 0.979 | 1.468 | 1.722 | 0.661 | 1.025 | 1.702 | 1.207 |
Figure 3Expression stability of 12 The CVs and SDs of the candidate reference genes were used to evaluate the stability of the candidate reference genes in all tested conditions. The gene with the lowest CV and SD was considered the most stably expressed, which is on the right, while the least stable gene is on the left. The treatments and group classifications are indicated in the figure.
Expression stability ranking of the 12 candidate reference genes.
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
| ||||||||||||
|
| CYP | SPRYp | TUB | L-asp | GAPDH | ACTB | MSF1 | 18S | MAPK | 28S | TUB | |
| UBQ | ||||||||||||
|
| UBQ | SPRYp | CYP | L-asp | TUB | 18S | ACTB | GAPDH | MSF1 | MAPK | TUB | 28S |
|
| SPRYp | UBQ | MAPK | L-asp | MSF1 | CYP | TUB | ACTB | TUB | GADPH | 18S | 28S |
|
| UBQ | SPRYp | CYP | L-asp | TUB | MAPK | MSF1 | ACTB | GAPDH | 18S | TUB | 28S |
|
| ||||||||||||
|
| TUB | SPRYp | ACTB | UBQ | MSF1 | MAPK | L-asp | GAPDH | CYP | 18S | 28S | |
| TUB | ||||||||||||
|
| SPRYp | TUB | ACTB | TUB | UBQ | MSF1 | L-asp | MAPK | GAPDH | 18S | CYP | 28S |
|
| MAPK | MSF1 | UBQ | SPRYp | TUB | L-asp | ACTB | TUB | CYP | GADPH | 28S | 18S |
|
| TUB | SPRYp | TUB | MAPK | MSF1 | UBQ | ACTB | L-asp | GAPDH | CYP | 18S | 28S |
|
| ||||||||||||
|
| TUB | TUB | ACTB | L-asp | SPRYp | CYP | GAPDH | MSF1 | 18S | MAPK | 28S | |
| UBQ | ||||||||||||
|
| UBQ | TUB | SPRYp | L-asp | TUB | ACTB | MSF1 | 18S | GAPDH | CYP | MAPK | 28S |
|
| SPRYp | L-asp | UBQ | TUB | TUB | MSF1 | MAPK | ACTB | CYP | GADPH | 18S | 28S |
|
| UBQ | TUB | SPRYp | L-asp | TUB | ACTB | MSF1 | CYP | GAPDH | MAPK | 18S | 28S |
|
| ||||||||||||
|
| MSF1 | TUB | ACTB | L-asp | UBQ | CYP | 28S | GAPDH | MAPK | TUB | 18S | |
| SPRYp | ||||||||||||
|
| MSF1 | SPRYp | TUB | ACTB | L-asp | UBQ | CYP | 28S | MAPK | GAPDH | TUB | 18S |
|
| GADPH | UBQ | L-asp | CYP | MSF1 | SPRYp | TUB | MAPK | ACTB | 28S | TUB | 18S |
|
| MSF1 | SPRYp | TUB | UBQ | L-asp | GAPDH | ACTB | CY11P | 28S | MAPK | TUB | 18S |
|
| ||||||||||||
|
| UBQ | CYP | ACTB | TUB | TUB | L-asp | GAPDH | SPRYp | 18S | 28S | MAPK | |
| MSF1 | ||||||||||||
|
| UBQ | MSF1 | CYP | TUB | ACTB | TUB | SPRYp | GAPDH | L-asp | 18S | 28S | MAPK |
|
| MSF1 | TUB | L-asp | GADPH | SPRYp | TUB | CYP | 18S | ACTB | UBQ | MAPK | 28S |
|
| MSF1 | UBQ | CYP | TUB | TUB | ACTB | L-asp | GAPDH | SPRYp | 18S | 28S | MAPK |
|
| ||||||||||||
|
| SPRYp | MSF1 | TUB | TUB | 28S | 18S | GAPDH | ACTB | CYP | UBQ | L-asp | |
| MAPK | ||||||||||||
|
| MSF1 | TUB | TUB | ACTB | MAPK | SPRYp | GAPDH | 28S | CYP | 18S | UBQ | L-asp |
|
| TUB | MAPK | SPRYp | MSF1 | TUB | L-asp | CYP | UBQ | ACTB | GADPH | 28S | 18S |
|
| MAPK | MSF1 | TUB | SPRYp | TUB | ACTB7 | 28S | GAPDH | CYP | 18S | L-asp | UBQ |
|
| ||||||||||||
|
| MSF1 | 18S | L-asp | CYP | UBQ | TUB | TUB | SPRYp | GAPDH | 28S | ACTB | |
| MAPK | ||||||||||||
|
| 18S | L-asp | CYP | UBQ | MSF1 | MAPK | TUB | TUB | SPRYp | GAPDH | 28S | ACTB |
|
| L-asp | MSF1 | MAPK | SPRYp | GADPH | CYP | TUB | UBQ | TUB | 18S | ACTB | 28S |
|
| L-asp | MSF1 | MAPK | 18S | CYP | UBQ | SPRYp | TUB | GAPDH | TUB | 28S | ACTB |
|
| ||||||||||||
|
| TUB | TUB | L-asp | 18S | GAPDH | SPRYp | MSF1 | CYP | 28S | UBQ | ACTB | |
| MAPK | ||||||||||||
|
| L-asp | TUB | MAPK | TUB | GAPDH | 18S | SPRYp | MSF1 | CYP | 28S | UBQ | ACTB |
|
| SPRYp | GADPH | L-asp | CYP | UBQ | MAPK | MSF1 | TUB | TUB | 18S | 28S | ACTB |
|
| L-asp | TUB | MAPK | SPRYp | GAPDH | TUB | 18S | CYP | MSF1 | UBQ4 | 28S | ACTB |
|
| ||||||||||||
|
| TUB | L-asp | CYP | GAPDH | MSF1 | UBQ | 28S | MAPK | TUB | 18S | ACTB | |
| SPRYp | ||||||||||||
|
| SPRYp | TUB | MSF1 | L-asp | CYP | GAPDH | MAPK | UBQ | TUB | 28S | 18S | ACTB |
|
| CYP | L-asp | MSF1 | MAPK | GADPH | ACTB | SPRYp | TUB | TUB | UBQ | 18S | 28S |
|
| SPRYp | TUB | CYP | L-asp | MSF1 | GAPDH | MAPK | UBQ | TUB | ACTB | 28S | 18S |
Figure 4Determination of the optimal number of reference genes for normalization by pairwise variation using geNorm. Pairwise variation (Vn/n+1) analysis of the normalization factors (NFn and NFn+1) was performed for all samples. Different conditions are included and marked in square frames with different colors. “Total group” refers to all samples. V is the variation value, where >0.15 indicates that an additional reference gene does not improve normalization.
Figure 5Validation of reference gene quality. Relative (a) Expression levels were measured in the presence of (a) CuSO4 and (b) NaCl and normalized using the most and least stable reference genes. SPRYp, UBQ, and TUBα represent the three in five most stable reference genes and 28S the least stable gene in Cold and NaCl. (c) Expression levels were normalized using different combinations of reference genes. Data are displayed as mean ± standard error of the mean. Statistical analyses were performed using Student's t-test to compare two reference genes or combinations of reference genes for normalization. P<0.05; P<0.01; N.S.: no significant difference.