Literature DB >> 25884297

Microsatellite instability and mutations in BRAF and KRAS are significant predictors of disseminated disease in colon cancer.

Helgi Birgisson1, Karolina Edlund2, Ulrik Wallin3, Lars Påhlman4, Hanna Göransson Kultima5, Markus Mayrhofer6, Patrick Micke7, Anders Isaksson8, Johan Botling9, Bengt Glimelius10, Magnus Sundström11.   

Abstract

BACKGROUND: Molecular alterations are well studied in colon cancer, however there is still need for an improved understanding of their prognostic impact. This study aims to characterize colon cancer with regard to KRAS, BRAF, and PIK3CA mutations, microsatellite instability (MSI), and average DNA copy number, in connection with tumour dissemination and recurrence in patients with colon cancer.
METHODS: Disease stage II-IV colon cancer patients (n = 121) were selected. KRAS, BRAF, and PIK3CA mutation status was assessed by pyrosequencing and MSI was determined by analysis of mononucleotide repeat markers. Genome-wide average DNA copy number and allelic imbalance was evaluated by SNP array analysis.
RESULTS: Patients with mutated KRAS were more likely to experience disease dissemination (OR 2.75; 95% CI 1.28-6.04), whereas the opposite was observed for patients with BRAF mutation (OR 0.34; 95% 0.14-0.81) or MSI (OR 0.24; 95% 0.09-0.64). Also in the subset of patients with stage II-III disease, both MSI (OR 0.29; 95% 0.10-0.86) and BRAF mutation (OR 0.32; 95% 0.16-0.91) were related to lower risk of distant recurrence. However, average DNA copy number and PIK3CA mutations were not associated with disease dissemination.
CONCLUSIONS: The present study revealed that tumour dissemination is less likely to occur in colon cancer patients with MSI and BRAF mutation, whereas the presence of a KRAS mutation increases the likelihood of disseminated disease.

Entities:  

Mesh:

Substances:

Year:  2015        PMID: 25884297      PMCID: PMC4364587          DOI: 10.1186/s12885-015-1144-x

Source DB:  PubMed          Journal:  BMC Cancer        ISSN: 1471-2407            Impact factor:   4.430


Background

Colorectal cancer (CRC) is the third most common cancer and the second most common cause of cancer-related death in Sweden [1]. Metastatic disease is present at diagnosis in 20-25% of patients and another 20-25% develops metastases in the course of the follow-up time. As local disease nowadays rarely is a cause of death in cancer of the colon and rectum [2], tumour cell dissemination may be considered a prerequisite for tumour death. To be able to improve survival by more appropriate treatment selection in primary disease, focus must therefore be on the identification of tumours with the capability to disseminate, whether clinically apparent at diagnosis (stage IV) or detected during follow-up after curative surgery (stages II and III). The TNM (tumour-node-metastasis) classification based on radiologic and histopathological evaluation is currently the most reliable method for treatment selection and prognostic prediction in patients with CRC [3]. Patients curatively operated for stage II disease have around 15% risk of developing disease recurrence [4] if staged appropriately, operated according to modern principles and assessed with high quality pathology. Due to low risk of recurrence, these patients are regularly not given adjuvant chemotherapy, unless they are considered to be at “high risk” due to poor prognostic features such as T4, emergency operation or vascular invasion [5,6]. Patients with stage III disease have approximately a 40% risk to develop recurrent disease. Adjuvant therapy with 5-fluorouracil (5-FU)/leucovorin in patients with stage III disease reduces this risk by approximately 30%. If 5-FU/leucovorin is combined with oxaliplatin, the recurrence rate is further decreased with 15-20% [7]. Obviously, a subgroup of patients with stage III disease is given adjuvant chemotherapy with limited survival benefits. At the same time, there is an under-treatment of the subset of stage II patients that eventually develop recurrent disease. CRC is heterogeneous with regard to molecular alterations and characterization of the molecular aetiology of sporadic CRC has identified different oncogenic pathways. The two major genomic instability pathways are the “traditional” chromosomal instability (CIN), or aneuploidy pathway, and the microsatellite instability (MSI) pathway [8-11]. These two pathways have been described as mutually exclusive, as the CIN tumours are microsatellite stable (MSS) [12]. CIN positive tumours constitute 65-70% of CRCs and have been associated with an aggressive clinical behaviour and distal location [10,13]. Tumours with CIN usually have large genomic aberrations that lead to higher average DNA copy number compared with MSI tumours [14]. Absolute DNA copy numbers can be assayed by SNP arrays and subsequent allele-specific analysis [15]. The MSI phenotype is the result of gene silencing of DNA mismatch repair (MMR) genes that cause accumulation of mutations in tumour suppressor genes and oncogenes. The MSI phenotype is therefore also referred to as the MMR deficient or mutator phenotype. CRC with MSI accounts for approximately 15% of sporadic CRCs and is characterized by a more proximal location, mucinous differentiation, near-diploid chromosome set and better prognosis compared to MMR proficient, frequently CIN positive, CRC [16-19]. Some CRC tumours also display epigenetic instability manifested as CpG island methylator phenotype (CIMP) or global DNA hypomethylation. CIMP-positive tumours are strongly associated with the MSI phenotype and the presence of BRAF mutations [20,21]. An additional CRC subtype comprises MSS CIN negative (diploid) tumours that also frequently are CIMP positive and BRAF mutated [12]. CRC tumourigenesis is also dependent on mutations in genes that deregulate intracellular signaling pathways, e.g. the EGFR mitogen-activated protein kinase (MAPK) and phosphatidylinositol 3-kinase (PI3K) pathways. Frequently mutated genes in these pathways are KRAS, BRAF and PIK3CA. Similar to CIN and MSI, these genes have been suggested as prognostic biomarkers, but although examined in many previous studies, the precise prognostic role of mutations in these genes remains unclear [22,23]. Based on the increased molecular knowledge of CRC, a classification of sporadic CRC into five different entities has been proposed [12]. However, the clinical value of these entities is still unclear and conflicting data exists among studies, probably a result of the heterogeneity of CRC resulting in overlap between the different pathways involved in CRC tumourigenesis. In order to better understand tumour cell characteristics in primary colon cancers associated with tumour cell dissemination, and disease recurrence, the aim of this study was to characterize colon tumours, stratified by tumour stage and presence or development of metastatic disease, with regard to KRAS, BRAF, and PIK3CA mutations, MSI, and average DNA copy number.

Methods

Patient material and study design

Fresh frozen tumour material was available for molecular analysis from over 600 patients with primary colon and rectal cancer operated at the Uppsala University Hospital, Sweden, between 1987 and 2006, or at the Central District Hospital in Västerås, Sweden, between 2000 and 2003. From this population patients with stage II and III tumours, with and without recurrent disease, and patients with stage IV disease at diagnosis, were identified. To enable comparisons of tumours with and without metastatic capability, patients with synchronous metastases at diagnosis were considered equivalent to those with metastases appearing during the follow-up period, as both synchronous and metachronous metastases develop from the primary tumour and may indicate the presence of certain traits. The terms “non-disseminated” was used for patients with stage II and III tumours without recurrence and “disseminated” for stages II and III with recurrence together with stage IV. Only colon cancers were selected as rectal cancers are often treated preoperatively with radiation and/or chemotherapy and rectal cancer can differ from colon cancer in the mutation profile. To ensure the high quality of the study population, only radiologically adequately staged patients and those operated abdominally according to either right-sided or left-sided hemicolectomy or sigmoidectomy were included. No preoperative therapy was allowed and the surgery was required to be radical (R0). Patients with stage II disease were only included if at least 10 lymph nodes were analyzed. Moreover, patients with stages II-III, with no disease recurrence were only included if the follow-up time was longer than 5 years. Haematoxylin-eosin stained tissue sections were prepared from OCT-embedded fresh-frozen specimens using a cryostat and the CryoJane tape-transfer system (Instrumedics, Richmond, IL). The tumour tissue sections were examined by a trained pathologist to ensure that only representative samples containing more than 40% tumour cells were included. Based on the above-mentioned criteria, tumour tissue from 121 patients was selected for analysis; 25 with disease stage II and 28 with stage III without disease recurrence; 15 with stage II and 27 with stage III with distant recurrence and 26 with stage IV disease. Totally 68 patients were therefore regarded as disseminated and 53 as non-disseminated. The stage II group with disease recurrence had to be limited to 15 cases as no more eligible patients could be identified; otherwise the aim was to include at least 25 patients in each group. Basic clinical and histopathological information of the selected cohort is given in Additional file 1: Table S1.

DNA extraction

Genomic DNA was extracted from 5-10 frozen tissue sections (10 μm) using the QIAamp DNA Mini Kit (Qiagen GmbH, Hilden, Germany) according to the manufacturer’s recommendations. The purityand concentration of the extracted DNA was assessed using a NanoDrop instrument (Thermo Scientific, Wilmington, DE).

Pyrosequencing

The PyroMark Q24 BRAF and KRAS v2.0 assays (Qiagen) were used to detect mutations in BRAF (codon 600) and KRAS (codons 12, 13 and 61 in exons 2 and 3) according to the manufacturer’s recommendations. Novel pyrosequencing assays were developed for the analysis of known PIK3CA mutation hotspots in exon 9 (codons 542, 545, and 546) and exon 20 (codons 1043 and 1047). PCR primers and sequencing primers were designed using the PyroMark Assay Design 2.0 software (Qiagen). Forward (F) and reverse (R) PCR primers and sequencing primers (S) for PIK3CA were as follows (5’-3’): 9-F CAGCTCAAAGCAATTTCTACACG (biotin); 9-R CTCCATTTTAGCACTTACCTGTGAC; 9-S TG ACTCCATAGAAAATCTTT; 20-F GCAAGAGGCTTTGGAGTATTTC (biotin); 20-R AG ATCCAATCATTTTTGTTGTC; 20-S TTTTGTTGTCCAGCC. Briefly, ten nanogram of genomic DNA was used in 25 μl PCR reactions. Eight (PIK3CA) or 20 μl (BRAF and KRAS) of the PCR product was subsequently subjected to pyrosequencing using Streptavidin Sepharose High Performance (GE Healthcare, Uppsala, Sweden), PyroMark Gold Q96 reagents, PyroMark Q24 1.0.9 software, and a Q24 instrument (QIAGEN). All identified mutations were confirmed in a second analysis.

MSI analysis

Determination of MSI status was performed using MSI Analysis System, version 1.2 (Promega, Madison, WI) with 6 ng genomic DNA and analysis of five mononucleotide repeat markers (BAT25, BAT26, NR-21, NR-24 and MONO-27). Analyses were performed on a 3130xl genetic analyzer (Applied Biosystems, Foster City, CA). According to guidelines from a National Cancer Institute workshop in 1997, samples were denoted MSI-High (MSI-H) if two or more of the five markers show instability, MSI-Low (MSI-L) if only one marker shows instability and microsatellite stable (MSS) if no markers display instability. In this study, MSI-L and MSS was grouped together in the interpretation of MSI data, therefore MSI refers to MSI-H and MSS refers to both MSS and MSI-L.

SNP array analysis

Array experiments were performed according to the standard protocols for AffymetrixGeneChip® Mapping SNP 6.0 arrays (AffymetrixCytogenetics Copy Number Assay User Guide (P/N 702607 Rev2.), Affymetrix Inc., Santa Clara, CA). Briefly, 500 ng total genomicDNA was digested with a restriction enzyme (Nsp, Sty), ligated to an appropriate adapter for the enzyme, and subjected to PCR amplification using a single primer. After digestionwith DNase I, the PCR products were labeled with a biotinylatednucleotide analogue using terminal deoxynucleotidyltransferaseand hybridized to the microarray. Hybridized probes were captured by streptavidin-phycoerythrin conjugates using the Fluidics Station 450 and the arrays were finally scanned using the GeneChip® Scanner 3000 7G. Normalization and segmentation of genomic data was performed using BioDiscovery Nexus Copy Number 6.0 and the SNP Rank Segmentation algorithm [24,25] with default settings. Genome-wide average DNA copy number (ploidy) and the proportion of the genome with allelic imbalance were determined using Tumour Aberration Prediction Suite (TAPS) [15]. Average DNA copy number was calculated as the mean copy number of all genomic segments, weighted on segment length. Near diploid tumours were defined to have average copy number <2.5 and aneuploid tumours to have average copy number ≥2.5. SNP array data is available at GEO with accession number: (GSE62875).

Statistical analyses

The Mann-Whitney U test was used in comparisons of non-parametric two group parameters, the Kruskal-Wallis test for multiple groups and the Chi-square test for dichotomous response parameters and to test differences in proportions between groups. A two-sided Fisher’s exact test was used instead of the Chi-square test when fewer than 30 cases where analysed in total or less than 10 cases in each group. Spearman’s rho was used to calculate the correlation coefficient (r). The odds ratio (OR) and the 95% confidence intervals (CI) were calculated according to Ahlbom et al. [26]. Differences were considered statistically significant if p < 0.05.

Ethics

Ethical approval was obtained from the Ethics committee at Uppsala University, Uppsala, Sweden.

Results

Of the 121 tumours analysed, 48 (40%) had KRAS mutations, the mutations where located in codon 12 (65%), codon 13 (31%) and codon 61 (4%). BRAF mutations were detected in 28 (23%) of the tumours and PIK3CA mutations were seen in 22 (18%) tumours mainly in exon 9 (n = 18; 82%) with 4 mutations in exon 20 (18%). MSI-H was detected in 24 (20%) tumours and MSI-L in 7 (6%). DNA copy number <2.5 were seen in 66 out of 116 (57%) tumours analysed. In Table 1 the main clinical and histopathological characteristics of the cohort are shown in relations to KRAS, BRAF and PIK3CA mutations and MSI and DNA copy number. The main findings were that KRAS mutation was associated with advanced disease stage, BRAF mutations were mainly found in right colon, PIK3CA was associated with poor tumour differentiation, MSI was more commonly seen in lower disease stage, larger and more poorly differentiated tumours. However, DNA copy number did not reveal any associations to the variables analysed (Table 1). The well-known mutual exclusiveness of KRAS and BRAF mutations was observed (Table 2 and Figure 1), and MSI was more prevalent in KRAS wild-type and BRAF mutated tumours (Table 2). PIK3CA mutations were in this cohort significantly associated with the presence of BRAF mutations and MSI (Table 2) and, in contrast to the mutual exclusive pattern of KRAS and BRAF mutations, PIK3CA mutations coexisted with mutations in the two other genes.
Table 1

Clinical and histopathological relations of KRAS, BRAF and PIK3CA mutations and MSI (n = 121) and DNA copy number (n = 116) in primary tumours of patients with colon cancer

TotalKras wtKras mutpBraf wtBraf mutpPIK3CA wtPIK3CA mutpMSSMSIpDNA copy numberp
<2.5≥2.5
Number 12173489328972297246650
Age at diagnosis
 Years (mean)7071690,34669720,38871670,38070700,85871690,412
Gender
 Female7143280.95051200.13257140.64154170.17737310.520
 Male5030204284284372919
Tumour location
 Right colon7343300.69249240.00256170.09355180.11039310.751
 Left colon4830184444354262719
Tumour stage
 Stage II4029110,00828120,1603550,14727130,01026140,247
 Stage III553421431245104692825
 Stage IV2610162241972421211
Tumour size
 <5 cm3822160.7493170.6393170.1003620.01121160.972
 ≥5 cm8250326220671561214434
 Missing data1
Differentiation
 Poor282080,19318100.07218100.0061414<0.0011890.274
 Well-moderate9353407518811283104841
Mucinous
 No10262400,80481210.14384180.74884180.20855420.100
 Yes19118127154136118
Perineural invasion
 No1177120.64989280.57297200.15193240.58364491.000
 Yes446240224021
Vascular invasion
 No10465390,28778260.35485181.00081230.18958420.549
 Yes178915214316188

Wt: wildtype; mut: mutation.

Table 2

Correlations between KRAS, BRAF and PIK3CA mutations, MSI (n = 121) and DNA copy number (n = 115) in primary tumours from patients with colon cancer

BRAFPIK3CAMSI vs MSSDNA copy number
MutWtprMutWtprMSIMSSpr<2.5≥2.5Missingpr
KRAS
 Mutation048<0.001-0.4149390.100-0.003246<0.001-0.338222230.169-0.146
 Wild type28451360225146253
BRAF
 Mutation10180.006-0.2131810<0.0010.6572350.0090.265
 Wild type128168745426
PIK3CA
 Mutation8140.0410.17314710.5950.072
 Wild type168354405
MSI
 MSI2301<0.0010.416
 MSS45475

Wt: Wild type; Mut: Mutation; r: Correlation coefficient.

Figure 1

Venn diagrams representing the interrelations of KRAS, BRAF, PIK3CA mutations and MSI in primary tumours from patients with colon cancer; a) the entire cohort (n = 121); b) non-disseminated disease (n = 53) and c) disseminated disease (n = 68).

Clinical and histopathological relations of KRAS, BRAF and PIK3CA mutations and MSI (n = 121) and DNA copy number (n = 116) in primary tumours of patients with colon cancer Wt: wildtype; mut: mutation. Correlations between KRAS, BRAF and PIK3CA mutations, MSI (n = 121) and DNA copy number (n = 115) in primary tumours from patients with colon cancer Wt: Wild type; Mut: Mutation; r: Correlation coefficient. Venn diagrams representing the interrelations of KRAS, BRAF, PIK3CA mutations and MSI in primary tumours from patients with colon cancer; a) the entire cohort (n = 121); b) non-disseminated disease (n = 53) and c) disseminated disease (n = 68). Tumours with average DNA copy number <2.5 frequently exhibited MSI and mutated BRAF. None of the tumours with MSI demonstrated an average DNA copy number ≥2.5 (Table 2 and Figure 2). On the contrary, 51 percent of the MSS tumours demonstrated an average DNA copy number ≥2.5, and were in all cases accompanied by a high proportion of the genome affected by allelic imbalance (Figure 2). However, average DNA copy number was neither associated with KRAS, nor PIK3CA mutation status (Table 2).
Figure 2

MSS/MSI-L and MSI-H samples were plotted according to average DNA copy number and proportion of the genome with allelic imbalance (%).

MSS/MSI-L and MSI-H samples were plotted according to average DNA copy number and proportion of the genome with allelic imbalance (%). DNA copy number or PIK3CA mutations revealed no associations with disseminated disease or recurrence in the whole study cohort, or in various subgroup combinations of the cohort, and were therefore excluded from further analysis. KRAS mutated tumours were more commonly seen in patients with disseminated disease. In contrast, BRAF mutations or MSI were less common in tumours from patients with disseminated disease or in those developing recurrence in disease stages II and III (Table 3). No statistically significant associations were seen when disease stages II and III were analysed separately (data not shown).
Table 3

The associations of KRAS and BRAF mutations and MSI to the risk of recurrence and dissemination in patients with colon cancer

Disease stage II and IIIDisseminated¥Non disseminatedβOdds ratio (95% Confidence interval)P
RecurrenceNo recurrenceOdds ratio (95% Confidence interval)P
n42536853
KRAS
 Mutation18142.09 (0.88-4.96)0.09234142.75 (1.28-6.04)0.009
 Wild type24393439
BRAF
 Mutation6180.32 (0.16-0.91)0.03410180.34 (0.14-0.81)0.013
 Wild type36355835
MSI
 MSI5170.29 (0.10-0.86)0.0277170.24 (0.09-0.64)0.005
 MSS37366136
MSS only
KRAS
 Mutation18130.95 (0.35-2.58)0.27933132.08 (0.89-4.86)0.087
 Wild type19232823
BRAF
 Mutation250.35 (0.06-1.96)0.261550.55 (0.15-2.06)0.492
 Wild type35315631
KRAS wild type only
MSI
 MSI5160.38 (0.12-1.22)0.1686160.31 (0.10-0.91)0.041
 MSS19232823
BRAF
 Mutation6180.39 (0.13-1.19)0.11510180.49 (0.18-1.28)0.142
 Wild type18212421
BRAF wild type only
MSI
 MSI140.22 (0.02-2.09)0.198240.28 (0.04-1.60)0.194
 MSS35315631
KRAS
 Mutation18141.50 (0.59-3.84)0.39734142.13 (0.90-4.99)0.082
 Wild type18212421
MSI and BRAF*
BRAF wild type + MSS35313.55 (1.33-9.44)0.01356313.31 (1.45-7.59)0.004
BRAF mutation + MSS250.48 (0.09-2.61)0.459550.76 (0.21-2.78)0.747
BRAF mutation + MSI4130.32 (0.10-1.08)0,0505130.24 (0.08-0.74)0.011
BRAF wild type + MSI140.30 (0.03-2.78)0.379240.37 (0.07-2.11)0.403

βNon-disseminated: Disease stages II and III without recurrence; ¥Disseminated: Disease stages II and III with recurrence and stage IV.

*The comparison of each subgroup is made with all other groups.

The associations of KRAS and BRAF mutations and MSI to the risk of recurrence and dissemination in patients with colon cancer βNon-disseminated: Disease stages II and III without recurrence; ¥Disseminated: Disease stages II and III with recurrence and stage IV. *The comparison of each subgroup is made with all other groups. Higher frequency of KRAS mutations was observed in tumours from patients with higher disease stages; 28% in stage II; 38% in stage III and 62% in stage IV. Whereas mutated BRAF, as well as MSI, were more frequent in lower disease stages; BRAF mutation frequency was 30% in stage II; 22% in stage III and 15% in stage IV and the frequency of MSI was: 33% in stage II; 16% in stage III and 8% in stage IV. When these genotypes were analysed separately in left and right colon, MSI and BRAF mutations were observed more frequently in the right colon and these molecular changes were present in both tumours from patients with, or without, recurrence in disease stages II and III and in disseminated disease (Table 4). For left colon, MSI and BRAF mutations could not be found in tumours from patients developing disease recurrence in stages II or III and were rare in those with disseminated disease (Table 4). On the contrary, KRAS mutations had a stronger association with disseminated disease in left compared with right colon (Table 4). Overall KRAS was the most frequently mutated gene in patients with disseminated disease (Figure 1c) and KRAS codon 12 glycine to valine mutations was seen in 10 of 34 KRAS mutated tumours in patients with disseminated disease compared to 2 of 14 KRAS mutated tumours in patients with non-disseminated disease (data not shown).
Table 4

The prognostic associations of KRAS mutation, BRAF mutation and MSI in right versus left colon in 121 patients with colon cancer

Diseasestage II and IIIAll
RecurrenceNo recurrenceOdds ratio (95% Confidence interval)PDisseminated¥Non-disseminatedβOdds ratio (95% Confidence interval)P
Rightcolon
 MSI5120,40 (0,12-1,31)0,1586120,31 (0,10-0,95)0.055
 MSS22213421
Leftcolon
 MSI05*0,057150,11 (0,01-1,04)0.069
 MSS15152715
Rightcolon
BRAFmutation6140,38 (0,12-1,21)0,16810140,45 (0,17-1,22)0.138
BRAFwildtype21193019
Leftcolon
BRAFmutation04*0,119040.025
BRAFwildtype15162816*
Rightcolon
BRAF/MSIpresent7160,37 (0,12-1,12)0,11011160,40 (0,15-1,07)0.089
BRAF/MSI absent20172917
Leftcolon
BRAF/MSIpresent06*0,024160,09 (0,01-0,79)0.015
BRAF/MSI absent15142714
Rightcolon
KRASmutation13102,13 (0,74-6,16)0,15720102,3 (0,87-6,05)0.089
KRASwildtype14232023
Leftcolon
KRASmutation542,00 (0,43-9,27)0,4511444,00 (1,07-15,01)0.041
KRASwildtype10161416

βNon-disseminated: Disease stage II and III without recurrence; ¥Disseminated: Disease stage II and III with recurrence and stage IV. *Not able to calculate OR because of 0 in one grupp.

The prognostic associations of KRAS mutation, BRAF mutation and MSI in right versus left colon in 121 patients with colon cancer βNon-disseminated: Disease stage II and III without recurrence; ¥Disseminated: Disease stage II and III with recurrence and stage IV. *Not able to calculate OR because of 0 in one grupp. In Table 3, patients with MSS tumours only, KRAS wild type only and BRAF wild type only are also presented according to molecular status, dissemination and recurrence. Among these subgroups, patients with KRAS wild type tumours that are MSI are less likely (p = 0.041) to have disseminated disease. Patients with KRAS mutated MSS tumours appear more likely to have disseminated disease, but recurrences in stages II and III disease were not more frequent when MSS tumours were KRAS mutated. The same trend for dissemination can be seen for BRAF wild type tumours with a KRAS mutation (Table 3). The OR for dissemination for BRAF mutated tumours is low both in MSS tumours and in KRAS wild type tumours; however these results are statistically non-significant. In an attempt to identify specific subgroups of molecular markers that could help to detect patients with high or low risk of disease dissemination, or recurrence in stages II and III, several combinations of markers were of interest. Patients with tumours presenting both KRAS wild type and MSI had a reduced risk of dissemination (OR 0.22; 95% CI 0.08-0.62) and recurrence in disease stages II and III (OR 0.31; 95% CI 0.10-0.94) compared with all other groups. On the other hand, patients with tumours harbouring both BRAF wild type and MSS presented a higher risk of disseminated disease, and disease recurrence in stages II and III compared with all other groups (Table 3). Tumours with both BRAF mutation and MSI had the lowest risk for dissemination also marginally significant for lower risk for disease recurrence in stages II and III (Table 3). No statistically significant differences were seen when stages II and III were analysed separately with aforementioned subgroups (data not shown).

Discussion

The present study revealed that tumour dissemination is less likely to occur in colon cancer patients with microsatellite instable (MSI) disease or mutated BRAF, as compared to patients with MSS or BRAF wild-type tumours. On the contrary, disseminated disease was more commonly observed in patients with mutated KRAS, as compared to their KRAS wild-type counterparts. This study is among the first that describes frequencies of mutations and microsatellite instability in association with disease dissemination (metastatic disease either present at the time of diagnosis or developed during follow-up time) in a selected subset of colon cancer patients. The rationale behind including patients with stage II and III colon cancer, with and without recurrent metastatic disease, together with stage IV patients (metastatic disease at diagnosis), was to facilitate the detection of predictive genotypes in a cost-effective way. The applied unmatched case-control design enabled a smaller number of samples to be analysed, while the number of critical events was maintained. However, it should be noted that the reduced sample size of each subgroup, as a result of the applied selection criteria, also might limit the power to detect statistically significant differences between the subgroups. Furthermore, even based on a large material of over 600 frozen tissue samples, we were unable to include the planned number of stage II patients with metastatic recurrence. The strict quality requirements with regard to staging, surgery, and pathology contributed to this inability, but at the same time likely increased the validity of the results, as the influence of unrelated factors was minimised. The observed mutation frequencies in the present investigation should be interpreted with caution, as this cohort is not population-based. Even so, the KRAS mutation frequency of 40% in this cohort was in good agreement with other published studies [27-29]. Moreover, we observed that the proportion of KRAS mutated patients increased with higher disease stage, a finding supported by Eklöf et al. [30], but not uniformly seen in other cohorts [31,32].Today KRAS mutation status is routinely analysed because of its predictive nature in patients receiving therapeutic antibodies against EGFR, with treatment restricted to patients with KRAS wild type tumours [33,34]. In addition to predictive power with regard to treatment response, the prognostic impact of mutated KRAS has been thoroughly studied in CRC. In the RASCAL II study, KRAS mutations were associated with worse prognosis compared to KRAS wild type in over 3000 patients with CRC, an association that was stronger in stage III than in stage II [31]. The association to worse prognosis was however restricted to KRAS 12Gly > Val in stage III disease [31,35]. In the present study, a similar trend of worse prognosis for KRAS 12Gly > Val mutated patients was observed. Additional studies have confirmed the association of KRAS mutations and poor prognosis [30,32,36-38]. Contrary to these results, two other prospective studies, including 1,404 and 315 patients respectively, did not demonstrate any major impact of KRAS mutations on prognosis [39,40]. In the present study, the BRAF mutation frequency (23%) was higher compared to the 5-17% previously reported in colorectal cancer [30,32,41], possibly explained by the fact that right-sided tumours were predominant in our cohort and BRAF mutations have been reported to mainly occur in tumours of the right colon [30,37,39-41]. BRAF mutations were associated with lower likelihood of tumour dissemination in the whole cohort, as well as lower likelihood of metastatic recurrence in a separate analysis of stage II and III tumours. This is in contrast to a majority of published studies, where BRAF mutations were mostly associated with worse prognosis [28,30,37,39,40,42,43] or did not exhibit a prognostic impact [30,38]. Of interest is that two recent studies showed that BRAF mutations were related to worse overall survival, but not to relapse-free survival [44,45], which may be explained by higher frequencies of BRAF mutations in older individuals [30,45]. BRAF and KRAS mutations were confirmed to be mutually exclusive in this study, as previously reported [46]. BRAF mutations were moreover significantly associated with MSI, also this in agreement with previous findings [37,47]. The good prognostic feature of patients with the MSI tumour type, also seen here, is well-established [38,48-50] and MSI has been reported to be prognostic in both stages II and III [48], stage II only [48,50] and stage III only [19]. As observed by others and similarly to BRAF mutations, MSI tumours were found to have larger tumour size, association with lower disease stage and poor differentiation. However, the frequently seen associations of MSI with right colon, mucinous tumour type and female gender was not seen in the present cohort possibly reflecting the differences in selection of patients compared with consecutive cohorts. Interestingly, of the patients with left-sided MSI tumours in the present cohort none developed recurrence. It is tempting to omit MSI analysis in left-sided colon cancers, as only about 5% of left-sided tumours are expected to be MSI, however this study indicates that MSI analysis can assist when selecting patients for adjuvant treatment even for left sided tumours. We were unable to find any publications that analysed the prognostic impact of MSI in left-sided colon cancers, as most studies state that the case number is too low for meaningful investigations of this subset [38]. MSI tumours are characterised by a defective DNA mismatch repairsystem and the consequential accumulation of mutations in tumour suppressor genes and oncogenes. Tumours that are MSS commonly exhibit another type of instability, CIN, with abundant large-scale genomic alterations that often lead to a higher average DNA copy number. In contrast to MSI, average DNA copy number is not routinely assessed. Therefore, in the present study, average DNA copy number was determined based on genome-wide SNP array analysis. A low average DNA copy number was associated with the presence of BRAF mutation and MSI, but no association with tumour dissemination nor disease recurrence was found, suggesting that the analysis of average DNA copy number would not improve routine diagnostics. In addition to KRAS and BRAF mutations, it has been put forward that mutations in PIK3CA, the p110α catalytic subunit of phosphatidylinositol-4,5-bisphosphonate 3-kinase (PI3K) and a main player in the PI3K/AKT/mTOR pathway, might be of clinical relevance. Coexistence of PIK3CA exon 9 and 20 mutations has, mainly by one group, revealed worse prognosis in CRC [22,51]. The present study revealed that PIK3CA mutations were more common in MSI and BRAF mutated tumours. However, no significant association with tumour dissemination was observed, an observation supported by others [30]. Molecular analysis methods to detect the presence of mutations and chromosomal or microsatellite instability are unlikely to replace conventional pathological analysis, but can potentially help oncologists decide whether or not colon cancer patients should receive chemotherapy as an adjuvant treatment to reduce the risk of metastatic recurrence.

Conclusions

The present study revealed that tumour dissemination is less likely to occur in colon cancer patients displaying MSI or BRAF mutation, whereas the presence of a KRAS mutation increases the likelihood of disseminated disease.
  48 in total

Review 1.  Colorectal cancer molecular biology moves into clinical practice.

Authors:  Colin C Pritchard; William M Grady
Journal:  Gut       Date:  2010-10-04       Impact factor: 23.059

2.  The BRAF V600E mutation is an independent prognostic factor for survival in stage II and stage III colon cancer patients.

Authors:  A Fariña-Sarasqueta; G van Lijnschoten; E Moerland; G-J Creemers; V E P P Lemmens; H J T Rutten; A J C van den Brule
Journal:  Ann Oncol       Date:  2010-05-25       Impact factor: 32.976

3.  Tumor microsatellite instability and clinical outcome in young patients with colorectal cancer.

Authors:  R Gryfe; H Kim; E T Hsieh; M D Aronson; E J Holowaty; S B Bull; M Redston; S Gallinger
Journal:  N Engl J Med       Date:  2000-01-13       Impact factor: 91.245

4.  PIK3CA mutation is associated with poor prognosis among patients with curatively resected colon cancer.

Authors:  Shuji Ogino; Katsuhiko Nosho; Gregory J Kirkner; Kaori Shima; Natsumi Irahara; Shoko Kure; Andrew T Chan; Jeffrey A Engelman; Peter Kraft; Lewis C Cantley; Edward L Giovannucci; Charles S Fuchs
Journal:  J Clin Oncol       Date:  2009-02-23       Impact factor: 44.544

5.  Analysis of the association between CIMP and BRAF in colorectal cancer by DNA methylation profiling.

Authors:  Toshinori Hinoue; Daniel J Weisenberger; Fei Pan; Mihaela Campan; Myungjin Kim; Joanne Young; Vicki L Whitehall; Barbara A Leggett; Peter W Laird
Journal:  PLoS One       Date:  2009-12-21       Impact factor: 3.240

6.  Effects of KRAS, BRAF, NRAS, and PIK3CA mutations on the efficacy of cetuximab plus chemotherapy in chemotherapy-refractory metastatic colorectal cancer: a retrospective consortium analysis.

Authors:  Wendy De Roock; Bart Claes; David Bernasconi; Jef De Schutter; Bart Biesmans; George Fountzilas; Konstantine T Kalogeras; Vassiliki Kotoula; Demetris Papamichael; Pierre Laurent-Puig; Frédérique Penault-Llorca; Philippe Rougier; Bruno Vincenzi; Daniele Santini; Giuseppe Tonini; Federico Cappuzzo; Milo Frattini; Francesca Molinari; Piercarlo Saletti; Sara De Dosso; Miriam Martini; Alberto Bardelli; Salvatore Siena; Andrea Sartore-Bianchi; Josep Tabernero; Teresa Macarulla; Frédéric Di Fiore; Alice Oden Gangloff; Fortunato Ciardiello; Per Pfeiffer; Camilla Qvortrup; Tine Plato Hansen; Eric Van Cutsem; Hubert Piessevaux; Diether Lambrechts; Mauro Delorenzi; Sabine Tejpar
Journal:  Lancet Oncol       Date:  2010-07-08       Impact factor: 41.316

7.  Value of mismatch repair, KRAS, and BRAF mutations in predicting recurrence and benefits from chemotherapy in colorectal cancer.

Authors:  Gordon Hutchins; Katie Southward; Kelly Handley; Laura Magill; Claire Beaumont; Jens Stahlschmidt; Susan Richman; Philip Chambers; Matthew Seymour; David Kerr; Richard Gray; Philip Quirke
Journal:  J Clin Oncol       Date:  2011-03-07       Impact factor: 44.544

8.  DNA mismatch repair status and colon cancer recurrence and survival in clinical trials of 5-fluorouracil-based adjuvant therapy.

Authors:  Frank A Sinicrope; Nathan R Foster; Stephen N Thibodeau; Silvia Marsoni; Genevieve Monges; Roberto Labianca; George P Kim; Greg Yothers; Carmen Allegra; Malcolm J Moore; Steven Gallinger; Daniel J Sargent
Journal:  J Natl Cancer Inst       Date:  2011-05-19       Impact factor: 13.506

9.  Defective mismatch repair as a predictive marker for lack of efficacy of fluorouracil-based adjuvant therapy in colon cancer.

Authors:  Daniel J Sargent; Silvia Marsoni; Genevieve Monges; Stephen N Thibodeau; Roberto Labianca; Stanley R Hamilton; Amy J French; Brian Kabat; Nathan R Foster; Valter Torri; Christine Ribic; Axel Grothey; Malcolm Moore; Alberto Zaniboni; Jean-Francois Seitz; Frank Sinicrope; Steven Gallinger
Journal:  J Clin Oncol       Date:  2010-05-24       Impact factor: 44.544

10.  Prognostic role of KRAS and BRAF in stage II and III resected colon cancer: results of the translational study on the PETACC-3, EORTC 40993, SAKK 60-00 trial.

Authors:  Arnaud D Roth; Sabine Tejpar; Mauro Delorenzi; Pu Yan; Roberto Fiocca; Dirk Klingbiel; Daniel Dietrich; Bart Biesmans; György Bodoky; Carlo Barone; Enrique Aranda; Bernard Nordlinger; Laura Cisar; Roberto Labianca; David Cunningham; Eric Van Cutsem; Fred Bosman
Journal:  J Clin Oncol       Date:  2009-12-14       Impact factor: 44.544

View more
  12 in total

1.  Molecular subtypes in early colorectal cancer associated with clinical features and patient prognosis.

Authors:  M Gil-Raga; E Jantus-Lewintre; S Gallach; V Giner-Bosch; A Frangi-Caregnato; M J Safont-Aguilera; J Garde-Noguera; E Zorraquino-Pina; M García-Martínez; C Camps-Herrero
Journal:  Clin Transl Oncol       Date:  2018-05-25       Impact factor: 3.405

2.  The prognostic yield of biomarkers harvested in chemotherapy-naive stage II colon cancer: can we separate the wheat from the chaff?

Authors:  Martin M Watson; Kjetil Søreide
Journal:  Mol Med       Date:  2016-05-04       Impact factor: 6.354

3.  Genome-wide association studies and epigenome-wide association studies go together in cancer control.

Authors:  Mukesh Verma
Journal:  Future Oncol       Date:  2016-04-15       Impact factor: 3.404

4.  Effect of KRAS mutational status on disease behavior and treatment outcome in patients with metastatic colorectal cancer: intratumor heterogeneity and mutational status.

Authors:  Ayman Rasmy; Alaa Fayed; Ayman Omar; Nermin Fahmy
Journal:  J Gastrointest Oncol       Date:  2019-10

5.  Impact of microsatellite status on chemotherapy for colorectal cancer patients with KRAS or BRAF mutation.

Authors:  Chi-Jung Huang; Shih-Hung Huang; Chih-Cheng Chien; Henry Hsin-Chung Lee; Shung-Haur Yang; Chun-Chao Chang; Chia-Long Lee
Journal:  Oncol Lett       Date:  2016-10-18       Impact factor: 2.967

6.  Plasma Protein Profiling Reveal Osteoprotegerin as a Marker of Prognostic Impact for Colorectal Cancer.

Authors:  Helgi Birgisson; Kostas Tsimogiannis; Eva Freyhult; Masood Kamali-Moghaddam
Journal:  Transl Oncol       Date:  2018-07-04       Impact factor: 4.243

7.  The oncogene KRAS promotes cancer cell dissemination by stabilizing spheroid formation via the MEK pathway.

Authors:  Juri Ogishima; Ayumi Taguchi; Akira Kawata; Kei Kawana; Mitsuyo Yoshida; Yuki Yoshimatsu; Masakazu Sato; Hiroe Nakamura; Yoshiko Kawata; Akira Nishijima; Asaha Fujimoto; Kensuke Tomio; Katsuyuki Adachi; Takeshi Nagamatsu; Katsutoshi Oda; Tohru Kiyono; Yutaka Osuga; Tomoyuki Fujii
Journal:  BMC Cancer       Date:  2018-12-03       Impact factor: 4.430

8.  Prognostic Impact of BRAF and KRAS Mutation in Patients with Colorectal and Appendiceal Peritoneal Metastases Scheduled for CRS and HIPEC.

Authors:  Wilhelm Graf; Peter H Cashin; Lana Ghanipour; Malin Enblad; Johan Botling; Alexei Terman; Helgi Birgisson
Journal:  Ann Surg Oncol       Date:  2019-09-30       Impact factor: 5.344

9.  Copy number rather than epigenetic alterations are the major dictator of imprinted methylation in tumors.

Authors:  Alex Martin-Trujillo; Enrique Vidal; Ana Monteagudo-Sánchez; Marta Sanchez-Delgado; Sebastian Moran; Jose Ramon Hernandez Mora; Holger Heyn; Miriam Guitart; Manel Esteller; David Monk
Journal:  Nat Commun       Date:  2017-09-07       Impact factor: 14.919

10.  Blood-based DNA Methylation Biomarkers for Early Detection of Colorectal Cancer.

Authors:  Lixn Dong; Hongmei Ren
Journal:  J Proteomics Bioinform       Date:  2018-06-26
View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.