Literature DB >> 24886028

Epidemic and virulence characteristic of Shigella spp. with extended-spectrum cephalosporin resistance in Xiaoshan District, Hangzhou, China.

Chuan-Ling Zhang, Qing-Zhong Liu1, Juan Wang, Xu Chu, Li-Meng Shen, Yuan-Yu Guo.   

Abstract

BACKGROUND: Shigellae have become increasingly resistant to the extended-spectrum cephalosporin (ESC) worldwide and pose a great challenge to anti-infection treatment options. The purpose of this study was to determine the resistance, cephalosporin resistance mechanisms, virulence characteristic and genotype of ESC-resistant Shigella.
METHODS: From 2008 to 2012, Shigella isolates collected from diarrhea patients were detected for antibiotics sensitivity by disk diffusion, cephalosporin resistance determinants and virulence genes using polymerase chain reaction (PCR) and genotyping through enterobacterial repetitive intergenic consensus sequence PCR (ERIC-PCR).
RESULTS: A total of 356 Shigella isolates were gathered, and 198 (55.6%, 58 S. flexneri and 140 S. sonnei) were resistant to ESC. All ESC-resistant isolates were susceptible to imipenem, and only 0.5% isolate was resistant to piperacillin/tazobactam. ESC-resistant S. flexneri showed high degrees of resistance to ampicillin (100%), ampicillin/sulbactam (96.6%), piperacillin (100%), trimethoprim/sulfamethoxazole (74.1%), ciprofloxacin (74.1%), levofloxacin (53.4%), ceftazidime (58.6%) and cefepime (58.6%). ESC-resistant S. sonnei exhibited high resistance rates to ampicillin (100%), piperacillin (100%) and trimethoprim/sulfamethoxazole (96.4%). Cephalosporin resistance genes were confirmed in 184 ESC-resistant isolates. bla(CTX-M) types (91.8%, mainly bla(CTX-M-14), bla(CTX-M-15) and bla(CTX-M-57)) were most prevalent, followed by bla(OXA-30) (26.3%). Over 99.0% ESC-resistant isolates harbored virulence genes ial, ipaH, virA and sen. However, set1 were more prevalent in ESC-resistant S. flexneri isolates than in S. sonnei isolates. ERIC-PCR results showed that 2 and 3 main genotypes were detected in ESC-resistant S. flexneri and S. sonnei, respectively.
CONCLUSION: Our findings indicated that a high prevalence of ESC-resistant Shigella mediated mainly by bla(CTX-M) with stronger resistance and virulence, and the existence of specific clones responsible for these Shigella infection in the region studied.

Entities:  

Mesh:

Substances:

Year:  2014        PMID: 24886028      PMCID: PMC4229937          DOI: 10.1186/1471-2334-14-260

Source DB:  PubMed          Journal:  BMC Infect Dis        ISSN: 1471-2334            Impact factor:   3.090


Background

Shigellosis continues to be a major public health problem in non-industrialized countries. It was reported that about 91 million cases of shigellosis occurred, with 414,000 people dying in Asia annually [1]. In China, the morbility of Shigella infections each year is unusually high. Wang et al. [2] have reported that in 2000 0.8-1.7 million episodes of shigellosis occurred in seven different geographical regions, China. For shigellosis, antibiotic therapy can reduce the duration and severity of the illness [3]. However, with the long-term overuse of antimicrobials, the resistant Shigella has prevailed all over the word, and production of extended-spectrum β-lactamases (ESBLs) or AmpC enzymes is one of the most important resistance mechanisms. In China extended-spectrum cephalosporin (ESC)-resistant Shigella spp. has also been described in recent years [3-7]. However, as China has a vast territory area, the spectrum of antimicrobial resistance and the mechanisms of resistance may vary in different regions. Therefore, it is necessary to explore the variations of ESC resistance in clinical isolates of Shigella spp. from different geographical areas. The ability of Shigella spp. to cause shigellosis is attributed to the expression of arrays of virulence genes associated with colonization, invasion/penetration and toxin-mediated disease, such as the invasion-associated locus (ial), the invasion plasmid antigen H gene (ipaH), Shigella enterotoxin 1 (ShET-1) gene (set1A and set1B), Shigella enterotoxin 2 (ShET-2) gene (sen) and virA gene [8,9]. Estimating the existence of virulence determinants in Shigella would help us better understand its pathogenicity. However, investigations into clinical Shigella spp. virulence factors are still rare in the world. The purpose of this study was to investigate the resistance, the cephalosporin resistance mechanisms and the prevalence of putative virulence genes in ESC-resistant Shigella from patients with dysentery in Xiaoshan District, suburban of Hangzhou city, Zhejiang province, China. Finally we further ascertained the genotypes of these strains by ERIC-PCR (enterobacterial repetitive intergenic consensus sequence PCR) typing.

Methods

Bacterial isolates

Between January 2008 and December 2012, a total of 356 nonduplicate Shigella isolates were obtained from the faeces of different diarrhea patients at Zhejiang Xiaoshan hospital, Hangzhou City, Zhejiang Province, China. All isolates were identified by VITEK 60 microbial identification system (BioMérieux Corp., Lyon, France) and serotyped using commercial antisera (Lanzhou Institute of Biological Products, Lanzhou, China). Isolates studied were taken as part of standard patient care. Because of being focused on bacteria, no ethical approval was required for this study.

Antimicrobial susceptibility testing

The Shigella isolates were detected for antibiotic susceptibility by Kirby–Bauer method for the following antibiotics (Oxoid, Hampshire, UK), according to Clinical and Laboratory Standards Institute (CLSI), 2012 [10]: ampicillin (AMP), piperacillin (PIP), ciprofloxacin (CIP), trimethoprim/sulfamethoxazole (SXT), levofloxacin (LEV), ampicillin/sulbactam (SAM), piperacillin/tazobactam (TZP), imipenem (IMP), cefotaxime (CTX), ceftazidime (CAZ), cefepime (FEP) and cefoxitin (FOX). ESC-resistant organisms were defined as isolates showing resistance or intermediate to cefotaxime (zone diameter ≤25 mm) or ceftazidime (zone diameter ≤20 mm) or cefepime (zone diameter ≤17 mm) [10]. Escherichia coli ATCC 25922 was used for antibiotic susceptibility testing quality control.

ESBL and AmpC detection

ESC-resistant isolates were screened for ESBL production by the phenotypic confirmatory test according to CLSI [10]. AmpC examination was performed by the three-dimensional extract test as described by Philip et al. [11] for cefoxitin resistant or intermediate isolates.

ESBL, AmpC and virulence genes amplification

Detection of the ESBL genes (bla, bla, bla and bla) and virulence determinants (ial, iapH, set1A, set1B, sen and virA) were performed by PCR for ESC-resistant isolates, as described previously [3,12,13]. AmpC genes (bla, bla, bla, bla, bla and bla) were examined by multiplex-PCR for cefoxitin resistant or intermediate isolates according to Perez-Perez et al. [14]. Sequences of the primers were given in Table 1. The PCR products for ESBL and AmpC genes were sequenced on both DNA strands with ABI 3730XL sequencer (Perkin-Elmer) by Shanghai Sangon Biotech. The nucleotide sequences were analyzed by the BLAST program. For virulence genes, a representative amplicon for the each gene detected was also sequenced to validate that primers amplified the target genes.
Table 1

Primers used for PCR to detect resistance and virulence genes

PrimerSequence (5′-3′)Amplicon size (bp)Reference
ESBL genes
CTX-M-1 group
F-GGCCCATGGTTAAAAAATCACTGC
891
[3]
 
R-CCGTTTCCGCTATTACAAACCGTTG
 
CTX-M-2 group
F-CTCAGAGCATTCGCCGCTCA
843
 
R-CCGCCGCAGCCAGAATATCC
 
CTX-M-8 group
F-ATGATGAGACATCGCGTTAAC
864
 
R-CGGTGACGATTTTCGCGGCAG
 
CTX-M-9 group
F-GTGACAAAGAGAGTGCAACGG
856
 
R-ATGATTCTCGCCGCTGAAGCC
 
OXA group
F-ACACAATACATATCAACTTCGC
813
 
R-AGTGTGTTTAGAATGGTGATC
 
SHV group
F-GCCTTTTCGGCCTTCACTCAAG
989
 
R-TTAGCGTTGCCAGTGCTCGATCA
 
TEM group
F-ATAAAATTCTTGAAGACGAAA
1076
 
R-GACAGTTACCAATGCTTAATC
 
AmpC β-lactamase genes
MOX group
F-GCTGCTCAAGGAGCACAGGAT
520
[14]
 
R-CACATTGACATAGGTGTGGTGC
 
CIT group
F-TGGCCAGAACTGACAGGCAAA
462
 
R-TTTCTCCTGAACGTGGCTGGC
 
DHA group
F-AACTTTCACAGGTGTGCTGGGT
405
 
R-CCGTACGCATACTGGCTTTGC
 
ACC group
F- AACAGCCTCAGCAGCCGGTTA
346
 
R- TTCGCCGCA ATCATCCCTAGC
 
EBC group
F- TCGGTAAAGCCGATGTTGCGG
302
 
R- CTTCCACTGCGGCTGCCAGTT
 
FOX group
F- AACATGGGGTATCAGGGAGATG
190
 
R- CAA AGCGCGTAACCGGATTGG
 
Virulence gene
ial
F-CTGGATGGTATGGTGAGG
320
[12]
 
R-GGAGGCCAACAATTATTTCC
 
ipaH
F-TGGAAAAACTCAGTGCCTCT
423
 
R-CCAGTCCGTAAATTCATTCT
 
setlA
F-TCACGCTACCATCAAAGA
309
 
R-TATCCCCCTTTGGTGGTA
 
setlB
F-GTGAACCTGCTGCCGATATC
147
 
R-ATTTGTGGATAAAAATGACG
 
sen
F-ATGTGCCTGCTATTATTTAT
799
 
R-CATAATAATAAGCGGTCAGC
 
virA
F-CTGCATTCTGGCAATCTCTTCACATC
215
[13]
 R-TGATGAGCTAACTTCGTAAGCCCTCC  
Primers used for PCR to detect resistance and virulence genes

ERIC-PCR

ERIC-PCR was carried out on ESC-resistant Shigella isolates using primer ERIC2: 5′-AAGTAAGTGACTGGGGTGAGCG-3′, as described by Navia et al. [15].

Clinical data

Clinical information of the patients was collected from the case notes. The data included date of onset, symptoms (such as times of diarrhea, nausea, bellyache, vomiting, fever and bloody stools), results of microscopic examination of stool (white blood cell and red blood cell), treatment and duration of illness.

Statistical analysis

Pearson’s chi-square test or Fisher’s exact test if necessary was used to analyze the differences of antibiotics resistance, and virulence genes, and the relationship of virulence factors, resistance and ERIC-PCR genotypes (SPSS 11.5). All statistical tests were two tailed, with p < 0.05 considered statistically significant.

Results

Distribution of Shigella spp

Among 356 Shigella isolates, S. sonnei was the most prevalent species (n = 244, 68.5%, 244/356), followed by S. flexneri (n = 112, 31.5%, 112/356). No sample was positive for S. dysenteriae and S. boydii. In S. flexneri, seven different serotypes were found: 63 type 2a, 15 type 2c, 18 type 4c, 6 type 2b, 5 type 1a, 3 type x and 2 type 3a. 35.7% (40/112) of S. flexneri and 47.1% (115/244) of S. sonnei cases were found among patients under 5 years old; 20.5% (23/112) of S. flexneri and 23.4% (57/244) of S. sonnei isolates were from victims aged from 5 to 14 years; 43.8% (49/112) of S. flexneri and 29.5% (72/244) of S. sonnei isolates were from patients aged ≥15 years.

Antimicrobial resistance

Of the 356 Shigella isolates, 198 (55.6%, 58 S. flexneri and 140 S. sonnei) were resistant to cefotaxime, 59 (16.6%) to ceftazidime, 66 (18.5%) to cefepime (Table 2). The strains with resistance to ceftazidime or cefepime were all resistant to cefotaxime. Thus, these cefotaxime resistant strains were referred to as ESC-resistant isolates in this study. In addition, in these ESC-resistant isolates, 8 (2.2%) were resistant or intermediate to cefoxitin.
Table 2

Antibiotic resistance of ESC-resistant and susceptible isolates

AntibioticNumber of isolates resistant to antibiotics (%)
ESC-resistant S. flexneri vs ESC-resistant S. sonnei ( p value)
Total (n = 356) S. flexneri ( n = 112)
S. sonnei (n = 244)
 
ESC-resistant (n = 58)Cefotaxime susceptible (n = 54)ESC-resistant vs cefotaxime susceptible ( p value)ESC-resistant (n = 140)Cefotaxime susceptible (n = 104)ESC-resistant vs cefotaxime susceptible ( p value)
AMP
348 (97.8)
58 (100)
51(94.4)
0.069
140(100)
99(95.2)
0.009
NA
PIP
298 (83.7)
58(100)
46(85.2)
0.002
140(100)
54 (51.9)
<0.001
NA
SAM
136 (38.2)
56(96.6)
46(85.2)
0.035
34(24.3)
0 (0.0)
<0.001
<0.001
TZP
1 (0.3)
1 (1.7)
0 (0.0)
3.332
0 (0.0)
0 (0.0)
NA
0.119
CAZ
59 (16.6)
34(58.6)
0 (0.0)
<0.001
25(17.9)
0 (0.0)
<0.001
<0.001
FEP
66 (18.5)
34(58.6)
0 (0.0)
<0.001
32(22.9)
0 (0.0)
<0.001
<0.001
FOX
8 (2.2)
3 (5.2)
0 (0.0)
0.090
5 (3.6)
0 (0.0)
0.056
0.618
IPM
0(0.0)
0(0)
0 (0.0)
NA
0 (0.0)
0 (0.0)
NA
NA
SXT
304 (85.4)
43(74.1)
25(46.3)
0.003
135(96.4)
101(97.1)
0.766
<0.001
CIP
86 (24.2)
43 (74.1)
39 (72.2)
0.819
3 (2.1)
1 (1.0)
0.485
<0.001
LEV
57 (16.0)
31(53.4)
20(37.0)
0.081
3 (2.1)
3 (2.9)
0.692
<0.001
β-lactam antibiotic + SXT + CIP or LEV69 (19.4)36 (62.1)23 (42.6)0.0396 (4.3)4 (3.8)0.864<0.001

AMP, ampicillin; PIP, piperacillin; SAM, ampicillin/sulbactam; TZP, piperacillin/tazobactam; FEP, cefepime; FOX, cefoxitin; IMP, imipenem; SXT, trimethoprim/sulfamethoxazole; CIP, ciprofloxacin; LEV, levofloxacin.

p < 0.05 were considered statistically significant.

NA, not available.

Antibiotic resistance of ESC-resistant and susceptible isolates AMP, ampicillin; PIP, piperacillin; SAM, ampicillin/sulbactam; TZP, piperacillin/tazobactam; FEP, cefepime; FOX, cefoxitin; IMP, imipenem; SXT, trimethoprim/sulfamethoxazole; CIP, ciprofloxacin; LEV, levofloxacin. p < 0.05 were considered statistically significant. NA, not available. Compared to cefotaxime susceptible S. flexneri isolates, the ESC-resistant S. flexneri isolates were more resistant to PIP (100% versus 85.2%, p = 0.002), SAM (96.6% versus 85.2%, p = 0.035), SXT (74.1% versus 46.3%, p = 0.003), CAZ (58.6% versus 0%, p < 0.001) and FEP (58.6% versus 0%, p < 0.001). In S. sonnei, the ESC-resistant strains were more resistant to AMP (100% versus 95.2%, p = 0.009), PIP (100% versus 51.9%, p < 0.001), SAM (24.3% versus 0%, p < 0.001), CAZ (17.9% versus 0%, p < 0.001) and FEP (22.9% versus 0%, p < 0.001) than the cefotaxime susceptible isolates (Table 2). Compared to ESC-resistant S. sonnei isaolates, the ESC-resistant S. flexneri isolates were significantly more likely to be resistant to CAZ (58.6% versus 17.9%, p < 0.001), FEP (58.6% versus 22.9%, p < 0.001), CIP (74.1% versus 2.1%, p < 0.001) and LEV (53.4% versus 2.1%, p < 0.001), and less likely to be resistant to SXT (74.1% versus 96.4%, p < 0.001). No Shigella isolates were resistant to IMP, and Only one S. flexneri isolates was resistant to TZP (Table 2).

Multiresistance among ESC-resistant Shigella isolates

Among the 356 Shigella isolates, 69 (36 ESC-resistant S. flexneri, 23 cefotaxime susceptible S. flexneri, 6 ESC-resistant S. sonnei and 4 cefotaxime susceptible S. sonnei) were multidrug resistant (MDR, resistant to 3 or more classes of antimicrobial agents), and the multi-resistance was more frequent among S. flexneri isolates than among S. sonnei isolates (Table 2).

Production of ESBL and AmpC

The phenotypic confirmatory test displayed that 96.0% (190/198) ESC-resistant isolates were ESBLs positive (Table 3). Of 8 cefoxitin resistant or intermediate isolates, 2 were the three-dimensional extract test positive.
Table 3

Distribution of genotypes of ESBL and AmpC in 198 ESC-resistant isolates

ESBL phenotypic confirmatory test (n)Genotype
S. flexneri (n = 58) S. sonnei (n = 140)Total (n = 198)
ESBL or AmpC groupESBL or AmpC gene
Positive (n = 190)
CTX-M-1
CTX-M-15
5
11
16
CTX-M-28
2
6
8
CTX-M-57
7
2
9
CTX-M-22
3
2
5
CTX-M-9
CTX-M-14
16
69
85
TEM
TEM-1
2
4
6
OXA
OXA-30
4
11
15
CTX-M-1+CTX-M-9+OXA
CTX-M-15+CTX-M-14+OXA-30
1
0
1
CTX-M-1+ OXA+TEM
CTX-M-22+OXA-30+TEM-1
0
2
2
CTX-M-57+ OXA-30+TEM-1
9
0
9
CTX-M-1+ TEM
CTX-M-57+ TEM-1
2
0
2
CTX-M-1+ OXA
CTX-M-57+ OXA-30
1
1
2
CTX-M-15+ OXA-30
2
8
10
CTX-M-9+ OXA+TEM
CTX-M-14+ OXA-30+ TEM-1
1
3
4
CTX-M-9+ OXA
CTX-M-14+ OXA-30
2
6
8
CTX-M-9+ TEM
CTX-M-14+ TEM-1
0
6
6
Not detect the ESBL or AmpC genotype
0
2
2
Negative (n = 8)CTX-M-9+CIT
CTX-M-14+CMY-2
0
1
1
CTX-M-1+DHA+OXA
CTX-M-15+OXA-30+DHA-1
1
0
1
Not detect the ESBL or AmpC genotype066
Distribution of genotypes of ESBL and AmpC in 198 ESC-resistant isolates

Distribution of ESBL and AmpC genes

Of the 198 ESC-resistant isolates, 105 (53.0%) were positive for bla, 28 (14.1%) for bla, 22 (13.6%) for bla, 8 (4.0%) for bla, 7 (3.3%) for bla, 52 (26.3%) for bla, 1 (0.5%) for bla, and 1 (0.5%) for bla; 28 (14.1%) isolates carried non-ESBL gene bla; 8 (4.0%) strains were negative for all β-lactamase genes detected. No isolate hosted bla, bla, bla and bla genes. And 44 (23.2%) isolates were found to harbor ≥2 β-lactamase genes (Table 3).

Distribution of virulence genes

All ESC-resistant Shigella isolates harbored the ial, ipaH and virA genes. The gene sen existed in 99.0% Shigella isolates. The genes set1A and set1B were more prevalent in S. flexneri strains than in S. sonnei isolates (p < 0.05) (Table 4). Of 198 ESC-resistant Shigella strains, 123 (S. sonnei isolates accounting for 92.7%, 114/123) possessed the most prevalent virulence gene combination of ia1 + ipaH + virA + sen, followed by the combination of ia1 + ipaH + virA + set1A + set1B + sen (S. flexneri isolates accounting for 86.8%, 46/53) (Table 4).
Table 4

Prevalence and combination of virulence genes among 198 ESC-resistant isolates

IsolateSerotypeNo. (%) of isolates that produced the following:
No. (%) of isolates that contained the following combination of genes
ial ipaH virA set1A set1B sen IIIIIIIVV
S. flexneri (n = 58)
1a (n = 2)
2 (3.4)
2 (3.4)
2 (3.4)
0 (0.0)
0 (0.0)
2 (3.4)
0 (0.0)
2 (3.4)
0 (0.0)
0 (0.0)
0 (0.0)
2a (n = 37)
37(63.8)
37 (63.8)
37 (63.8)
36 (62.1)
36 (62.1)
37 (63.8)
0 (0.0)
1 (1.7)
0 (0.0)
0 (0.0)
36 (62.1)
2b (n = 2)
2 (3.4)
2 (3.4)
2 (3.4)
0 (0.0)
0 (0.0)
2 (3.4)
0 (0.0)
2(3.4)
0 (0.0)
0 (0.0)
0 (0.0)
2c (n = 5)
5 (8.6)
5 (8.6)
5 (8.6)
0 (0.0)
0 (0.0)
5 (8.6)
0 (0.0)
5 (8.6)
0 (0.0)
0 (0.0)
0 (0.0)
4c (n = 12)
12(20.7)
12 (20.7)
12 (20.7)
10 (17.2)
10 (17.2)
12 (20.7)
0 (0.0)
2 (3.4)
0 (0.0)
0 (0.0)
10 (17.2)
 
58 (100)
58 (100)
58 (100)
46 (79.3)
46 (79.3)
58 (100)
0 (0.0)
12 (20.7)
0 (0.0)
0 (0.0)
46 (79.3)
S. sonnei (n = 140)
 
140(100)
140(100)
140(100)
12 (8.6)
19 (13.6)
138(98.6)
2 (1.4)
114 (81.4)
5 (3.6)
12 (8.6)
7 (5.0)
S. flexneri vs S. sonnei (p value)
 
NA
NA
NA
<0.001
0.003
0.360
0.364
<0.001
0.603
0.021
<0.001
Total 198(100)198(100)198(100)58 (29.3)65 (32.8)196 (99.0)2 (1.0)123(62.1)8 (4.0)12 (6.1)53 (26.8)

p < 0.05 were considered statistically significant.

I, ia1 + ipaH + virA; II, ia1 + ipaH + vir + sen; III, ia1 + ipaH + virA + setlA + sen; IV, ia1 + ipaH + virA + setlB + sen; V, ia1 + ipaH + virA + setlA + setlB + sen.

NA, not available.

Prevalence and combination of virulence genes among 198 ESC-resistant isolates p < 0.05 were considered statistically significant. I, ia1 + ipaH + virA; II, ia1 + ipaH + vir + sen; III, ia1 + ipaH + virA + setlA + sen; IV, ia1 + ipaH + virA + setlB + sen; V, ia1 + ipaH + virA + setlA + setlB + sen. NA, not available. The 58 ESC-resistant S. flexneri isolates were classified into 8 types by ERIC-PCR. The distribution of isolates based on this epidemiological analysis was as follows: 26 isolates in type A, 11 isolates in type B, 5 isolates in type C, 4 isolates each in type D and type E, 3 isolates each in type F and type G, and 2 isolates in type H. Among the 140 ESC-resistant S. sonnei isolates, 13 different genotypes (type A to M) were obtained. The major genotype was type A (66 isolates), followed by type B (19 isolates), type C (12 isolates), type D (8 isolates), type E (7 isolates), type F (7 isolates), type G (6 isolates), type H (6 isolates), type I (3 isolates), type J (2 isolates), type K (2 isolates), type L (1 isolates) and type M (1 isolates).

Discussion

This investigation reported the prevalence and resistance of ESC-resistant Shigella, and the molecular analysis of cephalosporin resistance genes and virulence determinants in clinical isolates from Xiaoshan District, Hangzhou, China collected over a period of 5 years. In the economic undeveloped regions, S. flexneri is the most frequently isolated Shigella species. A similar situation also exists in China, according to previous data [2,4,6,16-18]. However, in our study S. sonnei was the most common cause of bacterial dysentery, which was consistent with the findings in industrialized countries. In recent years, the data from Kaengkhoi District of Thialand, Ho Chi Minh City of Vietnam, South Korea, Taiwan and the East, North and Northeast regions of China, which are the newly industrialized regions, also displayed a striking species shift from S. flexneri to S. sonnei[18-22]. Therefore, the species transition of shigellosis in the present study may be related to the economic growth in Xiaoshan District, suburban of Hangzhou city with higher economic indicators. Of course, other factors may also play a role and need further researches. Through the resistance data analysis, we found that more than half of the S. flexneri and S. sonnei isolates were resistant to ESC (cefotaxime). Data from 8 Asian countries showed a high prevalence of resistance to the frontline antibiotics AMP (53.0%) and SXT (81.0%) among Shigella isolates [21]. However, the resistance rates to the both drugs among all our Shigella isolates were more higher (AMP, 97.8%; SXT, 85.4%), and were consistent with the data from other investigations, mainland China [6,16,17]. The data from Table 2 showed that SAM was not appropriate for the treatment of diarrhea caused by S. flexneri, regardless of the strains with ESC-resistance (96.6%) or susceptibility (85.2%); On the contrary, it can be used to prescribe for S. sonnei infections, especially for the cefotaxime susceptible strains. Although the resistance rate of Shigella to PIP was high (83.7%) in this study, TZP was of very high anti-Shigella activity (Table 2). If the inhibition zone diameter of CAZ is ≥21 mm or that of FEP ≥18 mm, the two antibiotics can be reported susceptibility for enterobacteriaceae, irrespective of the isolates producing ESBLs or not, according to the CLSI [10]. In all Shigella isolates studied, a similar results of resistance to CAZ and FEP (16.6% and 18.5%) were observed, which were higher than that reported by Yang et al. (5.2% and 6.5%) [16]. However, the resistance rates in Table 2 indicated that the two antibiotics were more suitable for the empiric therapy of the infection of ESC-resistant S. sonnei than that of ESC-resistant S. flexneri infection. Fluoroquinolones are the popular antibiotics for the treatment of serious shigellosis in both adults and children. Research results from Gu et al. [23] showed the resistance rate to CIP was 29.1% between 2007 and 2009 in the Asia-Africa area. Data from Henan Province, China displayed that 21% and 79% of S. flexneri strains showed high- or low-level resistance to CIP, respectively [6]. Yang et al. [16] reported that 27.9% and 9.7% Shigella were resistance to CIP and LEV, respectively, in Anhui province, China. In our study, a similar resistance rate to CIP (24.2%) and a higher resistance rate to LEV (16.0%) were exhibited (Table 2). Among the fluoroquinolone resistant isolates, 95.3% (82/86, resistance to CIP) and 89.5% (51/57, resistance to LEV) strains belonged to S. flexneri. The possible cause was that S. flexneri isolates often possessed plasmid-mediated quinolone resistance (PMQR) determinants or mutations in quinolone resistance-determining regions (QRDR) of gyrase and topoisomerase genes. This situation had been described in isolates from other regions of China by Zhang et al. [4], Zhu et al. [24] and Pu et al. [25]. So far, at least 109 variants of CTX-M enzymes (CTX-M-1 to 124) have been described. Of these CTX-Ms, 19 variants (CTX-M-15, 16, 19, 23, 25, 27, 32, 35, 37, 40, 42, 53, 54, 55, 57, 58, 62, 64, 82, 93) exhibit the increased hydrolysis activity against ceftazidime, and the others display a much higher rate of hydrolysis of cefotaxime than ceftazidime [26]. CTX-M-15 is the most usually detected CTX-M variant that hydrolyze ceftazidime at high level in enterobacteriaceae [26]. In this study, 28 bla positive ESC-resistant Shigella isolates were all resistant to ceftazidime (data not shown). No other CTX-M variant genes mediating high level ceftazidime resistance were found (Table 3). In the bla genes with higher catalytic efficiencies against cefotaxime than ceftazidime, bla was the most prevalent one (53.0%), and coincides with the data published worldwide in clinically important pathogens [26]. OXA-30 belongs to the class D oxacillinase group III, and mediates resistance to cefepime but not ceftazidime [27]. Unfortunately, 52 (26.3%) of our ESC-resistant Shigella isolates hosted bla, and 12 of them carried bla concomitantly and conferred resistance to cefotaxime, ceftazidime and cefepime (Table 3). In the past decade, an emergence of ESBL-producing Shigella spp. carrying different types of ESBL genes has been described in different countries and regions [28]. However, only a few studies have reported in the world the existence of AmpC β-lactamases encoded by bla or bla in Shigella spp. [4,25,28-31]. In this study, we also found 2 AmpC β-lactamase producers with bla and bla in the three-dimensional extract test positive Shigella strains. The bla and the bla existed in 1 S. flexneri with bla and 1 S. sonnei with bla and bla, respectively (Table 3). In this study, we detected several pathogenic genes (ial, ipaH, set1, sen and virA) for 198 ESC- resistant Shigella isolates (Table 4). It has been shown that ial takes responsibility for penetration of epithelial cell by Shigella and ipaH also for spread from cell to cell [32,33]. All Shigella species studied were positive for the ipaH as expected because this gene exists in multiple copies on both the chromosome and the plasmid of Shigella. Conversely, the ial gene is exclusively located on the plasmid and was only detected in some Shigella isolates [8]. Indeed, less frequent examination of ial gene had been described by Luscher and Altwegg [34], Kingombe et al. [35] and Thong et al. [36]. However, this gene was found in all our ESC-resistant Shigella strains. Another virulence factor VirA is involved in the uptake, motility, and cell to cell transmission of Shigella within the human host. It is an essential virulence factor in Shigella disease pathogenesis [9]. The positive rate of virA implied all the isolates of our collection might have the ability (Table 4). The set1 chromosomal gene encodes Shigella enterotoxin 1 (ShET-1, composed of one A and five B subunits), which is generated by S. flexneri (mainly in type 2a) and not found in other Shigella spp. [8,12,36-41]. The sen gene encoding Shigella enterotoxin 2 (ShET-2) is carried on a 140 MDa virulence plasmid. And the sen is present in all Shigella species. The both toxins are deemed to play a part in the clinical manifestation of shigellosis [8]. In our study, 79.3% of ESC-resistant S. flexneri strains were found to be set1A and set1B positive (62.1% isolates were serotype f2a, Table 4), and this is agreement with the previous results; however, 17.1% (24/140) ESC-resistant S. sonnei isolates also carried set1A and/or set1B genes (Table 4). The set1A and set1B genes are located on the she pathogenicity island (PAI), a chromosomal, laterally acquired, integrative element of S. flexneri[37]. Integrase-mediated excision can occur for the she PAI, and result in the formation of a circular excision product, which is a substrate for lateral transfer processes e.g. conjugation, packaging into phage particles and recombinase-mediated integration into the chromosome [42]. This may be the cause that the two determinants can be found in our ESC-resistant S. sonnei isolates studied. And the deficiency of set1A or set1B, or the existence of point mutations in the primer binding sites may be the possible explanation for the both genes not coexisting in some ESC-resistant S. sonnei isolates (Table 4). Furthermore, we found that the S. flexneri isolates with set1 were more resistance to CIP, LEV (p < 0.001, each) and FEP (p = 0.019) than those without set1; for S. sonnei, the set1 positive isolates were more likely resistance to SAM (p < 0.001), CIP, LEV (p < 0 .001, each) and FEP (p = 0.002), and more likely sensitivity to CAZ (p = 0.005) than set1 negative ones (data not shown). Nevertheless, we do not think there was correlation between set1 and the antibiotics resistance, because none of reports have described currently that the invasion genetic elements carrying virulence genes known contain resistance determinants simultaneously in Shigella spp.. These resistance differences may be only due to the spread of resistant plasmids among the different strains. The results of ERIC-PCR typing showed that most of the cases of ESC-resistant S. flexneri and S. sonnei infections were caused by several identical strains, respectively [for S. flexneri isolates, the percentage of type A and type B accounting for 63.8% (37/58); for S. sonnei, type A, type B and type C encompassing 69.3% (97/140) of the isolates]. This indicates that clonal dissemination was likely to contribute most to the spread of ESC-resistant S. flexneri and S. sonnei within the region studied. Of 46 ESC-resistant S. flexneri isolates with the second largest number of the virulence gene composition (ia1 + ipaH + virA + setlA + setlB + sen) being resistant to 4 to 8 antibiotics, 60.3% belonged to type A (43.1%) and type B (17.2%). Of 114 ESC-resistant S. sonnei isolates with the first largest number of the virulence gene composition (ia1 + ipaH + vir + sen) being resistant to 3 to 6 antibiotics, 71.1% belonged to type A (57.9%) and type B (13.2%), but isolates that hosted the set1 gene were more heterogeneous in ERIC-PCR pattern. In the present study all the Shigella strains were isolated from intestinal clinic patients. No patients had been hospitalized or died following episodes of shigellosis. According to the clinical reports, early stage of shigellosis the patients infected by ESBL genes positive isolates were not more severe than those of the patients infected by ESBL genes negative isolates. However, most of these patients had longer course of treatment, because physicians used to treat diarrhea by prescribing cefotaxime or ceftriaxone (particularly for children) in the region studied. When treatment failed, other drugs (such as fluoroquinolone or β-lactamase inhibitors) would be used as a substitute for continuing treatment. In addition, all the patients with Shigella infection in the study were treated with antibiotics, therefore, we had no relevant data to compare the course of disease treated using antibiotics with that of disease treated without antibiotics.

Conclusions

This investigation found a striking difference from other regions of China with relatively low economic status in the distribution of species, from S. flexneri to S. sonnei, and a high prevalence of ESC-resistance among Shigella isolates. Antibiotic susceptibility testing displayed ESC-resistant S. flexneri isolates were much more resistant than ESC-resistant S. sonnei isolates. The analysis of extended-spectrum cephalosporin resistance genes showed the spread of the Shigella harboring a combination of genes bla and bla. This combination may be a serious threat to infection treatment because it is spread by conjugation and it displays high levels of resistance to cefotaxime, ceftazidime and cefepime. We also described the prevalence of virulence genes in ESC-resistant Shigella, which may provide clues about the pathogenicity difference of this type of bacteria. ERIC-PCR typing supported the existence of specific clones responsible for the ESC-resistant S. flexneri and S. sonnei infection cases in the region studied. In China, especially in some undeveloped regions, there were limited and sporadic data on the epidemiology of Shigella spp. Therefore, we suggest the Ministry of Health National Antimicrobial Resistance Investigation Net (Mohnarin) to reinforce the surveillance for the development of antibiotic resistance and take measures to control shigellosis in China.

Abbreviations

ESC: Extended-spectrum cephalosporin; ESBL: Extended-spectrum beta-lactamase; S. flexneri: Shigella flexneri; S. sonnei: Shigella sonnei; CLSI: Clinical laboratory standards institute; PCR: Polymerase chain reaction; ERIC-PCR: Enterobacterial repetitive intergenic consensus sequence polymerase chain reaction; SPSS: Statistical package for social sciences.

Competing interests

The authors declare no conflict of interests.

Authors’ contributions

CLZ performed the experiments; QZL designed the study, analyzed the clinical data and wrote this manuscript; JW, XC, LMS and YYG collected the clinical samples. All authors read and approved the final manuscript.

Pre-publication history

The pre-publication history for this paper can be accessed here: http://www.biomedcentral.com/1471-2334/14/260/prepub
  41 in total

1.  Detection of plasmid-mediated AmpC beta-lactamase genes in clinical isolates by using multiplex PCR.

Authors:  F Javier Pérez-Pérez; Nancy D Hanson
Journal:  J Clin Microbiol       Date:  2002-06       Impact factor: 5.948

2.  Prevalence of the genes for shigella enterotoxins 1 and 2 among clinical isolates of shigella in Israel.

Authors:  M Yavzori; D Cohen; N Orr
Journal:  Epidemiol Infect       Date:  2002-06       Impact factor: 2.451

3.  Detection of plasmid-mediated quinolone resistance determinants and the emergence of multidrug resistance in clinical isolates of Shigella in SiXian area, China.

Authors:  Yu-lin Zhu; Hai-fei Yang; Yan-yan Liu; Li-fen Hu; Jun Cheng; Ying Ye; Jia-bin Li
Journal:  Diagn Microbiol Infect Dis       Date:  2013-03       Impact factor: 2.803

4.  Molecular subtyping methods for detection of Salmonella enterica serovar Oranienburg outbreaks.

Authors:  Toshio Kumao; William Ba-Thein; Hideo Hayashi
Journal:  J Clin Microbiol       Date:  2002-06       Impact factor: 5.948

5.  Occurrence and detection of AmpC beta-lactamases among Escherichia coli, Klebsiella pneumoniae, and Proteus mirabilis isolates at a veterans medical center.

Authors:  P E Coudron; E S Moland; K S Thomson
Journal:  J Clin Microbiol       Date:  2000-05       Impact factor: 5.948

6.  Complete genome sequence and comparative genomics of Shigella flexneri serotype 2a strain 2457T.

Authors:  J Wei; M B Goldberg; V Burland; M M Venkatesan; W Deng; G Fournier; G F Mayhew; G Plunkett; D J Rose; A Darling; B Mau; N T Perna; S M Payne; L J Runyen-Janecky; S Zhou; D C Schwartz; F R Blattner
Journal:  Infect Immun       Date:  2003-05       Impact factor: 3.441

7.  High prevalence of antibiotic resistance and molecular characterization of integrons among Shigella isolates in Eastern China.

Authors:  Yun Shen; Huimin Qian; Junjun Gong; Feifei Deng; Chen Dong; Lu Zhou; Hongxiong Guo
Journal:  Antimicrob Agents Chemother       Date:  2013-01-14       Impact factor: 5.191

8.  Surveillance of antimicrobial susceptibility patterns among Shigella species isolated in China during the 7-year period of 2005-2011.

Authors:  Haifei Yang; Guosheng Chen; Yulin Zhu; Yanyan Liu; Jun Cheng; Lifen Hu; Ying Ye; Jiabin Li
Journal:  Ann Lab Med       Date:  2013-02-21       Impact factor: 3.464

Review 9.  Causative species and serotypes of shigellosis in mainland China: systematic review and meta-analysis.

Authors:  Zhili Chang; Shuting Lu; Lihong Chen; Qi Jin; Jian Yang
Journal:  PLoS One       Date:  2012-12-20       Impact factor: 3.240

10.  Shigella in Brazilian children with acute diarrhoea: prevalence, antimicrobial resistance and virulence genes.

Authors:  Mireille Ângela Bernardes Sousa; Edilberto Nogueira Mendes; Guilherme Birchal Collares; Luciano Amedée Péret-Filho; Francisco José Penna; Paula Prazeres Magalhães
Journal:  Mem Inst Oswaldo Cruz       Date:  2013-02       Impact factor: 2.743

View more
  18 in total

Review 1.  Shigella flexneri: an emerging pathogen.

Authors:  Iqbal Nisa; Muhammad Qasim; Nusrat Yasin; Rafi Ullah; Anwar Ali
Journal:  Folia Microbiol (Praha)       Date:  2020-02-05       Impact factor: 2.099

2.  In Vitro Resistance Selection in Shigella flexneri by Azithromycin, Ceftriaxone, Ciprofloxacin, Levofloxacin, and Moxifloxacin.

Authors:  George P Allen; Kayla A Harris
Journal:  Antimicrob Agents Chemother       Date:  2017-06-27       Impact factor: 5.191

3.  Novel mutations in quinolone resistance-determining regions of gyrA, gyrB, parC and parE in Shigella flexneri clinical isolates from eastern Chinese populations between 2001 and 2011.

Authors:  T Qin; R Bi; W Fan; H Kang; P Ma; B Gu
Journal:  Eur J Clin Microbiol Infect Dis       Date:  2016-09-12       Impact factor: 3.267

4.  Profiling of Virulence-associated Factors in Shigella Species Isolated from Acute Pediatric Diarrheal Samples in Tehran, Iran.

Authors:  Sajad Yaghoubi; Reza Ranjbar; Mohammad Mehdi Soltan Dallal; Somayeh Yasliani Fard; Mohammad Hasan Shirazi; Mahmood Mahmoudi
Journal:  Osong Public Health Res Perspect       Date:  2017-06-30

5.  Prospective study on the overuse of blood test-guided antibiotics on patients with acute diarrhea in primary hospitals of China.

Authors:  Xinghui Liu; Xueke Tong; Liyin Jin; Minghao Ha; Feng Cao; Fengxia Xu; Yongbin Chi; Denghai Zhang; Limin Xu
Journal:  Patient Prefer Adherence       Date:  2017-03-14       Impact factor: 2.711

6.  Genome sequence of Shigella flexneri strain SP1, a diarrheal isolate that encodes an extended-spectrum β-lactamase (ESBL).

Authors:  Ping Shen; Jianzhong Fan; Lihua Guo; Jiahua Li; Ang Li; Jing Zhang; Chaoqun Ying; Jinru Ji; Hao Xu; Beiwen Zheng; Yonghong Xiao
Journal:  Ann Clin Microbiol Antimicrob       Date:  2017-05-12       Impact factor: 3.944

7.  Molecular characterization of fluoroquinolone and/or cephalosporin resistance in Shigella sonnei isolates from yaks.

Authors:  Zhen Zhu; Yuxiang Shi; Xuzheng Zhou; Bing Li; Jiyu Zhang
Journal:  BMC Vet Res       Date:  2018-06-07       Impact factor: 2.741

8.  Virulence and Stress Responses of Shigella flexneri Regulated by PhoP/PhoQ.

Authors:  Zhiwei Lin; Xia Cai; Mingliang Chen; Lina Ye; Yang Wu; Xiaofei Wang; Zhihui Lv; Yongpeng Shang; Di Qu
Journal:  Front Microbiol       Date:  2018-01-15       Impact factor: 5.640

9.  Low distribution of genes encoding virulence factors in Shigella flexneri serotypes 1b clinical isolates from eastern Chinese populations.

Authors:  Wenting Fan; Huimin Qian; Wenkang Shang; Chen Ying; Xuedi Zhang; Song Cheng; Bing Gu; Ping Ma
Journal:  Gut Pathog       Date:  2017-12-16       Impact factor: 4.181

10.  Dominant serotype distribution and antimicrobial resistance profile of Shigella spp. in Xinjiang, China.

Authors:  Hongbo Liu; Binghua Zhu; Shaofu Qiu; Yidan Xia; Beibei Liang; Chaojie Yang; Nian Dong; Yongrui Li; Ying Xiang; Shan Wang; Jing Xie; Muti Mahe; Yansong Sun; Hongbin Song
Journal:  PLoS One       Date:  2018-04-03       Impact factor: 3.240

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.