Literature DB >> 28781945

Profiling of Virulence-associated Factors in Shigella Species Isolated from Acute Pediatric Diarrheal Samples in Tehran, Iran.

Sajad Yaghoubi1, Reza Ranjbar2, Mohammad Mehdi Soltan Dallal1,3, Somayeh Yasliani Fard4, Mohammad Hasan Shirazi1, Mahmood Mahmoudi5.   

Abstract

OBJECTIVES: The genus Shigella comprises the most infectious and diarrheagenic bacteria causing severe diseases, mostly in children under five years of age. This study aimed to detect nine virulence genes (ipaBCD, VirA, sen, set1A, set1B, ial, ipaH, stx, and sat) in Shigella species (spp.) using multiplex polymerase chain reaction (MPCR) and to determine the relation of Shigella spp. from pediatric diarrheal samples with hospitalization and bloody diarrhea in Tehran, Iran.
METHODS: Shigella spp. were isolated and identified using standard microbiological and serological methods. The virulence genes were detected using MPCR.
RESULTS: Seventy-five Shigella spp. (40 S. sonnei, 33 S. flexneri, 1 S. dysenteriae, and 1 S. boydii) were isolated in this study. The prevalence of ial, sen, sat, set1A, and set1B was 74.7%, 45.4%, 28%, 24%, and 24%, respectively. All S. flexneri isolates, while no S. sonnei, S. dysenteriae, or S. boydii isolates, contained sat, set1A, and set1B. All isolates were positive for ipaH, ipaBCD, and virA, while one (1.4%) of the isolates contained stx. The highest prevalence of virulence determinants was found in S. flexneri serotype IIa. Nineteen (57.6%) of 33 S. flexneri isolates were positive for ipaBCD, ipaH, virA, ial, and sat. The sen determinants were found to be statistically significantly associated with hospitalization and bloody diarrhea (p = 0.001).
CONCLUSION: This study revealed a high prevalence of enterotoxin genes in S. flexneri, especially in serotype 2a, and has presented relations between a few clinical features of shigellosis and numerous virulence determinants of clinical isolates of Shigella spp.

Entities:  

Keywords:  Iran; Shigella; diarrhea; gene profile; pediatrics; virulence gene

Year:  2017        PMID: 28781945      PMCID: PMC5525559          DOI: 10.24171/j.phrp.2017.8.3.09

Source DB:  PubMed          Journal:  Osong Public Health Res Perspect        ISSN: 2210-9099


INTRODUCTION

Shigellosis, or bacillary dysentery, continues to be a public health concern worldwide, mainly in the underdeveloped and developing regions with poor hygiene and limited access to clean drinking water [1,2]. The genus Shigella is divided into four serogroups—S. dysenteriae (serogroup A), S. flexneri (serogroup B), S. boydii (serogroup C), and S. sonnei (serogroup D) [3]. Shigellosis is an invasive illness of the human colon that leads to varied clinical symptoms ranging from mild watery diarrhea to severe colitis [4]. The pathogenesis of shigellosis is related to various virulence factors located in the chromosome or large virulent inv plasmids [5]. Colonization—in which epithelial cell penetration and modification of the host response towards infection for dissemination from cell to cell occurs—is mediated by an invasion-associated locus (ial) and the invasion plasmid antigen H (ipaH) genes, respectively [6,7]. Chromosomal genes, set1A and set1B, encode the Shigella enterotoxin 1 (ShET-1), and are among the factors associated with the watery phase of diarrhea [8]. Shigella enterotoxin 2 (ShET-2) is involved in invasion and is located in large virulent plasmids [8]. ShET-1 and ShET-2, in addition to their enterotoxic activity, play an important role in the transport of electrolytes and water in the intestine [9]. Plasmid-encoded toxin (pet), secreted auto-transporter toxin (sat), and Shigella IgA-like protease homologue (SigA) are members of the class 1 serine protease autotransporters of Enterobacteriaceae (SPATEs) [8,9]. VirA are located on large virulent plasmids and act as virulence determinants in intercellular spreading and invasion [8-10]. Two distinct shiga toxins, stx-1 and stx-2, are encoded by chromosomal genes and expressed only by S. dysenteriae serotype 1 and are similar to the shiga-like toxins of enterohemorrhagic Escherichia coli (EHEC) [11]. These toxins lead to the expansion of vascular lesions in the kidney, central nervous system, and colon in a large number of cell types [12]. Because of the high toxicity of the shiga toxin, infections with S. dysenteriae serotype 1 commonly have life-threatening complications [13]. Numerous studies have been conducted on the prevalence and antimicrobial resistance of Shigella species, both in Iran and other countries [13,14]. The aim of the present study was to detect nine virulence genes (ipaBCD, VirA, sen, set1A, set1B, ial, ipaH, stx, and sat) in Shigella species (spp.) using the multiplex polymerase chain reaction (MPCR) and to determine the relation of Shigella spp. from pediatric diarrheal samples with hospitalization and bloody diarrhea in Tehran, Iran.

MATERIALS AND METHODS

1. Clinical samples and laboratory identification

Seventy-five Shigella strains, including S. sonnei (n = 40), S. flexneri (n = 33), S. dysenteriae (n = 1), and S. boydii (n = 1), were used in this cross-sectional study. These strains were isolated from 946 non-duplicative stool samples from pediatric patients with diarrhea in Tehran, Iran, during an 18-month period from May 2015 to October 2016. The presence or absence of bloody diarrhea and any history of hospitalization were reported by the individual responsible for the clinical evaluation. Cary-Blair transport medium (Oxoid, Basingstoke, Hampshire, UK) was used for sample transportation to the laboratory, where each sample was subjected to immediate testing. In the laboratory, all specimens were cultured in different differential media, including xylose lysine desoxycholate (XLD) agar and Hektoen enteric agar (HEA) (Merck, Darmstadt, Germany), and then incubated at 37°C for 24 hours. All grown colonies were identified using a conventional biochemical culture base and a microbiological API 20E kit (bioMerieux, Marcy l’Etoile, France). Serological tests were performed on the Shigella strains using the slide agglutination method [14]. The serotypes of all Shigella isolates were determined with commercially available polyclonal- and monoclonal-specific antisera (Denka Seiken, Tokyo, Japan) against all Shigella serotypes, including S. sonnei 1 and 2, polyvalent S. flexneri, S. dysenteriae 1, and polyvalent S. boydii. S. boydii ATCC 9207, S. dysenteriae ATCC 13313, S. sonnei ATCC 1202, and S. flexneri ATCC 9290 were used as quality controls in each test. All strains were stored in Luria-Bertani broth containing 50% glycerol at −80°C until use.

2. MPCR method

Each sample was subjected to MPCR amplification using 14 pairs (nine virulence genes and five species-specific genes) of different primers (Table 1 [15-18]); MPCR with various Tm details are shown in Table 1. MPCR was performed using a polymerase chain reaction (PCR) instrument with mastercycler gradient (PEQLAB, Erlangen, Germany) for the detection of various virulence- and species-specific genes (set1A/set1B, ial/virA, sen/ipaBCD, sat, stx, and ipaH). The overnight-grown colonies on the XLD agar plates were picked for template genomic DNA extraction by the boiling method. The total volume of the MPCR mixture was 20 μL, containing 0.5 μL extracted template DNA, 2.0 μL 10× PCR buffer, 0.5 μL MgCl2 (50 mM), 0.5 μL deoxynucleotides (10 mM), 0.5 μL each virulence gene primer, 0.5 μL Taq DNA polymerase (5 U/μL) (Amplicon Co., Copenhagen, Denmark), and 13 μL ddH2O (In set1A/set1B, 2 μL H2O was added).
Table 1

Primer sequences for detection of virulence genes

Gene targetedPrimerSequenceProduct size (bp)ReferenceTm
set1AShET-1AF: 5′-TCACGCTACCATCAAAGA-3′309[15]55
R: 5′-TATCCCCCTTTGGTGGTA-3′
set1BShET-1BF: 5′-GTGAACCTGCTGCCGATATC-3′147[15]55
R: 5′-ATTTGTGGATAAAAATGACG-3′
satSat1F: 5′-ACTGGCGGACTCATGCTGT-3′387[17]55
R: 5′-AACCCTGTAAGAAGACTGAGC-3′
ialIal1F;CTGGATGGTATGGTGAGG320[15]58
R;GGAGGCCAACAATTATTTCC
ipaHShig1F: 5′-TGGAAAAACTCAGTGCCTCT-3′423[16]58
R: 5′-CCAGTCCGTAAATTCATTCT-3′
virAvirAF-CTGCATTCTGGCAATCTCTTCACATC215[15]58
R-TGATGAGCTAACTTCGTAAGCCCTCC
StxStx1F: 5′-CAGTTAATGTGGTTGCGAAG-3′895[15]60
R: 5′-CTGCTAATAGTTCTGCGCATC-3′
senShET2F: 5′-ATGTGCCTGCTATTATTTAT-3′799[15]60
R: 5′-CATAATAATAAGCGGTCAGC-3′
ipaBCDipaBCDF: 5′-GCTATAGCAGTGACATGG-3′612[18]60
R: 5′-ACGAGTTCGAAGCACTC-3′
The MPCR conditions for the amplification of virulence genes included an initial denaturation at 94°C for 60 seconds, 35 cycles of denaturation at 94°C for 60 seconds, annealing at 58°C (variable) for 90 seconds, and extension at 72°C for 60 seconds, as well as a final extension at 72°C for 7 minutes. The reaction mixture was completed in a thermal gradient cycler (PEQLAB) for the detection of species-specific genes using the following MPCR procedure: pre-denaturation at 95°C for 1 minutes, 35 cycles with denaturation at 94°C for 35 seconds, annealing at 55°C for 90 seconds, extension at 72°C for 30 seconds, and final extension at 72°C for 7 minutes. The PCR products were subjected to electrophoresis using 1.0% agarose gel, stained with ethidium bromide, and observed under ultraviolet light. Statistical analysis was then conducted for each of the virulence determinants. The analysis included cross-tabulation and the performance of the Pearson chi-square test of independence. Levels of significance were determined between the two clinical features (hospitalization and bloody diarrhea) and enterotoxin genes.

RESULTS

1. Shigella species

Of the 946 diarrheal samples, 75 isolates of Shigella spp. were obtained using conventional biochemical and microbiological tests. All isolates were confirmed by the Shigella genus-specific PCR. The prevalence of the Shigella species is shown in Table 2. The species-specific amplification test showed that 40, 33, 1, and 1 strains of S. sonnei, S. flexneri, S. dysenteriae, and S. boydii, respectively, were isolated from all the tested samples. The study was performed on children aged 1–15 years; as anticipated, children over one year of age were more affected by Shigella than the younger children were. The prevalence rate of Shigella spp. varied in different age groups; S. sonnei was identified in 12 (30.0%) isolates in the ≤ 5 years age group and 28 (70.0%) isolates in the < 5 years of age group, while S. flexneri was found in 17 (51.5%) isolates in the ≤ 5 year age group, but this difference was not statistically significant (p = 0.16). Of the total isolates, 45.3% and 54.7% of isolates were associated with males and females, respectively, but this distribution was not significant (p = 0.19).
Table 2

Prevalence and combination of virulence genes among 75 Shigella isolates

Virulence gene (Shigella species)IsolatesIsolates with a combination of genes


ipaBCDVirAsenset1Aset1BipaHialStxsatIIIIIIIVV
S. sonnei (n = 40)40 (100)40 (100)19 (47.5)0 (0)0 (0)40 (100)31 (77.5)0 (0)0 (0)40 (100)31 (77.5)0 (0)0 (0)0 (0)

S. flexneri (n = 33)33 (100)33 (100)15 (45.5)18 (54.5)18 (54.5)33 (100)25 (75.7)0 (0)21 (63.6)33 (100)25 (75.7)19 (57.6)10 (30.3)5 (15.2)

 1a (n = 11)11 (100)11 (100)5 (45.5)0 (0)0 (0)11 (100)9 (81.8)0 (0)5 (45.4)11 (100)9 (81.9)4 (36.3)1 (9.0)0 (0)

 IIa (n = 22)22 (100)22 (100)10 (45.4)18 (81.8)18 (81.8)22 (100)16 (72.7)0 (0)16 (72.7)22 (100)16 (72.7)15 (68.1)9 (40.9)5 (22.7)

S. flexneri vs. S. sonnei (p-value)NANA< 0.862< 0.000< 0.000NA< 0.464NA< 0.000NANANANANA

S. boydii (n = 1)1 (100)1 (100)0 (0)0 (0)0 (0)1 (100)0 (0)0 (0)0 (0)1 (100)0 (0)0 (0)0 (0)0 (0)

S. dysenteriae (n = 1)1 (100)1 (100)0 (0)0 (0)0 (0)1 (100)0 (0)1 (100)0 (0)1 (100)0 (0)0 (0)0 (0)0 (0)

Total75 (100)75 (100)34 (45.4)18 (24)18 (24)75 (100)56 (74.7)1 (1.4)21 (28)75 (100)53 (74.7)19 (25.4)10 (13.4)5 (6.7)

Values are presented as number (%). NA, not available.

Combination of genes: I: ipaBCD + ipaH + virA; II: ipaBCD + ipaH + virA + iaI; III: ipaBCD + ipaH + virA + ial + sat; IV: ipaBCD + ipaH + virA+ ial + sat + sen; V: ipaBCD + ial + ipaH + virA + setlA + setlB + sen + sat.

p < 0.05 was considered statistically significant.

2. Virulence factors

All isolates were positive for the ipaH, ipaBCD, and virA, while only one (1.4%) of all the isolates was positive for the stx (Table 2). The prevalence of the ial, sen, sat, set1A, and set1B was 74.7%, 45.4%, 28.0%, 24.0%, and 24.0%, respectively; the results are shown in Table 2. set1A, set1B, and sat were only detected in S. flexneri isolates. stx is carried by S. dysenteriae. The highest prevalence of virulence determinants was found in S. flexneri. One interesting finding was the simultaneous presence of the ipaBCD, ipaH, virA, and ial in 31 isolates (77.5%) of S. sonnei, while these genes were not found in the nine remaining isolates. In addition, 19 (57.6%) of the 33 S. flexneri isolates were simultaneously positive for the ipaBCD, ipaH, virA, ial, and sat. All S. flexneri, while no S. sonnei, S. dysenteriae, and S. boydii, isolates harbored sat, set1A, and set1B. Between the two Shigella enterotoxin genes, sen was found to be statistically significant and associated with hospitalization and bloody diarrhea (p = 0.001), as shown in Table 3. The remainder of the calculations yielded values in which p < 0.05, and thus were considered to be statistically insignificant in this study.
Table 3

Assessing major Shigella virulence genes associated with main symptoms of shigellosis

Virulence geneHospitalizationOR (CI)p-valueBloody diarrheaOR (CI)p-value
PositiveNegativePositiveNegative
SET.1APositive3 (30.0)15 (23.8)0.7 (0.16–3.1)NS16 (88.9)20 (36.4)3.1 (2.97–6.1)0.001**
Negative7 (70.0)48 (76.2)2 (11.1)35 (63.6)
SET.1BPositive3 (30.0)15 (23.8)0.7 (0.16–3.1)NS16 (88.9)20 (36.4)3.1 (2.97–6.1)0.001**
Negative7 (70.0)48 (76.2)2 (11.1)35 (63.6)
SENPositive10 (100)24 (38.1)1.1 (0.6–2.1)0.001**24 (70.6)12 (30.8)3.2 (1.9–7.2)0.001**
Negative039 (61.9)10 (29.4)27 (69.2)
SATPositive3 (30.0)18 (28.6)0.9 (0.6–1.4)NS18 (85.7)18 (34.6)NRNR
Negative7 (70.0)45 (71.4)3 (14.3)34 (65.4)

Values are presented as number (%).

OR, odds ratio; CI, confidence interval; NS, not significant; NR, not reported.

Analyzed by Fisher’s exact test;

significant difference.

DISCUSSION

In the current study, 75 Shigella isolates were obtained from all the tested stool samples. Conventionally identified isolates of Shigella were confirmed using ipaH-specific PCR assay. In our study, similar to Binet et al.’s study [19], ipaH was detected in all Shigella culture-positive specimens [20]. In accordance with these results, Vu et al. [21] showed that ipaH is carried by all four Shigella species as well as by enteroinvasive E. coli (EIEC). In agreement with Casabonne et al.’s [22] and Cruz et al.’s [23] results, the results of our study revealed that virA and ipaBCD were found to be positive in all the strains. Shigella attaches to the target region through the two receptors, hyaluronan receptor CD44 and integrin α5β1 [24]. Shigella attaches to CD44 through the IpaB determinant, while the IpaBCD complex interacts via α5β1 integrin receptor. Finally, invasion and cytoskeleton reformation occur by the binding of Shigella to the receptors [24,25]. VirA, IcsA/VirG, SopA/IscP, and PhoN2 are important determinants for bacterial penetration into host cells and actin nucleation at one end of the bacterium [8]. Some of the virulence factors mentioned above are also situated in large virulent plasmids. Fifty-six (74.7%) Shigella strains were found to carry ial, in our study; these results are approximately consistent with those of Casabonne et al.’s [22] and Hosseini Nave et al.’s [26] studies. This contrast may be because ial is only located on the virulent plasmid and can cause deletion mutations [26]. Sat was described first in uropathogenic E. coli (UPEC), but has now also been found in Shigella spp. The prevalence of sat in S. flexneri has been found to be 21 (63.6%) [8]. This data conflicts with that of studies conducted in India [27] (56/65, 86.2%) and India 72/75 (96.0%) [28]. A large invasion plasmid gene (sen), which encodes ShET-2, has also been reported in numerous Shigella spp. In this study, 45.4% (34/75; 19 S. sonnei and 15 S. flexneri) isolates carried sen [29]. Similarly, sen has been detected in 37 (66.1%) Shigella isolates in Kerman, Iran [26]. Casabonne et al. [22] showed that of the 100 Shigella isolates, 29 S. flexneri and 11 S. sonnei carried the gene encoding ShET-2. The conflict is likely because of the loss of the large plasmid that contains the gene in different Shigella serogroups and the number of samples. Shigella enterotoxin 1 (ShET-1) is encoded by set located on the chromosomes of several clinical strains of S. flexneri serotype 2 and rarely on those of other serotypes [28]. ShET-1 has been found to stimulate fluid secretion into the intestine, thus, contributing to the watery phase of diarrhea [28,30]. In our study, 18 (24.0%) isolates were found to carry both set1A and set1B. Casabonne et al. [22], Vargas et al. [15], and Cruz et al. [23] showed that the prevalence of set1A and set1B was 7.0% (7/100), 3.92 (2/51), and 36.6 (11/30), respectively. In agreement with previous studies, the present study showed that set1A and set1B were detected only in S. flexneri strains [26]. stx is another virulence determinant related to S. dysenteriae; it is not excreted by the bacteria, but is released only during cell lysis [31]. Only one (1.4%) S. dysenteriae isolate carries stx. Bekal et al.’s [32] study detected S. flexneri isolates harboring the Shiga toxin 1-producing gene. In Gray et al.’s study [33], 21% of the isolates, including S. flexneri 2a, S. flexneri Y, and S. dysenteriae 4, were found to harbor and produce stx. Among Shigella entero-toxin genes, both sen and set enterotoxins are significantly associated with bloody diarrhea. In Cruz et al.’s study [23], ShET-2 was found to contribute to intestinal injury and bloody diarrhea. Farfán et al. [34] reported that the ShET-2 coding sen is responsible for epithelial inflammation; in this research found a combination of the ipaBCD, ipaH, virA, and ial in 31 (77.5%) S. sonnei isolates. In addition, Zhang et al. [16] found that 19 (57.6%) of 33 S. flexneri isolates were positive for ipaBCD, ipaH, virA, ial, and sat simultaneously; however, only sat, set1A, and set1B were detected in S. flexneri strains. They also showed that 2, 123, 8, 12, and 53 of 198 Shigella isolates carried Ia1/ipaH/virA, ia1/ipaH/vir/sen, ia1/ipaH/virA/setlA/sen, ia1/ipaH/virA/setlB/sen, and ia1/ipaH/virA/setlA/setlB/sen, respectively [16]. Of the 100 Shigella isolates, 24 S. flexneri were found to carry set and sen in Casabonne et al.’s study [22]. To the best of our knowledge, this is the first study on the distribution of virulence gene combinations, and these genes are related with hospitalization and bloody diarrhea among Shigella species in Tehran, Iran. In conclusion, this work has demonstrated the high prevalence of two entero-toxins, ShET-1 and ShET-2, in S. flexneri, especially, among the hospitalized pediatric patients who were included in the study population. Among Shigella serotypes, S. flexneri serotype 2a was found to have a high number of virulence determinants. Bloody diarrhea and hospitalization were also found to be associated with the number of virulence determinants. Future studies should investigate the relations between shigellosis symptoms and virulence determinants in Iran.
  30 in total

1.  Prevalence of Shigella enterotoxins 1 and 2 among Shigella strains isolated from patients with traveler's diarrhea.

Authors:  M Vargas; J Gascon; M T Jimenez De Anta; J Vila
Journal:  J Clin Microbiol       Date:  1999-11       Impact factor: 5.948

Review 2.  Shiga toxins and apoptosis.

Authors:  Rama P Cherla; Sang-Yun Lee; Vernon L Tesh
Journal:  FEMS Microbiol Lett       Date:  2003-11-21       Impact factor: 2.742

3.  Pathogenicity of Shigella in healthy carriers: a study in Vientiane, Lao People's Democratic Republic.

Authors:  Bounnanh Phantouamath; Noikaseumsy Sithivong; Sithat Insisiengmay; Yoshio Ichinose; Naomi Higa; Tianyan Song; Masaaki Iwanaga
Journal:  Jpn J Infect Dis       Date:  2005-08       Impact factor: 1.362

4.  IpaA targets beta1 integrins and rho to promote actin cytoskeleton rearrangements necessary for Shigella entry.

Authors:  Kris A Demali; April L Jue; Keith Burridge
Journal:  J Biol Chem       Date:  2006-10-22       Impact factor: 5.157

Review 5.  Bacterial adhesion and entry into host cells.

Authors:  Javier Pizarro-Cerdá; Pascale Cossart
Journal:  Cell       Date:  2006-02-24       Impact factor: 41.582

6.  Structural analysis of phage-borne stx genes and their flanking sequences in shiga toxin-producing Escherichia coli and Shigella dysenteriae type 1 strains.

Authors:  A Unkmeir; H Schmidt
Journal:  Infect Immun       Date:  2000-09       Impact factor: 3.441

7.  Prevalence of Shiga toxin-producing Shigella species isolated from French travellers returning from the Caribbean: an emerging pathogen with international implications.

Authors:  M D Gray; D W Lacher; S R Leonard; J Abbott; S Zhao; K A Lampel; E Prothery; M Gouali; F-X Weill; A T Maurelli
Journal:  Clin Microbiol Infect       Date:  2015-05-14       Impact factor: 8.067

8.  Associations between virulence factors of Shiga toxin-producing Escherichia coli and disease in humans.

Authors:  P Boerlin; S A McEwen; F Boerlin-Petzold; J B Wilson; R P Johnson; C L Gyles
Journal:  J Clin Microbiol       Date:  1999-03       Impact factor: 5.948

9.  High prevalence of antibiotic resistance and molecular characterization of integrons among Shigella isolates in Eastern China.

Authors:  Yun Shen; Huimin Qian; Junjun Gong; Feifei Deng; Chen Dong; Lu Zhou; Hongxiong Guo
Journal:  Antimicrob Agents Chemother       Date:  2013-01-14       Impact factor: 5.191

10.  Increased isolation and characterization of Shigella sonnei obtained from hospitalized children in Tehran, Iran.

Authors:  Reza Ranjbar; Mohammad M Soltan Dallal; Malihe Talebi; Mohammad R Pourshafie
Journal:  J Health Popul Nutr       Date:  2008-12       Impact factor: 2.000

View more
  7 in total

1.  Virulence gene profiles of Shigella species isolated from stool specimens in India: its association with clinical manifestation and antimicrobial resistance.

Authors:  Dhiviya Prabaa Muthuirulandi Sethuvel; Shalini Anandan; Joy Sarojini Michael; Dhivya Murugan; Ayyanraj Neeravi; Valsan Philip Verghese; Kamini Walia; Balaji Veeraraghavan
Journal:  Pathog Glob Health       Date:  2019-06-21       Impact factor: 2.894

2.  Distribution of genes encoding virulence factors of Shigella strains isolated from children with diarrhea in southwest Iran.

Authors:  Nabi Jomehzadeh; Khadijah Ahmadi; Hazhir Javaherizadeh; Maryam Afzali
Journal:  Mol Biol Rep       Date:  2021-02-06       Impact factor: 2.316

3.  Burden, Antibiotic Resistance, and Clonality of Shigella spp. Implicated in Community-Acquired Acute Diarrhoea in Lilongwe, Malawi.

Authors:  Abel F N D Phiri; Akebe Luther King Abia; Daniel Gyamfi Amoako; Rajab Mkakosya; Arnfinn Sundsfjord; Sabiha Y Essack; Gunnar Skov Simonsen
Journal:  Trop Med Infect Dis       Date:  2021-04-28

4.  Case report on a swift shift in uropathogens from Shigella flexneri to Escherichia coli: a thin line between bacterial persistence and reinfection.

Authors:  Kukwah Anthony Tufon; Djike Puepi Yolande Fokam; Youmbi Sylvain Kouanou; Henry Dilonga Meriki
Journal:  Ann Clin Microbiol Antimicrob       Date:  2020-07-29       Impact factor: 3.944

5.  Antimicrobial resistance, virulence & plasmid profiles among clinical isolates of Shigella serogroups.

Authors:  Dhiviya Prabaa Muthuirulandi Sethuvel; Susmitha Perumalla; Shalini Anandan; Joy Sarojini Michael; Naveen Kumar Devanga Ragupathi; Revathi Gajendran; Kamini Walia; Balaji Veeraraghavan
Journal:  Indian J Med Res       Date:  2019-02       Impact factor: 2.375

6.  High Rates of Antimicrobial Resistance and Virulence Gene Distribution Among Shigella spp. Isolated from Pediatric Patients in Tehran, Iran.

Authors:  Mohammadmahdi Karimi-Yazdi; Zohreh Ghalavand; Mahdi Shabani; Hamidreza Houri; Mehrzad Sadredinamin; Marzieh Taheri; Gita Eslami
Journal:  Infect Drug Resist       Date:  2020-02-13       Impact factor: 4.003

7.  Virulence factors and molecular characteristics of Shigella flexneri isolated from calves with diarrhea.

Authors:  Zhen Zhu; Weiwei Wang; Mingze Cao; Qiqi Zhu; Tenghe Ma; Yongying Zhang; Guanhui Liu; Xuzheng Zhou; Bing Li; Yuxiang Shi; Jiyu Zhang
Journal:  BMC Microbiol       Date:  2021-07-16       Impact factor: 3.605

  7 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.