| Literature DB >> 24359443 |
Gareth A Maglennon, Beth S Cook, Alannah S Deeney, Janine T Bossé, Sarah E Peters, Paul R Langford, Duncan J Maskell, Alexander W Tucker, Brendan W Wren, Andrew N Rycroft1.
Abstract
Mycoplasma hyopneumoniae is the cause of enzootic pneumonia in pigs, a chronic respiratory disease associated with significant economic losses to swine producers worldwide. The molecular pathogenesis of infection is poorly understood due to the lack of genetic tools to allow manipulation of the organism and more generally for the Mycoplasma genus. The objective of this study was to develop a system for generating random transposon insertion mutants in M. hyopneumoniae that could prove a powerful tool in enabling the pathogenesis of infection to be unraveled. A novel delivery vector was constructed containing a hyperactive C9 mutant of the Himar1 transposase along with a mini transposon containing the tetracycline resistance cassette, tetM. M. hyopneumoniae strain 232 was electroporated with the construct and tetM-expressing transformants selected on agar containing tetracycline. Individual transformants contained single transposon insertions that were stable upon serial passages in broth medium. The insertion sites of 44 individual transformants were determined and confirmed disruption of several M. hyopneumoniae genes. A large pool of over 10 000 mutants was generated that should allow saturation of the M. hyopneumoniae strain 232 genome. This is the first time that transposon mutagenesis has been demonstrated in this important pathogen and could be generally applied for other Mycoplasma species that are intractable to genetic manipulation. The ability to generate random mutant libraries is a powerful tool in the further study of the pathogenesis of this important swine pathogen.Entities:
Mesh:
Substances:
Year: 2013 PMID: 24359443 PMCID: PMC4028751 DOI: 10.1186/1297-9716-44-124
Source DB: PubMed Journal: Vet Res ISSN: 0928-4249 Impact factor: 3.683
Sequences of oligonucleotides.
| TetM1 | GCCG | |
| TetM2 | GAAA | |
| TetM3 | CGAT | |
| TetM4 | CAGT | |
| Tpn1 | GCG | |
| Tpn2 | CGCCA | |
| P97-1 | CGAT | |
| P97-2 | GAAT | |
| TetMF | N/A | GTGGACAAAGGTACAACGAG |
| TetMR | N/A | CGGTAAAGTTCGTCACACAC |
| Linker-A | N/A | CGACTGGACCTGGA |
| Linker-B | N/A | GATAAGCAGGGATCGGAACCTCCAGGTCCAGTCG |
| L-PCR-C | N/A | GATAAGCAGGGATCGGAACC |
| L-PCR-L | N/A | GATAGGGTTGAGTGTTGTTC |
| L-PCR-R | N/A | TAGTCGGATAGATAAAGTAC |
Sequences of oligonucleotides used in the study are shown. Where appropriate, the restriction enzyme recognition sites added to the 5’ end of the oligonucleotides are underlined.
Figure 1Plasmid maps and construction. Plasmid pTn4001-RVC1 was constructed by replacing the pac gene of pMiniTn4001PsPuro with tetM from plasmid pSRT2 (A). Plasmid pMiniHimar1BSC1 contains a mini transposon incorporating pac conferring resistance to puromycin and the wild-type Himar1 transposase downstream of the Tn4001 native promoter sequence (B)[26]. In the pMHWT-2 plasmid, the pac in pMiniHimar1BSC1 has been replaced with tetM from pSRT2 (C). In plasmid pMHWT-1, the promoter sequence of the M. hyopneumoniae strain 232 P97 gene has been placed upstream of the wild-type Himar1 gene (D). In pMHC9-1, the wild-type Himar1 gene has been replaced with the hyperactive C9 mutant version of the gene (E)[28].
Transformation frequencies using Himar1 constructs.
| pMHWT-2 | 0 | NT |
| pMHWT-1 | 2.5 × 10-6 [1.3 × 10-6] | 9.0 × 10-8 [2.4 × 10-8] |
| pMHC9-1 | 9.3 × 10-6 [4.5 × 10-6] | 3.0 × 10-7 [4.6 × 10-8] |
Mean transformation frequencies (with standard errors) are shown for three separate transformations of M. hyopneumoniae strain 232 using plasmid constructs pMHWT-1, pMHWT-2 and pMHC9-1 in two separate experiments. In experiment 1, 106 CFU were transformed with each plasmid while in experiment 2, 108 CFU were transformed.
Figure 2Microscopic appearance of mutant colonies. M. hyopneumoniae strain 232 was transformed with plasmid pMHC9-1 and within 14 days, tetracycline resistant colonies formed on Friis agar (A). No colonies were observed on “no DNA” control transformations (B). Individual colonies exhibited a similar appearance to non-transformed M. hyopneumoniae colonies. Tiny deposits on the surface of the agar are typically seen and are considered to arise from dead M. hyopneumoniae that have failed to grow in the presence of tetracycline or from proteinaceous material in the fresh yeast extract used (A and B).
Figure 3Analysis of mutant by PCR. M. hyopneumoniae strain 232 was transformed with pMHC9-1. PCR was performed on extracted total DNA from 15 individual transformants (lanes 1–15) for identification of the tetM gene (A) and the pGEM-T plasmid backbone (B). A further 11 transformants underwent a further two rounds of “colony purification”. Total DNA was extracted and linker PCR performed using two primer pairs at either end of the transposon (left and right) (C). The same 11 transformants were passaged 15 times in Friis medium without selection, and all subsequently retained their resistance to tetracycline. Linker PCR was repeated using the same two primer pairs (left and right). Control samples for PCR reactions included: “no template” control (NT); untransformed M. hyopneumoniae strain 232 (NC); plasmid DNA positive control (PC).
Figure 4Southern analysis of mutant Total DNA was extracted from 11 individual transformants of M. hyopneumoniae 232 generated using plasmid pMHC9-1, and subjected to Southern analysis using a probe specific for tetM. Single bands were generated for 10 of the mutants suggesting single transposon insertion sites. Two separate bands were present for mutant 1. No band was present for the untransformed M. hyopneumoniae strain 232 negative control (NC) and an intense band was present for the pMHC9-1 positive control (PC) as expected.
Figure 5Mapping of transposon insertions sites to the genome. Transposon insertion sites were determined by linker PCR and sequencing of PCR products for 44 individual mutants. The location of these insertion sites in the M. hyopneumoniae strain 232 genome is depicted by lines emanating from the circular genome (drawn to scale). Thicker lines indicate the presence of more than one insertion at a given location.
Transposon insertion sites of strain 232 mutants.
| 72 | 84920 | Mhp069 | Unknown |
| 11 | 85345 | Mhp069 | Unknown |
| 40 | 259306 | Tig | Trigger factor |
| 159 | 275721 | NCR | Unknown |
| 50B | 284811 | Mhp261 | Unknown |
| 4 | 299711 | Mhp271 | P97 ciliary adhesion |
| 96 | 318725 | P95 | Outer membrane protein |
| 165 | 318913 | P95 | Outer membrane protein |
| 91 | 359210 | Mhp313 | Unknown |
| 9 | 434381 | Mhp366 | Unknown |
| 34 | 466299 | ulaA | PTS system ascorbate-specific transporter subunit IIC |
| 37 | 522533 | Mhp443 | Unknown |
| 54B | 527019 | Mhp445 | Unknown |
| 156 | 537514 | Mhp446 | Unknown |
| 75 | 540819 | Mhp447 | Unknown |
| 53B | 541339 | Mhp447 | Unknown |
| 102 | 542436 | Mhp447 | Unknown |
| 90 | 542541 | Mhp447 | Unknown |
| 1 | 544071 | Mhp447 | Unknown |
| 78 | 544309 | Mhp447 | Unknown |
| 24 | 544767 | Mhp447 | Unknown |
| 5 | 545264 | Mhp447 | Unknown |
| 68 | 549968 | Mhp447 | Unknown |
| 49 | 549968 | Mhp447 | Unknown |
| 161 | 549968 | Mhp447 | Unknown |
| 52B | 551617 | NCR | Unknown |
| 13 | 552503 | NCR | Unknown |
| 56 | 574428 | NCR | Unknown |
| 66 | 574428 | NCR | Unknown |
| 17 | 608509 | Mhp490 | PTS system fructose-specific transporter subunit IIABC |
| 16 | 652232 | pepF | Oligoendopeptidase F |
| 162 | 653224 | pepF | Oligoendopeptidase F |
| 101 | 653333 | pepF | Oligoendopeptidase F |
| 92 | 653430 | pepF | Oligoendopeptidase F |
| 47 | 672237 | Mhp535 | Unknown |
| 170 | 672318 | Mhp536 | Unknown |
| 63 | 672979 | Mhp537 | Unknown |
| 50 | 686279 | Mhp542 | Unknown |
| 19 | 722926 | ulaA | PTS system ascorbate-specific transporter subunit IIC |
| 2 | 759509 | NCR | Regulatory region of glpD |
| 10 | 788260 | Mhp630 | Unknown |
| 7 | 788457 | Mhp630 | Unknown |
| 12 | 790862 | Mhp631 | Unknown |
| 51B | 856887 | pepP | xaa-pro aminopeptidase |
The locations of transposon insertions within the M. hyopneumoniae strain 232 genome for 44 individual pMHC9-1 transformants are shown. The open reading frame (ORF) or non-coding region (NCR) containing the insertion is shown and, where known, the function of the protein encoded.