Literature DB >> 23658635

Enhanced production of bovine chymosin by autophagy deficiency in the filamentous fungus Aspergillus oryzae.

Jaewoo Yoon1, Takashi Kikuma, Jun-ichi Maruyama, Katsuhiko Kitamoto.   

Abstract

Aspergillus oryzae has been utilized as a host for heterologous protein production because of its high protein secretory capacity and food-safety properties. However, A. oryzae often produces lower-than-expected yields of target heterologous proteins due to various underlying mechanisms, including degradation processes such as autophagy, which may be a significant bottleneck for protein production. In the present study, we examined the production of heterologous protein in several autophagy (Aoatg) gene disruptants of A. oryzae. We transformed A. oryzae gene disruptants of Aoatg1, Aoatg13, Aoatg4, Aoatg8, or Aoatg15, with a bovine chymosin (CHY) expression construct and found that the production levels of CHY increased up to three fold compared to the control strain. Notably, however, conidia formation by the Aoatg gene disruptants was significantly reduced. As large amounts of conidia are necessary for inoculating large-scale cultures, we also constructed Aoatg gene-conditional expression strains in which the promoter region of the Aoatg gene was replaced with the thiamine-controllable thiA promoter. Conidiation by the resultant transformants was clearly enhanced in the absence of thiamine, while autophagy remained repressed in the presence of thiamine. Moreover, these transformants displayed increased CHY productivity, which was comparable to that of the Aoatg gene disruptants. Consequently, we succeeded in the construction of A. oryzae strains capable of producing high levels of CHY due to defects in autophagy. Our finding suggests that the conditional regulation of autophagy is an effective method for increasing heterologous protein production in A. oryzae.

Entities:  

Mesh:

Substances:

Year:  2013        PMID: 23658635      PMCID: PMC3639164          DOI: 10.1371/journal.pone.0062512

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

The filamentous fungus Aspergillus oryzae (Ahlburg) Cohn has the ability to secrete large amounts of proteins and it has been safely used in the preparation of fermented foods for over a thousand year in Japan [1]. Due to these merits, A. oryzae is generally considered to be an outstanding host for the production of heterologous proteins [2], [3]. However, when heterologous proteins derived from higher organisms are expressed in A. oryzae, lower-than-desired yields of the target protein are often obtained [4]–[7]. These reduced yields are thought to result from bottlenecks in the transcription, translation, and secretory pathways of A. oryzae. In our previous research, we observed that the expression of a mutant α-amylase protein with defective disulfide bonds in A. oryzae resulted in accumulation of the protein in the endoplasmic reticulum (ER) [8]. Furthermore, we confirmed that autophagy delivers the misfolded secretory proteins from the ER to vacuoles [9]. Based on these observations, autophagy appears to be a significant process adversely affecting the production of heterologous proteins in A. oryzae. Autophagy, which is a highly conserved intracellular degradation pathway in eukaryotes, functions as a survival mechanism under nutrient starvation conditions by recycling intracellular components [10]. The autophagic process consists of several sequential steps: 1) induction, 2) autophagosome formation, 3) fusion of autophagosomes to lysosomes/vacuoles, and 4) degradation of autophagic bodies [11], [12]. In addition to nutrient recycling, autophagy plays important roles in cell development and differentiation, immune responses, and cell death, and has also been shown to participate in various diseases including cancer [13]. Thus, autophagy is an extremely important system in eukaryotes; however, no studies have examined the mechanisms by which autophagy affects the production of recombinant proteins. Our group previously demonstrated that decreasing protease activity in A. oryzae through the disruption of ten protease genes led to increased productivity of heterologous proteins [14]. Moreover, disruption of the gene coding for the vacuolar protein sorting (Vps) receptor AoVps10 led to decreased transportation of recombinant proteins to vacuoles via the Vps pathway and increased secretion of recombinant proteins in the culture medium [15]. This finding suggests that repression of vacuolar degradation may be effective in enhancing the productivity of heterologous proteins. In the present study, the effect of disruption of genes involved in autophagy on heterologous protein production in A. oryzae was examined. A. oryzae disruptants were constructed for five genes related to autophagy: Aoatg1, encoding a kinase involved autophagy induction [16]; Aoatg13, encoding a component of the AoAtg1 complex [17], [18]; Aoatg4 and Aoatg8, which are essential genes for the formation of autophagosomes and membrane fusion [19]; and Aoatg15, encoding a lipase required for the breakdown of autophagic bodies [20]–[22]. Using the A. oryzae gene disruptants, the production of bovine chymosin (CHY) was measured as a reporter heterologous protein. This is the first report demonstrating that the disruption of autophagy-related genes in a filamentous fungus enhances the production levels of heterologous proteins.

Materials and Methods

Strains, Media, and Transformation

A. oryzae wild-type strain RIB40 and strain NSPlD1, which has a highly efficient gene-targeting background (niaD − sC − ΔpyrG ΔligD) [23], were used as a DNA donor and transformation host, respectively. The strains used and generated in this study are listed in Table 1. Potato Dextrose (PD) agar (Nissui Phamaceutical) medium was used for the growth and maintenance of all strains. PD agar containing 10 µM thiamine was used for harvesting conidia from Aoatg gene-conditional expression strains. M medium [0.2% NH4Cl, 0.1% (NH4)2SO4, 0.05% KCl, 0.05% NaCl, 0.1% KH2PO4, 0.05% MgSO4·7H2O, 0.002% FeSO4·7H2O, and 2% glucose, pH 5.5] supplemented with 0.15% methionine (M+Met) was used as a selective medium for replacing the Aoatg promoter. 5×DPY medium [10% dextrin, 5% polypeptone, 2.5% yeast extract, 0.5% KH2PO4, and 0.05% MgSO4·7H2O, pH 5.5] was used for CHY production. Czapek-Dox (CD) medium (0.3% NaNO3, 0.2% KCl, 0.1% KH2PO4, 0.05% MgSO4·7H2O, 0.002% FeSO4·7H2O, and 2% glucose, pH 5.5) supplemented with 0.0015% methionine was used for niaD-based plasmid integration. Escherichia coli DH5α [supE44 ΔlacU169 (Φ80 lacZ ΔM15) hsdR17 recA1 endA1 gyrA96 thi-1 relA1] was used for DNA manipulation. A. oryzae was transformed according to a previously reported method [1].
Table 1

List of strains used in the study.

Strain nameParental strainGenotypeReference
RIB40Wild-type
NSRKu70-1-1NSAR1 niaD sC adeA- ΔargB::adeA Δku70::argB [36]
NSKu70-AANSRKu70-1-1 niaD sC adeA ΔargB::adeA Δku70::argB adeA [37]
NSKu70-Aoatg1NSRKu70-1-1 niaD sC adeA ΔargB::adeA Δku70::argB ΔAoatg1::adeA [30]
NSKu70-ΔAoatg4-2NSRKu70-1-1 niaD sC adeA ΔargB::adeA Δku70::argB ΔAoatg4::adeA [29]
ΔAoatg8NSR13 niaD sC adeA ΔAoatg8::adeA [28]
NSKu70-ΔAoatg13NSRKu70-1-1 niaD sC adeA ΔargB::adeA- Δku70::argB ΔAoatg13::adeA [29]
NSKu70-ΔAoatg15-10-1NSRKu70-1-1 niaD sC adeA ΔargB::adeA- Δku70::argB ΔAoatg15::adeA [29]
SKu70-AA-AKC1NSKu70-AA niaD::pgAKCN[PamyB::amyB-kex2-CHY::TamyB::niaD]sC adeA ΔargB::adeA Δku70::argB ΔAoatg1::adeA [27]
SKu70-ΔAoatg1-AKC2NSKu70-ΔAoatg1 niaD::pgAKCN[PamyB::amyB-kex2-CHY::TamyB::niaD] sC adeA ΔargB::adeA- Δku70::argB ΔAoatg1::adeA This study
SKu70-ΔAoatg4-AKC1NSKu70-ΔAoatg4-2 niaD::pgAKCN[PamyB::amyB-kex2-CHY::TamyB::niaD] sC adeA ΔargB::adeA Δku70::argB ΔAoatg4::adeA This study
ΔAoatg8-AKC1ΔAoatg8 niaD::pgAKCN[PamyB::amyB-kex2-CHY::TamyB::niaD] sC adeA ΔAoatg8::adeA This study
SKu70-ΔAoatg13-AKC1NSKu70-ΔAoatg13 niaD::pgAKCN[PamyB::amyB-kex2-CHY::TamyB::niaD] sC adeA ΔargB::adeA Δku70::argB ΔAoatg13::adeA This study
SKu70-ΔAoatg15-AKC2NSKu70-ΔAoatg15-10-1 niaD::pgAKCN[PamyB::amyB-kex2-CHY::TamyB::niaD] sC adeA ΔargB::adeA Δku70::argB ΔAoatg15::adeA This study
NSPlD1NSR-ΔlD2 niaD sC adeA ΔargB::adeA ΔligD::argB pyrG [23]
NSlD1NSPlD1 niaD sC adeA ΔargB::adeA ΔligD::argB [14]
SlD-AKC1NSlD1 niaD::pgAKCN[PamyB::amyB-kex2-CHY::TamyB::niaD] sC adeA ΔargB::adeA- ΔligD::argB pyrG- [14]
NSlD-PtA1NSPlD1 niaD sC adeA ΔargB::adeA ΔligD::argB pyrG::[PAoatg1::pyrG-PthiA::Aoatg1]This study
NSlD-PtA4NSPlD1 niaD sC adeA ΔargB::adeA ΔligD::argB pyrG::[PAoatg4::pyrG-PthiA::Aoatg4]This study
NSlD-PtA8NSPlD1 niaD sC adeA ΔargB::adeA ΔligD::argB pyrG::[PAoatg8::pyrG-PthiA::Aoatg8]This study
NSlD-PtA15NSPlD1 niaD sC adeA- ΔargB::adeA- ΔligD::argB pyrG-::[PAoatg15::pyrG-PthiA::Aoatg15]This study
SlD-PtA1-AKCNSlD-PtA1 niaD::pgAKCN[PamyB::amyB-kex2-CHY::TamyB::niaD] sC adeA ΔargB::adeA- ΔligD::argB pyrG::[Aoatg1::pyrG-PthiA::Aoatg1]This study
SlD-PtA4-AKCNSlD-PtA4 niaD::pgAKCN[PamyB::amyB-kex2-CHY::TamyB::niaD] sC- adeA- ΔargB::adeA- ΔligD::argB pyrG::[PAoatg4::pyrG-PthiA::Aoatg4]This study
SlD-PtA8-AKCNSlD-PtA8 niaD::pgAKCN[PamyB::amyB-kex2-CHY::TamyB::niaD] sC adeA ΔargB::adeA ΔligD::argB pyrG-::[PAoatg8::pyrG-PthiA::Aoatg8]This study
SlD-PtA15-AKCNSlD-PtA15 niaD::pgAKCN[PamyB::amyB-kex2-CHY::TamyB::niaD] sC adeA ΔargB::adeA ΔligD::argB pyrG::[PAoatg15::pyrG-PthiA::Aoatg15]This study

Construction of Conditional Expression Strains

Plasmid pgPtA1 was constructed to replace the Aoatg1 promoter with the thiA promoter using the MultiSite Gateway cloning system (Invitrogen). The upstream and N-terminal 1.5-kb regions of the Aoatg1 gene were amplified by PCR using the primer pairs attB4-PAoatg1-F and attB1-PAoatg1-R, and attB2-Aoatg1-F and attB3-Aoatg1-R, respectively (Table 2). The amplified attB-flanked upstream and Aoatg1 fragments were introduced into pDNORTMP4-P1R and pDNORTMP2R-P3, respectively, using the Gateway BP Clonase Reaction Mix (Invitrogen), generating the Entry Clone plasmids pg5′upAoatg1 and pg3′Aoatg1, respectively. The plasmids pg5′upAoatg1 and pg3′Aoatg1, an Entry Clone plasmid containing the A. oryzae pyrG gene as a selective marker and the thiA promoter, and the Destination vector pDESTTMR4-R3 (Invitrogen) were mixed and then subjected to the Gateway LR reaction using the Gateway LR Clonase reaction mix (Invitrogen) to generate pgPtA1. Using plasmid pgPtA1 as a template, the sequence containing the replacement cassette, which consisted of the upstream region of Aoatg1 (1.5 kb), pyrG gene (2.0 kb), thiA promoter (1.3 kb), and N-terminal region of the Aoatg1 gene (1.5 kb), was amplified by PCR with the primers attB4-upAoatg1-F and attB3-Aoatg1-R, and then transformed into A. oryzae NSRKu70-1-1. Recombination was confirmed by Southern blotting using a 1.5-kb fragment of the Aoatg1 gene upstream region as a probe, which was generated by PCR with the primers attB4-upAoatg1-F and attB1-upAoatg1-R (Figure S1).
Table 2

List of primers used in this study.

Primer nameSequence (5'-3')
attB4-PAoatg1-F GGGGACAACTTTGTATAGAAAAGTTGCCTTTCTCCTCTCTACCTTG
attB1-PAoatg1-R GGGGACTGCTTTTTTGTACAAACTTGCCTAAGAGGAGCGTCTACAA
attB2-Aoatg1-F GGGGACAGCTTTCTTGTACAAAGTGGATGTCGTCTTCACACCACAG
attB3-Aoatg1-R GGGGACAACTTTGTATAATAAAGTTGCCGTAGCGTTTCGATCTACA
attB4-PAoatg4-F GGGGACAACTTTGTATAGAAAAGTTGTCATCTTCACTAGAGCTGTCACG
attB1-PAoatg4-R GGGGACTGCTTTTTTGTACAAACTTGTATGGTTGGCTGGGTAGTGAA
attB2-Aoatg4-F GGGGACAGCTTTCTTGTACAAAGTGGATGAACAGTGTAGACATAGGGCG
attB3-Aoatg4-R GGGGACAACTTTGTATAATAAAGTTGCCCTTCTGCCTTGGTTGTAAGTA
attB4-PAoatg8-F GGGGACAACTTTGTATAGAAAAGTTGTCTGAAAGTTGCAAGGTGCG
attB1-PAoatg8-R GGGGACTGCTTTTTTGTACAAACTTGATTGATGGATCGAATCAGTTAATGG
attB2-Aoatg8-F GGGGACAGCTTTCTTGTACAAAGTGGATGCGCTCCAAGTTCAAG
attB3-Aoatg8-R GGGGACAACTTTGTATAATAAAGTTGTTTTCACTACTTATTTTCAATTACC
attB4-PAoatg15-F GGGGACAACTTTGTATAGAAAAGTTGCCGACTAGAAGTAATGTGGC
attB1-PAoatg15-R GGGGACTGCTTTTTTGTACAAACTTGATTTGTTGAGAGGTACCTTATACTTC
attB2-Aoatg15-F GGGGACAGCTTTCTTGTACAAAGTGGATGATTATTTCAAATGCTCTTCTGGG
attB3-Aoatg15-R GGGGACAACTTTGTATAATAAAGTTGTCAGGGTGGCGTGGTGAT

The underlined sequences indicate the MultiSite Gateway attB recombination sites.

The underlined sequences indicate the MultiSite Gateway attB recombination sites. The plasmids pgPtA4, pgPtA8, and pgPtA15 for replacement of the Aoatg4, Aoatg8, and Aoatg15 promoters, respectively, were constructed by the identical method used for replacement of the Aoatg1 promoter. The 1.0-kb upstream region of the Aoatg4 gene and a 1.0-kb fragment containing the Aoatg4 gene were amplified by PCR using the primer pairs attB4-PAoatg4-F and attB1-PAoatg4-R, and attB2-Aoatg4-F and attB3-Aoatg4-R, respectively (Table 2). The 1.0-kb upstream region of the Aoatg8 gene and a 0.9-kb region containing the Aoatg8 gene were amplified by PCR using the primer pairs attB4-PAoatg8-F and attB1-PAoatg8-R, and attB2-Aoatg8-F and attB3-Aoatg8-R, respectively (Table 2). The 1.5-kb upstream region of the Aoatg15 gene and a 1.8-kb region containing the Aoatg15 gene were amplified by PCR using the primer pairs attB4-PAoatg15-F and attB1-PAoatg15-R, and attB2-Aoatg15-F and attB3-Aoatg15-R, respectively (Table 2). All primers were based on the sequence in the A. oryzae genome database (http://www.bio.nite.go.jp/dogan/project/view/AO). The PCR reactions were performed using the genomic DNA of A. oryzae RIB40 [24] as a template.

Southern Blot Analysis

The A. oryzae autophagy gene-conditional expression strains and strains expressing CHY were analyzed by Southern blot analysis. Briefly, after electrophoresis, the digested genomic DNAs of each strain were transferred onto a Hybond N+ membrane (GE Healthcare). The Enhanced Chemiluminescence (ECL) Direct Nucleic Acid Labeling and Detection System (GE Healthcare) and a LAS-4000miniEPUV luminescent image analyzer (Fuji Photo Film) were used for detection.

Western Blot Analysis

CHY-expressing transformants were cultured in 20 ml 5×DPY (pH 5.5) medium at 30°C for 4 days. Four microliters of the culture supernatant was subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis and the separated proteins were then transferred onto a cellulose nitrate membrane (Immobilon-NC; Millipore) using a semi-dry blotting system (Nihon Eido). The membrane was immunostained using a polyclonal rabbit serum against CHY (kindly gifted by Dr. Tsuchiya [25]), followed by treatment with antirabbit immunoglobulin G labeled with horseradish peroxidase (Cotalog No. PI-1000; Vector Laboratories), and bands were visualized using the ECL Advance™ Western Blotting Detection kit (GE Healthcare).

Measurement of CHY Production Yield

The number of conidia harvested from PD agar plates counted using a hemocytometer under the microscope. Approximately 2×105 conidia of the CHY-expressing transformant were inoculated into 20 ml 5×DPY medium (pH 5.5) and thiamine-supplemented 5×DPY medium (pH 5.5), and were then cultured at 30°C for 3–6 days. CHY activity in the culture supernatant was measured by a modification of a method of Foltmann [26] as described previously by Yoon et al. [27]. Briefly, culture supernatant (100 µl) was collected every 24 h and then mixed with 1 ml of a 12% skim milk solution containing 10 mM CaCl2. During the milk-clotting reaction, the mixture was shaken (60 strokes per minute) at room temperature. The time point at which the thin film of milk began to form visible particles was designated as the clotting time. The CHY production level (mg/L) in each sample was estimated from a standard curve of clotting time versus CHY protein concentration that was generated using authentic CHY (Sigma).

Statistics

Microsoft Excel was used as a tool for statistics including means comparisons, standard deviation analyses and t-tests for significance.

Results

Effects of A. oryzae Autophagy (Aoatg) Gene Disruption on CHY Production

To examine the effect of autophagy impairment on heterologous protein production in A. oryzae, gene disruptants of Aoatg1, Aoatg13, Aoatg4, Aoatg8, and Aoatg15, which were previously constructed in our laboratory [28]–[30], were modified to produce CHY by transformation of a CHY expression plasmid fused with AmyB [27]. The plasmid for CHY expression was introduced into the control strain and the autophagy gene disruptants using the niaD gene as the selectable marker. The transformants possessing a single copy of the plasmid, which was integrated homologously at the niaD locus were identified by Southern blot analysis (data not shown). When the Aoatg1, Aoatg4, Aoatg8, and Aoatg15 disruptants expressing CHY were cultured for 5 days at 30°C on PD agar medium, conidia formation was clearly impaired (Figure 1). Under the same conditions, the Aoatg13 disruptant formed a modest conidia (Figure 1).
Figure 1

Phenotype of the A.oryzae autophagy gene disruptants.

Images of the Aoatg disruptants expressing CHY after growth on PD agar plates for 4 days at 30°C.

Phenotype of the A.oryzae autophagy gene disruptants.

Images of the Aoatg disruptants expressing CHY after growth on PD agar plates for 4 days at 30°C. The production levels of CHY by the autophagy gene disruptants were estimated by measuring the milk-clotting activity of the culture supernatant (Figure 2). Each disruptant produced the highest level of CHY after 4 days of cultivation in 5×DPY medium (Figure 2). Compared to the control strain (SlD-AKC1), the production of CHY by the Aoatg1, Aoatg4, and Aoatg8 disruptants was increased by 2.3, 3.1, and 2.5 fold, respectively. In contrast, the Aoatg13 disruptant showed only a slight increase (1.4 fold) in CHY production. Additionally, no significant increase in CHY production by the Aoatg15 disruptant was observed.
Figure 2

Extracellular bovine chymosin (CHY) production by A. oryzae autophagy gene disruptants.

Approximately 2×105 conidia of each strain were inoculated into 20 ml 5×DPY medium (pH 5.5) and the CHY activity in the culture supernatant was measured daily after 3–6 days of growth at 30°C. Three experiments were performed, and the values of the average and standard deviations are represented (*p<0.01, Student’s t test).

Extracellular bovine chymosin (CHY) production by A. oryzae autophagy gene disruptants.

Approximately 2×105 conidia of each strain were inoculated into 20 ml 5×DPY medium (pH 5.5) and the CHY activity in the culture supernatant was measured daily after 3–6 days of growth at 30°C. Three experiments were performed, and the values of the average and standard deviations are represented (*p<0.01, Student’s t test).

Construction of Aoatg Gene-conditional Expression Strains

Disruption of autophagy in A. oryzae has almost no influence on growth on a nutrient-rich medium, but markedly reduces conidia formation. Therefore, we constructed four Aoatg gene-conditional expression strains by replacing the Aoatg1, Aoatg4, Aoatg8, and Aoatg15 promoters with the thiA promoter, whose activity can be controlled by the external concentration of thiamine. The integration of the thiA promoter was confirmed by Southern blotting (Figure S1). Genes under control of the thiA promoter are induced in the absence of thiamine, and have reduced expression levels in the presence of thiamine [31]. To examine conidia formation by the four Aoatg gene-conditional expression strains, each strain was cultured for 4 days on PD agar supplemented with and without thiamine. Conidia were formed by all transformants on the PD agar without thiamine, and yellowish-green colonies were observed (Figure 3A, upper), whereas few conidia were formed by any strain on the PD agar containing thiamine (Figure 3A, lower). Enumeration of the conidia formed per plate showed that the Aoatg1 and Aoatg4 conditional expression strains had a substantial recovery of conidiation, approaching the level of the control strain. In the case of the Aoatg8 and Aoatg15 conditional expression strains, however, conidiation was relatively poorly recovered on PD agar compared to the control strain, although an increased number of conidia were observed compared to their gene disruptants (Figure 3B). These results indicate that a sufficient amount of conidia for inoculation are successfully harvested from the Aoatg gene-conditional expression strains.
Figure 3

Conidiation in autophagy gene-conditional expression strains.

(A) Images of the Aoatg conditional expression strains after growth on PD agar plates supplemented with or without thiamine for 4 days at 30°C. (B) The number of conidia formed per plate are shown for each strain under the indicated conditions. Three experiments were performed, and the values of the average and standard deviations are represented (*p<0.01, Student’s t test).

Conidiation in autophagy gene-conditional expression strains.

(A) Images of the Aoatg conditional expression strains after growth on PD agar plates supplemented with or without thiamine for 4 days at 30°C. (B) The number of conidia formed per plate are shown for each strain under the indicated conditions. Three experiments were performed, and the values of the average and standard deviations are represented (*p<0.01, Student’s t test).

Repression of Aoatg Genes Enhances CHY Production

To examine heterologous protein production in the Aoatg1, Aoatg4, Aoatg8, and Aoatg15 conditional expression strains, the CHY expression plasmid was introduced into these strains, and the transformants possessing a single copy of the plasmid, which was integrated homologously at the niaD locus were identified by Southern blot analysis (data not shown). The production levels of CHY were then measured (Figure 4 and Figure S2). For each strain, conidia formed on PD agar were harvested and inoculated into 5×DPY medium supplemented with and without thiamine. The CHY production level after 4 days of cultivation in the 5×DPY medium increased by 1.7 fold (Aoatg1), 1.7 fold (Aoatg4), 2.4 fold (Aoatg8), and 1.6 fold (Aoatg15) compared to that of the control strain (Figure 4A). Notably, a similar amount of CHY was produced by all strains in the presence and absence of externally supplied thiamine, suggesting that sufficient thiamine to repress the Aoatg gene expression was present in the yeast extract component of the 5×DPY medium. Western blotting analysis using an anti-chymosin antibody revealed an increased level of CHY production in the transformants compared to the control strain (Figure 4B). These results suggested that autophagy in the transformants was repressed during submerged culture in the 5×DPY medium.
Figure 4

Extracellular bovine chymosin (CHY) production by A.oryzae autophagy gene-conditional expression strains.

(A) Approximately 2×105 conidia of the control (SlD-AKC1), SlD-PtA1-AKC, SlD-PtA4-AKC, SlD-PtA8-AKC, and SlDPtA15-AKC strains expressing CHY were inoculated into 20 ml 5×DPY medium (pH 5.5) supplemented with and without thiamine. CHY activities in the culture supernatant were measured after 4 days of growth at 30°C. Five experiments were performed, and the values of the average and standard deviations are represented (*p<0.01, Student’s t test). (B) Western blot analysis of the culture supernatant of the CHY-expressing strains. Mature CHY bands of 35.4 kDa were detected using an anti-CHY antibody.

Extracellular bovine chymosin (CHY) production by A.oryzae autophagy gene-conditional expression strains.

(A) Approximately 2×105 conidia of the control (SlD-AKC1), SlD-PtA1-AKC, SlD-PtA4-AKC, SlD-PtA8-AKC, and SlDPtA15-AKC strains expressing CHY were inoculated into 20 ml 5×DPY medium (pH 5.5) supplemented with and without thiamine. CHY activities in the culture supernatant were measured after 4 days of growth at 30°C. Five experiments were performed, and the values of the average and standard deviations are represented (*p<0.01, Student’s t test). (B) Western blot analysis of the culture supernatant of the CHY-expressing strains. Mature CHY bands of 35.4 kDa were detected using an anti-CHY antibody.

Discussion

Autophagy is an intracellular degradation mechanism that delivers cytoplasmic constituents to vacuoles/lysosomes and has recently been shown to play various complex cytological and physiological roles. However, despite the apparent importance of autophagy in eukaryotes, prior to the present study, no reports have examined modification of the autophagic process for enhancing the industrial production of recombinant heterologous proteins. As we predicted that autophagy is a bottleneck for heterologous protein production by A. oryzae, we transformed several autophagy gene disruptants with a CHY expression construct and confirmed that the production levels of CHY increased up to 3 fold. However, the poor conidiation by autophagy gene disruptants to be used as hosts for heterologous protein production at the industrial scale is problematic, as sufficient numbers of conidia for inoculation are difficult to obtain. Therefore, we also constructed conditional expression strains of each of the four autophagy genes and demonstrated that the transformants formed increased numbers of conidia, in addition to higher CHY production. As part of protein quality control in the ER, misfolded proteins are degraded in the ER-associated protein degradation (ERAD) pathway [32]. Autophagy has been reported to serve as another route for ERAD and appears to degrade misfolded proteins that accumulate in the ER lumen [32]. Furthermore, it has been demonstrated that ER stress leads to the induction of autophagy in yeast and mammals [33], [34]. Thus, we speculate that the improvement of CHY protein productivity in most of the A. oryzae autophagy gene disruptants was due to impairment of the autophagic-induced degradation of CHY that normally occurs as part of the ER protein quality control process. In contrast to the Aoatg1, Aoatg4, Aoatg8, Aoatg13 gene disruptants, the productivity of CHY did not markedly increase in the Aoatg15 gene disruptant. However, increased CHY production was detected in the Aoatg15 conditional expression strain. Notably, the Aoatg15 gene disruptant also displayed the greatest deficiency in the development of aerial hyphae and formation of conidia [29]. Thus, we consider that conidia formed by the Aoatg15 gene disruptant did not fully mature, because the harvested conidia were white in color, indicating they lacked pigment. In contrast, the conidia recovered from the Aoatg15 gene-conditional expression strain appeared green in color, and were therefore considered to be fully mature. These results suggest that mature conidia are insufficient to grow of mycelia, which yield an adequate amount of CHY, in the Aoatg15 disruptant. In addition, the Aoatg13 disruptant formed a modest conidia (Figure 1), indicating that autophagic flux was not completely inhibited. This result was consistent with the reported phenotype of these mutants [29], [30]. The disruptant also showed only a slight increase (1.4 fold) in CHY production. These results suggest that the increase of CHY production was correlated with the repression level of autophagy. In the fission yeast Schizosaccharomyces pombe, disruption of multiple protease genes, including ppp80/atg4, enhances the productivity of human growth hormone (hGH) [35]. However, the atg4 gene was one of seven protease genes that were disrupted based on a search for such genes in the S. pombe genomic database, but the functional effects of atg4 disruption on hGH production were not examined. In the present study, we revealed that autophagy may have direct effects on heterologous protein production in filamentous fungi by examining CHY in several A. oryzae autophagy gene disruptants, including Aoatg4, which is involved in autophagosome formation, but also Aoatg1, Aoatg8, Aoatg13, and Aoatg15. In addition, the observed correlation between the level of CHY production and repression of autophagy (to the extent that reduction in conidia formation indicates a repression of autophagy) also indicates that autophagy can limit heterologous protein production. Recently, we identified Aovps10 encoding an A. oryzae vacuolar protein sorting receptor, AoVps10, which is responsible for the recognition and vacuolar sorting of carboxypeptidase Y. Moreover, we demonstrated that the disruption of Aovps10 in A. oryzae leads to enhanced production levels of heterologous proteins [15]. Therefore, it is expected that control of autophagy gene expression, in addition to the disruption of vacuolar protein sorting receptor gene Aovps10, will synergistically improve heterologous protein productivity in A. oryzae. Despite the successful enhancement of the extracellular production of CHY by the autophagy gene disruption, there still exist proteolytic problems that should be solved. We previously constructed an A. oryzae ten extracellular protease genes disruptant [14]. Thus, another synergy effect of autophagy gene disruptant and the ten protease genes disruptant could be expected. In other words, yields for the heterologous protein production could be efficiently increased when the intracellular (autophagic degradation) and extracellular (proteolysis by proteases) bottlenecks were eliminated. In conclusion, we successfully constructed A. oryzae strains capable of producing high levels of CHY as a model of heterologous protein production due to the repression of autophagy. In addition, to overcome the poor formation of conidia in these strains, the autophagic genes were expressed under control of an inducible promoter. This is the first report to demonstrate that the manipulation of autophagy mechanisms, which have important functions at a basic cellular level, can be applied towards the enhanced production of heterologous proteins. It may be possible to combine this approach for controlling bulk degradation pathways with the disruption of protease genes, which has been demonstrated to be effective [14], [27], for further improving the productivity of heterologous proteins in A. oryzae. Replacement of the promoter. Schemes for the integration of the thiA promoter and Southern blotting in Aoatg1 (A), Aoatg4 (B), Aoatg8 (C), and Aoatg15 (D). (TIFF) Click here for additional data file. Extracellular bovine chymosin (CHY) production by conditional expression strains. (A) Approximately 2×105 conidia of the control and three individual Aoatg8 conditional expression strains expressing CHY were inoculated into 20 ml 5×DPY medium (pH 5.5). CHY activities in the culture supernatant were measured after 4 days of growth at 30°C. Three experiments were performed, and the values of the average and standard deviations are represented (*p<0.01, Student’s t test). (TIFF) Click here for additional data file.
  35 in total

Review 1.  Autophagy in the eukaryotic cell.

Authors:  Fulvio Reggiori; Daniel J Klionsky
Journal:  Eukaryot Cell       Date:  2002-02

2.  Apg1p, a novel protein kinase required for the autophagic process in Saccharomyces cerevisiae.

Authors:  A Matsuura; M Tsukada; Y Wada; Y Ohsumi
Journal:  Gene       Date:  1997-06-19       Impact factor: 3.688

3.  Analyses of APG13 gene involved in autophagy in yeast, Saccharomyces cerevisiae.

Authors:  T Funakoshi; A Matsuura; T Noda; Y Ohsumi
Journal:  Gene       Date:  1997-06-19       Impact factor: 3.688

Review 4.  Autophagy in health and disease: a double-edged sword.

Authors:  Takahiro Shintani; Daniel J Klionsky
Journal:  Science       Date:  2004-11-05       Impact factor: 47.728

5.  Development of Aspergillus oryzae thiA promoter as a tool for molecular biological studies.

Authors:  Jun-Ya Shoji; Jun-ichi Maruyama; Manabu Arioka; Katsuhiko Kitamoto
Journal:  FEMS Microbiol Lett       Date:  2005-03-01       Impact factor: 2.742

6.  Identification and analysis of Ku70 and Ku80 homologs in the koji molds Aspergillus sojae and Aspergillus oryzae.

Authors:  Tadashi Takahashi; Tsutomu Masuda; Yasuji Koyama
Journal:  Biosci Biotechnol Biochem       Date:  2006-01       Impact factor: 2.043

7.  Intravacuolar membrane lysis in Saccharomyces cerevisiae. Does vacuolar targeting of Cvt17/Aut5p affect its function?

Authors:  Ulrike D Epple; Eeva-Liisa Eskelinen; Michael Thumm
Journal:  J Biol Chem       Date:  2002-12-22       Impact factor: 5.157

8.  High level secretion of calf chymosin using a glucoamylase-prochymosin fusion gene in Aspergillus oryzae.

Authors:  K Tsuchiya; T Nagashima; Y Yamamoto; K Gomi; K Kitamoto; C Kumagai; G Tamura
Journal:  Biosci Biotechnol Biochem       Date:  1994-05       Impact factor: 2.043

9.  Secretion of calf chymosin from the filamentous fungus Aspergillus oryzae.

Authors:  K Tsuchiya; K Gomi; K Kitamoto; C Kumagai; G Tamura
Journal:  Appl Microbiol Biotechnol       Date:  1993-11       Impact factor: 4.813

10.  Genome sequencing and analysis of Aspergillus oryzae.

Authors:  Masayuki Machida; Kiyoshi Asai; Motoaki Sano; Toshihiro Tanaka; Toshitaka Kumagai; Goro Terai; Ken-Ichi Kusumoto; Toshihide Arima; Osamu Akita; Yutaka Kashiwagi; Keietsu Abe; Katsuya Gomi; Hiroyuki Horiuchi; Katsuhiko Kitamoto; Tetsuo Kobayashi; Michio Takeuchi; David W Denning; James E Galagan; William C Nierman; Jiujiang Yu; David B Archer; Joan W Bennett; Deepak Bhatnagar; Thomas E Cleveland; Natalie D Fedorova; Osamu Gotoh; Hiroshi Horikawa; Akira Hosoyama; Masayuki Ichinomiya; Rie Igarashi; Kazuhiro Iwashita; Praveen Rao Juvvadi; Masashi Kato; Yumiko Kato; Taishin Kin; Akira Kokubun; Hiroshi Maeda; Noriko Maeyama; Jun-ichi Maruyama; Hideki Nagasaki; Tasuku Nakajima; Ken Oda; Kinya Okada; Ian Paulsen; Kazutoshi Sakamoto; Toshihiko Sawano; Mikio Takahashi; Kumiko Takase; Yasunobu Terabayashi; Jennifer R Wortman; Osamu Yamada; Youhei Yamagata; Hideharu Anazawa; Yoji Hata; Yoshinao Koide; Takashi Komori; Yasuji Koyama; Toshitaka Minetoki; Sivasundaram Suharnan; Akimitsu Tanaka; Katsumi Isono; Satoru Kuhara; Naotake Ogasawara; Hisashi Kikuchi
Journal:  Nature       Date:  2005-12-22       Impact factor: 49.962

View more
  12 in total

1.  Aspergillus Secondary Metabolite Database, a resource to understand the Secondary metabolome of Aspergillus genus.

Authors:  Varahalarao Vadlapudi; Nabajyoti Borah; Kanaka Raju Yellusani; Sriramya Gade; Prabhakar Reddy; Maheshwari Rajamanikyam; Lakshmi Narasimha Santosh Vempati; Satya Prakash Gubbala; Pankaj Chopra; Suryanarayana Murty Upadhyayula; Ramars Amanchy
Journal:  Sci Rep       Date:  2017-08-04       Impact factor: 4.379

2.  Modulating endoplasmic reticulum-Golgi cargo receptors for improving secretion of carrier-fused heterologous proteins in the filamentous fungus Aspergillus oryzae.

Authors:  Huy-Dung Hoang; Jun-ichi Maruyama; Katsuhiko Kitamoto
Journal:  Appl Environ Microbiol       Date:  2014-10-31       Impact factor: 4.792

3.  CRISPR/Cas9-mediated point mutations improve α-amylase secretion in Saccharomyces cerevisiae.

Authors:  Yanyan Wang; Xiaowei Li; Xin Chen; Verena Siewers
Journal:  FEMS Yeast Res       Date:  2022-07-15       Impact factor: 2.923

4.  Enhancing the production of cephalosporin C through modulating the autophagic process of Acremonium chrysogenum.

Authors:  Honghua Li; Pengjie Hu; Ying Wang; Yuanyuan Pan; Gang Liu
Journal:  Microb Cell Fact       Date:  2018-11-13       Impact factor: 5.328

5.  Altered secretion patterns and cell wall organization caused by loss of PodB function in the filamentous fungus Aspergillus nidulans.

Authors:  Karthik R Boppidi; Liliane Fraga Costa Ribeiro; Sirasa Iambamrung; Sidney M Nelson; Yan Wang; Michelle Momany; Elizabeth A Richardson; Stephen Lincoln; Ranjan Srivastava; Steven D Harris; Mark R Marten
Journal:  Sci Rep       Date:  2018-07-30       Impact factor: 4.379

6.  Antiproliferative Illudalane Sesquiterpenes from the Marine Sediment Ascomycete Aspergillus oryzae.

Authors:  Raha Orfali; Shagufta Perveen; Muhammad Farooq Khan; Atallah F Ahmed; Mohammad A Wadaan; Areej Mohammad Al-Taweel; Ali S Alqahtani; Fahd A Nasr; Sobia Tabassum; Paolo Luciano; Giuseppina Chianese; Jyh-Horng Sheu; Orazio Taglialatela-Scafati
Journal:  Mar Drugs       Date:  2021-06-10       Impact factor: 5.118

7.  Autophagy is dispensable to overcome ER stress in the filamentous fungus Aspergillus niger.

Authors:  Anne-Marie Burggraaf; Arthur F J Ram
Journal:  Microbiologyopen       Date:  2016-03-29       Impact factor: 3.139

8.  Production of Bioactive Recombinant Bovine Chymosin in Tobacco Plants.

Authors:  Zheng-Yi Wei; Yu-Ying Zhang; Yun-Peng Wang; Ming-Xia Fan; Xiao-Fang Zhong; Nuo Xu; Feng Lin; Shao-Chen Xing
Journal:  Int J Mol Sci       Date:  2016-04-28       Impact factor: 5.923

9.  Improvement of homologous GH10 xylanase production by deletion of genes with predicted function in the Aspergillus nidulans secretion pathway.

Authors:  Mariane P Zubieta; Jaqueline A Gerhardt; Marcelo V Rubio; César R F Terrasan; Gabriela F Persinoti; Everton P Antoniel; Fabiano J Contesini; Rolf A Prade; André Damasio
Journal:  Microb Biotechnol       Date:  2020-03-25       Impact factor: 5.813

Review 10.  Inducible promoters and functional genomic approaches for the genetic engineering of filamentous fungi.

Authors:  Janina Kluge; Dominik Terfehr; Ulrich Kück
Journal:  Appl Microbiol Biotechnol       Date:  2018-06-02       Impact factor: 4.813

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.