Literature DB >> 23584054

Evaluation of the interaction between long telomeric DNA and macrocyclic hexaoxazole (6OTD) dimer of a G-quadruplex ligand.

Keisuke Iida1, Satoki Majima, Takahiro Nakamura, Hiroyuki Seimiya, Kazuo Nagasawa.   

Abstract

Macrocyclic hexaoxazole dimer of L2H2-6OTD-dimer (3) was newly synthesized as a telomeric G-quadruplex (G4) ligand, and interaction with long telomeric DNAs telo48, 72, and 96 was evaluated by means of electrophoresis mobility shift assay, CD spectra analysis, and CD melting experiments. The L2H2-6OTD-dimer (3) interacted with the long telomeric DNAs by inducing anti-parallel type G4 structure of each unit of 24 bases, i.e., (TTAGGG)₄ sequences. Dimer 3 stabilizes long telomeric DNAs more efficiently than the corresponding monomer of L2H2-6OTD (2). It showed potent inhibitory activity against telomerase, with an IC₅₀ value of 7.5 nm.

Entities:  

Mesh:

Substances:

Year:  2013        PMID: 23584054      PMCID: PMC6269967          DOI: 10.3390/molecules18044328

Source DB:  PubMed          Journal:  Molecules        ISSN: 1420-3049            Impact factor:   4.411


1. Introduction

At the end of chromosomes, there exists a characteristic region called the telomere. The telomere is composed of double-stranded tandem repeats of (TTAGGG/AATCCC)n sequence amounting to 2–30 kb, to which telomere binding proteins are bound [1,2,3,4]. These sequences are shortened at each cell division, ultimately inducing cell senescence. At the extreme end of these duplex repeats there is a single-stranded 3' overhang, termed the 3' G-tail, consisting of ca. 50−250 nucleotides in total. The G-tail sequence is considered to form G-quadruplexes (G4s), one of the higher-order structures of polynucleotides [5]. The G4s are stacked structures of planar G-quartets, consisting of four guanine residues, and these structures are in equilibrium with random structures in the presence of monovalent cations such as Na+ and K+ (Figure 1) [6,7,8,9]. In most cancer cells, the enzyme telomerase is over-expressed. This enzyme catalyzes elongation of telomeric DNA by adding (TTAGGG) repeats in the 3' terminus direction, leading to immortalization of the cells [10,11]. On the other hand, the telomeric G4 structures in cancer cells inhibit telomerase activity, leading to cellular senescence and apoptosis [12,13,14]. Thus, stabilization of telomeric G4 structure by small molecules, i.e., G4 ligands, is considered to be a promising strategy for cancer chemotherapy, and various G4 ligands, both natural and synthetic, have been explored [15,16]. Among them, telomestatin (Figure 2a), a secondary metabolite isolated from Streptomyces anulatus, was found to show extremely potent telomerase inhibitory activity with an IC50 value of 5 nm in TRAP assay [17,18,19,20,21,22]. Consequently, various telomestatin-related macrocyclic polyoxazole compounds have been synthesized [23,24,25,26,27,28,29,30]. We have independently developed macrocyclic hexaoxazole-type telomestatin derivatives of 6OTDs as G4 ligands, and some of them showed potent telomerase-inhibitory activity, as well as G4-stabilizing activity (Figure 2a) [31,32,33,34,35,36,37,38,39,40,41].
Figure 1

Induction of G-quadruplex formation on telomeric DNA by monovalent cations.

Figure 2

.Structures of telomestatin (1), L2H2-6OTD (2) and L2H2-6OTD-dimer (3).

Induction of G-quadruplex formation on telomeric DNA by monovalent cations. For evaluations of interaction and stabilization of telomeric DNA with G4 ligands, telo24 DNA, i.e., four sets of (TTAGGG) repeats consisting of 24 bases in total, has been usually used as a telomeric DNA model, because it is a minimum length able to form one unit of G4 structure [7,8]. L2H2-6OTD (2) (Figure 2), a derivative of the 6OTD series with an amine group on the side chain, strongly interacts with telo24 to form anti-parallel-type G4 structure in an end-stacking mode with two molecules of 2 (Figure 2). However, telomeric DNA possesses ca. 50−250 bases, so that longer telomeric DNA models are required to mimic the behavior of telomeres in living cells [42,43,44,45,46,47,48,49,50,51,52]. Quite recently, we examined the interaction of L2H2-6OTD (2) with long telomeric DNAs telo48, 72, and 96, and these were found to be stabilized in a similar manner to telo24, i.e., each telo24 unit in the long telomeric DNAs interacted with two molecules of L2H2-6OTD (2) in an end-stacking mode, and were induced to take anti-parallel-type topology, as shown in Figure 3b [53]. Based on this schematic interacting model of L2H2-6OTD (2) with long telomeric DNAs, we expected that the dimer-type of 6OTD might more effectively stabilize the “flexible” long telomeric DNA by interaction of one molecule of 6OTD-dimer with each telo24 unit in a sandwich manner (Figure 3) [36,37,38]. In the present work, we evaluated the interaction mode and efficacy of L2H2-6OTD-dimer (3) with long telomeric DNAs by means of electrophoresis mobility shift assay (EMSA), circular dichroism (CD) titration analysis, CD melting experiments and TRAP assay.
Figure 3

(a) Schematic interaction model of telomestatin (1), L2H2-6OTD (2) and L2H2-6OTD-dimer (3)with telo24; (b) Schematic interaction model of L2H2-6OTD (2) with long telomeric DNA.

.Structures of telomestatin (1), L2H2-6OTD (2) and L2H2-6OTD-dimer (3). (a) Schematic interaction model of telomestatin (1), L2H2-6OTD (2) and L2H2-6OTD-dimer (3)with telo24; (b) Schematic interaction model of L2H2-6OTD (2) with long telomeric DNA.

2. Results and Discussion

We designed the L2H2-6OTD-dimer (3) based upon our previous findings, which suggested that it requires about 10–15 Å linker length to interact with one unit of telomeric G4 of telo24 [36]. We chose the triethylene glycol unit as the linker because of its flexibility and hydrophilic nature. Synthesis of L2H2-6OTD dimer (3) is depicted in Scheme 1. The Cbz group in diamine 4 [37] was selectively deprotected with hydrogen in the presence of Pd(OH)2, and the resulting amine was protected with a 2-nitrobenzenesulfonyl (Ns) group to give 5 in 69% yield from 4. The diamine 5 was linked with 1,2-bis(2-iodoethoxy)ethane in the presence of potassium carbonate to give dimer 6 in 53% yield. After conversion of the two Ns groups into Boc groups by treatment with thiophenol followed by (Boc)2O (71% yield in 2 steps), all four Boc groups in 7 were deprotected with TFA to give L2H2-6OTD-dimer (3) in 99% yield. With dimer L2H2-6OTD (3) in hand, we next examined the interaction mode and efficacy of 3 with the long telomeric DNA models.
Scheme 1

Synthesis of the L2H2-6OTD-dimer (3).

Synthesis of the L2H2-6OTD-dimer (3). Reagents and conditions: (a) Pd(OH)2, H2, MeOH: THF (1:1), rt, 5 h; (b) NsCl, Et3N, CH2Cl2:MeOH (9:1), −78 °C to rt, 16 h, 2 steps 69%; (c) 1,2-bis(2-iodoethoxy)ethane, K2CO3, DMF, r.t. 23 h, 53%; (d) PhSH, K2CO3, DMF, rt, 1.5 h; then (Boc)2O, rt, 12 h, 71%; (e) TFA, CH2Cl2, rt, 3 h, 99%. First, interaction of L2H2-6OTD-dimer (3) with the short telomeric DNA model of telo24 was confirmed by EMSA (Figure 4a). In this case, the original band of telo24 was transformed to a smear with increasing equivalents of dimer 3 [54]. Then, the long telomeric DNA models telo48, telo72 and telo96 were subjected to complexation with dimer 3, and the results are summarized in Figure 4b–d [55]. In all cases, the original bands of telomeric DNAs migrated further in proportion to the increment of the ligand 3. Thus, even the longer telomeric DNAs were clearly interacted with dimer type G4 ligand 3. Since each band converged to a single band with a long migration distance in the presence of a sufficient amount of ligand 3, the L2H2-6OTD-dimer (3) was suggested to form a unimolecular ligand-G4 complex with every size of telomeric DNA examined.
Figure 4

Evaluation of the interaction of telomeric DNAs (a) telo24, (b) telo48, (c) telo72, and (d) telo96 with 3 by EMSA.

Evaluation of the interaction of telomeric DNAs (a) telo24, (b) telo48, (c) telo72, and (d) telo96 with 3 by EMSA. Then, the topologies of the G4s obtained from interaction of every size of telomeric DNA with dimer 3 were evaluated by means of CD titration experiments [56]. Telomeric DNAs are known to form multiple G4 topologies, such as parallel, anti-parallel, and hybrid types, and these are usually present as a mixture or in equilibrium, depending upon the conditions [7,8]. When telo24 (10 μM) was titrated with L2H2-6OTD-dimer (3), typical spectral changes indicating a change from hybrid-type to anti-parallel topology were observed, i.e., a shoulder at 268 nm disappeared and a positive Cotton effect at 240 nm and a negative effect at 255 nm appeared (Figure 5a). The topologies of the longer DNAs were also examined by CD spectral titration with 3 in the presence of 100 mM KCl. All the longer telomeric DNAs showed spectral changes quite similar to those of telo24, indicating that dimer 3 induced the increment of the anti-parallel form of the longer telomeric DNAs as well (Figure 5). In these experiments, similar degrees of CD intensity (y-axis in Figure 5) were observed with each length of telomeric DNA in the presence of an excess amount of the ligand 3. Since the concentrations of the DNAs used in the titration were 10 μm for telo24, 5 μm for telo48 (half the concentration of telo24), 3.3 μM for telo72 (one-third of telo24), and 2.5 μm for telo96 (a quarter of telo24), the number of anti-parallel G4 units in telo48, telo72 and telo96 were suggested to be two, three and four, respectively, based upon the case of telo24, which should form one G4 unit (Figure 3).
Figure 5

CD spectra of telomeric DNAs in the presence of KCl (100 mM) upon titration with 3, (a) telo24 (10 μM) + 3 (0–5 eq.), (b) telo48 (5 μM) + 3 (0–10 eq.), (c) telo72 (3.3 μ) + 3 (0–15 eq.) and (d) telo96 (2.5 μM) + 3 (0–20 eq.).

CD spectra of telomeric DNAs in the presence of KCl (100 mM) upon titration with 3, (a) telo24 (10 μM) + 3 (0–5 eq.), (b) telo48 (5 μM) + 3 (0–10 eq.), (c) telo72 (3.3 μ) + 3 (0–15 eq.) and (d) telo96 (2.5 μM) + 3 (0–20 eq.). Next, the stabilization of the topologies obtained from each size of telomeric DNA with 6OTD-dimer 3 was evaluated by means of CD melting experiments, in comparison with the corresponding monomer L2H2-6OTD (2). Each size of telomeric DNA, i.e., telo24, telo48, telo72 and telo96, was incubated with 3 (a half equivalent versus the monomer 2), and the melting temperatures (Tm) for those DNAs were determined (Table 1). The Tm values for telo24, telo48, telo72 and telo96 were found to be 73, 74, 70, and 69 °C, respectively, which are all quite high values compared with that obtained under the ligand-free conditions. In addition, dimer 3 stabilizes every length of telomeric G4 to approximately the same extent as a half equivalent of monomer L2H2-6OTD (2) [53].
Table 1

Tm values (°C) of telomeric DNAs in the absence or presence of G4 ligands 2 and 3 a,b,c.

DNA oligomersLigandsTm
absence59
telo242 (4 eq.)75
3 (2 eq.)73
absence57
telo482 (8 eq.)76
3 (4 eq.)74
absence55
telo482 (12 eq.)73
3 (6 eq.)70
absence55
telo482 (16 eq.)70
3 (8 eq.)69

a Tm values were obtained by monitoring the CD bands at 295 nm in the presence of KCl (100 mM). b Melting temperature is defined as the temperature at 0.5 value of normalized CD [mdeg]. c Values for the monomer 2 were previously reported [53].

Finally, we examined the telomerase inhibitory activities of the L2H2-6OTD monomer (2) and its dimer 3 in a cell-free system by telomerase repeat amplification protocol (TRAP) assay using PC3 cell lysate [10]. Telomerase is known to elongate various lengths of telomere sequences, and the stabilization ability of each ligand can be evaluated with TRAP assay. In this assay, the monomer 2 and dimer 3 showed telomerase inhibitory activity with IC50 values of 15 nM and 7.6 nm, respectively, and the dimer 3 was also found to be more effective than the monomer 2 at the in vitro level. Tm values (°C) of telomeric DNAs in the absence or presence of G4 ligands 2 and 3 a,b,c. a Tm values were obtained by monitoring the CD bands at 295 nm in the presence of KCl (100 mM). b Melting temperature is defined as the temperature at 0.5 value of normalized CD [mdeg]. c Values for the monomer 2 were previously reported [53].

3. Experimental

3.1. General

Flash chromatography was performed on silica gel 60 (spherical, particle size 0.040–0.100 mm; Kanto, Tokyo, Japan). Optical rotations were measured on a P 2200 polarimeter (JASCO, Tokyo, Japan), using the sodium lamp (589 nm). 1H and 13C-NMR spectra were recorded on JNM-ECX 300 and 400 instruments (JEOL, Tokyo, Japan). The spectra are referenced internally according to the residual solvent signals of CDCl3 (1H-NMR; δ = 7.26 ppm, 13C-NMR; δ = 77.0 ppm), DMSO-d6 (1H-NMR; δ = 2.50 ppm, 13C-NMR; δ = 39.5 ppm). Data for NMR are recorded as follows; chemical shift (δ, ppm), multiplicity (s, singlet; d, doublet; t, triplet; m, multiplet; br, broad), integration, coupling constant (Hz). Data for 13C-NMR are reported in terms of chemical shift (δ, ppm). Mass spectra were recorded on JEOL JMS-T100X spectrometer with ESI-MS mode using MeOH.

3.2. Synthesis

Compound 5: To a solution of 4 (1.13 g, 1.26 mmol) in MeOH (100 mL) was added Pd(OH)2/C (700 mg) and the reaction mixture was stirred at room temperature under an atmosphere of hydrogen gas (balloon). After 5 h, the reaction mixture was filtered through a pad of Celite and filtrates were concentrated in vacuo to give the corresponding amine. The crude amine was dissolved in a mixture of CH2Cl2-MeOH (9:1, 150 mL), and triethylamine (353 μL, 2.53 mmol) and NaCl (560 mg, 2.53 mmol) was added at 78 °C. After being stirred for 16 h, H2O was added to the reaction mixture, and the aqueous layer was extracted with CHCl3. The extracts were dried over MgSO4, filtered, and concentrated in vacuo. The residue was purified by silica gel column (EtOAc) to give 5 as a white solid (0.85 g, 0.90 mmol, 69%). [α]25D = −18.6 (c 1.5, CHCl3); 1H-NMR (400 MHz, CDCl3) δ 8.43 (d, J = 8.0 Hz, 1H), 8.26 (d, J = 8.0 Hz, 1H), 8.23–8.07 (m, 8H), 7.94–7.88 (m, 1H), 7.70–7.63 (m, 1H), 5.46 (t, J = 5.5 Hz, 1H), 5.40–5.26 (m, 2H), 4.68 (br, 1H), 3.12–2.88 (m, 4H), 2.08–1.69 (m, 4H), 1.56–0.94 (m, 17H); 13C-NMR (100 MHz, CDCl3) δ 164.6, 164.1, 159.6, 159.5, 155.8, 155.7, 154.6, 154.5, 147.6, 141.0, 140.9, 140.8, 139.4, 139.3, 139.2, 138.7, 138.6, 136.6, 136.4, 134.6, 132.8, 132.7, 130.5, 130.3, 129.3, 129.2, 125.7, 78.7, 47.6, 47.5, 47.4, 47.3, 43.3, 40.1, 34.5, 33.7, 29.3, 28.6, 28.2, 28.1, 21.7, 21.0; HRMS (ESI, M+Na) calcd for C41H41N11O14SNa 966.2453, found 966.2413. Compound 6: To a solution of 5 (1.28 g, 1.36 mmol) in DMF (10 mL) was added K2CO3 (9.40 g, 68.0 mmol) and 1,2-bis(2-iodoethoxy)ethane (0.25 g, 0.68 mmol) in DMF (1 mL), and the mixture was stirred at room temperature for 23 h. To the reaction mixture was added H2O, and aqueous layer was extracted with CHCl3. The extracts were dried over MgSO4, filtered, and concentrated in vacuo. The residue was purified by silica gel column (EtOAc: MeOH = 9: 1) to give 6 (0.75 g, 0.36 mmol, 53%). [α]25D = −17.2 (c 1.5, CHCl3); 1H-NMR (300 MHz, CDCl3) δ 8.61–8.51 (m, 2H), 8.47–8.36 (m, 4H), 8.28–8.05 (m, 16H), 7.88-7.81 (m, 2H), 7.61–7.52 (m, 2H), 5.45–5.25 (m, 4H), 4.63 (br, 2H), 3.59–2.90 (m, 20H), 2.15–1.68 (m, 8H), 1.65–0.62 (m, 34H); 13C-NMR (100 MHz, CDCl3) δ 164.9, 163.9, 159.7, 159.5, 156.0, 155.9, 154.7, 154.6, 147.6, 141.0, 140.9, 139.5, 139.3, 138.5, 136.8, 136.7, 135.6, 132.6, 131.7, 130.9, 130.8, 130.2, 129.6, 129.3, 125.6, 78.9, 77.2, 70.3, 69.7, 47.7, 46.9, 45.0, 40.9, 40.2, 34.8, 33.4, 29.4, 28.3, 26.8, 21.9, 20.2; HRMS (ESI, M+Na) calcd for C88H92N22O30S2Na 2023.5689, found 2023.5678. Compound 7: To a solution of 6 (31 mg, 15.4 μmol) in DMF (2 mL) was added K2CO3 (213 mg, 1,540 μmol) and PhSH (17 μL, 154 μmol), and mixture was stirred at room temperature for 1.5 h. To the reaction mixture was added (Boc)2O (68 mg, 308 μmol), and mixture was stirred at room temperature for 12 h. To the reaction mixture was added H2O, and aqueous layer was extracted with CHCl3. The extracts were dried over MgSO4, filtered, and concentrated in vacuo. The residue was purified by preparative TLC (CHCl3/MeOH = 15: 1) to give 7 (20 mg, 10.9 μmol, 71%). [α]25D = −4.7 (c 1.0, CHCl3); 1H-NMR (400 MHz, CDCl3) δ 8.59–8.51 (m, 4H), 8.27–8.18 (m, 12H), 5.47–5.32 (m, 4H), 4.63 (br, 2H), 3.85–3.01 (m, 20H), 2.50–1.90 (m, 8H), 1.57–0.79 (m, 52H); 13C-NMR (100 MHz, CDCl3) δ 164.8, 164.7, 159.8, 159.7, 156.0, 155.9, 154.6, 140.9, 139.1, 138.4, 136.8, 130.9, 129.6, 128.8, 79.3, 79.0, 77.2, 70.5, 70.2, 69.6, 69.5, 47.9, 47.8, 40.3, 34.6, 29.7, 29.5, 28.4, 28.3, 21.9; HRMS (ESI, M+Na) calcd for C88H102N20O26Na 1853.7172, found 1853.7160. L2H2-6OTD-dimer 3: To a solution of 7 (18 mg, 9.67 μmol) in CH2Cl2/TFA (1: 1, 10 mL) was stirred at room temperature for 3 h. The resulting mixture was concentrated in vacuo to give 3 (18 mg, 9.56 μmol, 99%). [α]25D = +72.0 (c 0.6, MeOH); 1H-NMR (400 MHz, DMSO-d6) δ 9.18–9.11 (m, 8H), 8.95–8.91 (m, 4H), 8.60 (br, 2H), 8.35 (d, J = 7.3 Hz, 4H), 7.72 (br, 4H), 5.47–5.38 (m, 4H), 3.63–3.45 (m, 8H), 3.09–2.99 (m, 4H), 2.94–2.83 (m, 4H), 2.77–2.69 (m, 4H), 2.14–1.87 (m, 8H), 1.68–0.71 (m, 16H); 13C-NMR (100 MHz, DMSO-d6) δ 164.4, 158.8, 158.7, 155.6, 155.5, 154.5, 154.4, 142.5, 141.9, 141.2, 136.0, 129.7, 128.4, 69.4, 65.5, 47.3, 46.6, 46.0, 38.6, 33.5, 33.3, 26.6, 25.0, 21.2, 20.9; HRMS (ESI, M+Na) calcd for C66H70N20O18Na 1453.5075, found 1453.5071.

3.3. Electrophoresis Mobility Shift Assay (EMSA)

EMSA was performed as follows; oligonucleotides (2.0 μL, 50 μM of telo24, 25 μM of telo48, 16.7 μM of telo72 and 12.5 μM of telo96) in TE buffer was added to Tris-HCl buffer (5.0 μL, 50 mM, pH 7.1) with 250 mM of KCl. This solution was heated at 94 °C for 2 min and then slowly cooled to 25 °C. Corresponding concentration of 2 and 3 in DMSO was added to the DNA solution. After a 14 h incubation period, the samples were mixed with Ficoll 400 solution (2.0 μL, 100 mg/mL). Next, each mixture (0.5 μL) was run on 12% nondenatured polyacrylamide gels in 1 × TBE buffer (100 V for 10 min, then 200 V for 15 min for telo24, 30 min for telo48, 45 min for telo72 and 60 min for telo96, respectively), and stained with GelStar®. The gels were scanned with a phosphorimager (Typhoon 8600, GE Healthcare, Buckinghamshire, UK) using a 580–640 band pass filter.

3.4. CD Spectrometry

CD spectra was recorded on a J-720 spectropolarimeter (JASCO, Tokyo, Japan) using a quartz cell of 1 mm optical path length and an instrument scanning speed of 500 nm/min with a response time of 1 s, over a wavelength range of 220–320 nm. The nucleotides purified (Sigma Genosys, Hokkaido, Japan) were dissolved as 1.0 mM stock solutions in sterilized water to be used without further purification. These nucleotides were diluted to 10 μM (telo24), 5.0 μM (telo48), 3.3 μM (telo72) and 2.5 μM (telo96) with 50 mM Tris–HCl, pH 7.5, 100 mM KCl buffer, respectively. Subsequently, these solution were annealed by heating at 96 °C for 2 min, then slowly cooled to room temperature, and then corresponding concentrations of 2 and 3 were titrated into these DNA solutions. Finally the CD spectra are representative of ten scans taken at 25 °C.

3.5. CD Melting Experiments

A solution of all DNA (10 μM: telo24, 5.0 μM: telo48, 3.3 μM: telo72, 2.5 μM: telo96) was prepared in 50 mM Tris–HCl, pH 7.5, 100 mM KCl buffer. Subsequently, corresponding concentration of 2 and 3 were added. Melting curves were obtained by monitoring the CD intensity at 295 nm on a JASCO J-720 spectropolarimeter using a quartz cell of 1 mm optical path length; the temperature was changed as follows: 25 to 99 °C then 99 to 25 °C at 1.0 °C/min.

3.6. Telomerase Repeat Amplification Protocol (TRAP) Assay

Telomerase repeat amplification protocol (TRAP) assays were conducted as follows; 1 × 105 of PC3 cells were lysed with 200 μL of TRAP lysis buffer [57], placed on ice for 30 min, and centrifuged for 20 min (15,000 rpm, 4 °C). This TRAP lysate (2.0 μL) was mixed with 10×T-PCR buffer (5.0 μL), 2.5 mM dNTPs (1.0 μL), 50 ng/μL TS primer (5'-d[AATCCGTCGAGCAGAGTT]-3', 2.0 μL), 0.2 pM TSNT (5'-d[AATCCGTCGAGCGAGTTAAAAGGCCGAGAAGCGAT]-3', 0.5 μL), DEPC (Diethylpyro carbonate) solution in MilliQ water (30 μL), compounds (DMSO solution, 5.0 μL), and placed on ice for 30 min. After the telomerase reactions (30 min, 20 °C), the reacting solution was placed on ice, 2.0 μL of 10 μM NT primer (5'-d[ATCGCTTCTCGGCCTTTT]-3’), 2.0 μL of 10 μL ACX primer (5'-d[GCGCGG (CTTACC)3CTAACC]-3') and 0.5 μL of Gene Taq (Nippon Gene, Tokyo, Japan) were added. The three-step PCR was performed: 27 cycles of 94 °C for 25 s, 50 °C for 25 s, and 72 °C for 45 s. PC3 cell lysates were used as a negative control, and lysis buffer as a positive control. Approximately 5.0 μL of each PCR reacting solution and 1.0 μL of 10 × loading buffer (Takara Bio Inc., Shiga, Japan) were loaded onto a 10% nondenaturing polyacrylamide gel (Perfect NT Gel, D.R.C. Co., Ltd., Tokyo, Japan) and run for 10 min at 100 V, then 55 min at 200 V. Gels were stained with SYBR® Green I (Takara Bio Inc., Shiga, Japan), and visualized with Fuji FLA-2000 (Fujifilm, Tokyo, Japan). Each sample was examined in duplicate by the TRAP assay on different occasions and the reproducibility was confirmed. IC50 value was calculated from average of two independent experiments.

4. Conclusions

In summary, we have newly synthesized a dimer-type G4 ligand 3, and evaluated its binding properties with long telomeric DNAs, telo48, 72 and 96, by means of EMSA and CD titration. The L2H2-6OTD-dimer (3) interacted with the long telomeric DNAs by forming an anti-parallel type G4 structure with each 24-base unit. The stabilization efficacy of 3 with long telomeric DNAs was superior to that of the monomer L2H2-6OTD (2) at both the molecular level (CD melting assay) and the enzymatic level (TRAP assay).
  49 in total

1.  Conformations of individual quadruplex units studied in the context of extended human telomeric DNA.

Authors:  Vijay Singh; Mykhailo Azarkh; Malte Drescher; Jörg S Hartig
Journal:  Chem Commun (Camb)       Date:  2012-04-24       Impact factor: 6.222

2.  A caged ligand for a telomeric G-quadruplex.

Authors:  Takahiro Nakamura; Keisuke Iida; Masayuki Tera; Kazuo Shin-ya; Hiroyuki Seimiya; Kazuo Nagasawa
Journal:  Chembiochem       Date:  2012-03-21       Impact factor: 3.164

3.  Inhibition of telomerase by G-quartet DNA structures.

Authors:  A M Zahler; J R Williamson; T R Cech; D M Prescott
Journal:  Nature       Date:  1991-04-25       Impact factor: 49.962

4.  How shelterin solves the telomere end-protection problem.

Authors:  T de Lange
Journal:  Cold Spring Harb Symp Quant Biol       Date:  2011-01-05

5.  Protection of DNA ends by telomeric 3' G-tail sequences.

Authors:  Yuan-Chin Tsai; Haiyan Qi; Leroy F Liu
Journal:  J Biol Chem       Date:  2007-05-04       Impact factor: 5.157

Review 6.  A hitchhiker's guide to G-quadruplex ligands.

Authors:  David Monchaud; Marie-Paule Teulade-Fichou
Journal:  Org Biomol Chem       Date:  2007-11-14       Impact factor: 3.876

7.  Macrocyclic hexaoxazoles as sequence- and mode-selective G-quadruplex binders.

Authors:  Masayuki Tera; Hiromichi Ishizuka; Motoki Takagi; Masami Suganuma; Kazuo Shin-ya; Kazuo Nagasawa
Journal:  Angew Chem Int Ed Engl       Date:  2008       Impact factor: 15.336

8.  Ring-closing metathesis for the synthesis of a highly G-quadruplex selective macrocyclic hexaoxazole having enhanced cytotoxic potency.

Authors:  Mavurapu Satyanarayana; Suzanne G Rzuczek; Edmond J Lavoie; Daniel S Pilch; Angela Liu; Leroy F Liu; Joseph E Rice
Journal:  Bioorg Med Chem Lett       Date:  2008-05-15       Impact factor: 2.823

9.  The tail of the telomere.

Authors:  Luigi Petraccone; John O Trent; Jonathan B Chaires
Journal:  J Am Chem Soc       Date:  2008-12-10       Impact factor: 15.419

10.  Defining the mode, energetics and specificity with which a macrocyclic hexaoxazole binds to human telomeric G-quadruplex DNA.

Authors:  Christopher M Barbieri; Annankoil R Srinivasan; Suzanne G Rzuczek; Joseph E Rice; Edmond J LaVoie; Daniel S Pilch
Journal:  Nucleic Acids Res       Date:  2007-04-22       Impact factor: 16.971

View more
  5 in total

Review 1.  A practical guide to studying G-quadruplex structures using single-molecule FRET.

Authors:  Parastoo Maleki; Jagat B Budhathoki; William A Roy; Hamza Balci
Journal:  Mol Genet Genomics       Date:  2017-02-01       Impact factor: 3.291

2.  Single-molecule displacement assay reveals strong binding of polyvalent dendrimer ligands to telomeric G-quadruplex.

Authors:  Pravin Pokhrel; Shogo Sasaki; Changpeng Hu; Deepak Karna; Shankar Pandey; Yue Ma; Kazuo Nagasawa; Hanbin Mao
Journal:  Anal Biochem       Date:  2022-04-29       Impact factor: 3.191

3.  Targeting glioma stem cells in vivo by a G-quadruplex-stabilizing synthetic macrocyclic hexaoxazole.

Authors:  Takahiro Nakamura; Sachiko Okabe; Haruka Yoshida; Keisuke Iida; Yue Ma; Shogo Sasaki; Takao Yamori; Kazuo Shin-Ya; Ichiro Nakano; Kazuo Nagasawa; Hiroyuki Seimiya
Journal:  Sci Rep       Date:  2017-06-15       Impact factor: 4.379

4.  Quantifying the impact of small molecule ligands on G-quadruplex stability against Bloom helicase.

Authors:  Parastoo Maleki; Golam Mustafa; Prabesh Gyawali; Jagat B Budhathoki; Yue Ma; Kazuo Nagasawa; Hamza Balci
Journal:  Nucleic Acids Res       Date:  2019-11-18       Impact factor: 16.971

5.  BMPQ-1 binds selectively to (3+1) hybrid topologies in human telomeric G-quadruplex multimers.

Authors:  Chao Gao; Zhu Liu; Haitao Hou; Jieqin Ding; Xin Chen; Congbao Xie; Zibing Song; Zhe Hu; Mingqian Feng; Hany I Mohamed; Shengzhen Xu; Gary N Parkinson; Shozeb Haider; Dengguo Wei
Journal:  Nucleic Acids Res       Date:  2020-11-18       Impact factor: 16.971

  5 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.