Literature DB >> 23077478

Rapid and sensitive detection of Plesiomonas shigelloides by loop-mediated isothermal amplification of the hugA gene.

Shuang Meng1, Jianguo Xu, Yanwen Xiong, Changyun Ye.   

Abstract

Plesiomonas shigelloides is one of the causative agents of human gastroenteritis, with increasing number of reports describing such infections in recent years. In this study, the hugA gene was chosen as the target to design loop-mediated isothermal amplification (LAMP) assays for the rapid, specific, and sensitive detection of P. shigelloides. The performance of the assay with reference plasmids and spiked human stools as samples was evaluated and compared with those of quantitative PCR (qPCR). No false-positive results were observed for the 32 non-P. shigelloides strains used to evaluate assay specificity. The limit of detection for P. shigelloides was approximately 20 copies per reaction in reference plasmids and 5×10(3) CFU per gram in spiked human stool, which were more sensitive than the results of qPCR. When applied in human stool samples spiked with 2 low levels of P. shigelloides, the LAMP assays achieved accurate detection after 6-h enrichment. In conclusion, the LAMP assay developed in this study is a valuable method for rapid, cost-effective, and simple detection of P. shigelloides in basic clinical and field laboratories in the rural areas of China.

Entities:  

Mesh:

Substances:

Year:  2012        PMID: 23077478      PMCID: PMC3471923          DOI: 10.1371/journal.pone.0041978

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

Plesiomonas shigelloides is a motile, oxidase-positive, facultatively anaerobic, gram-negative rod bacterium, which is presently classified in the family Vibrionaceae [1]. P. shigelloides has been isolated from a variety of environmental sources, primarily aquatic [2]–[4], and is distributed worldwide. Moreover, P. shigelloides has been associated with seafood-associated outbreaks [5]. P. shigelloides has been implicated as an agent of human gastroenteritis for many years, with an increasing number of reports describing such infections during the recent years [6]. This bacterium is also of considerable clinical importance as the etiological agent responsible for different types of opportunistic infections [7]. Although extra-intestinal infections such as septicemia, cellulitis, and meningitis caused by P. shigelloides are rarely reported, it has been associated with secondary infections in immunocompromised patients [8]–[10]. Salerno et al [12] also described an infection of P. shigelloides with a fatal outcome in a newborn. Since most laboratories concentrate on recovery of Salmonella, Shigella, E. coli and other classical enteropathogens, P. shigelloides may be overlooked during routine culture of stool samples. The lack of routine analysis for P. shigelloides in cases of gastroenteritis leads to only sporadic and occasional identification of this bacterium [11]. However, the greatest challenge to clinicians and epidemiologist is the lack of a rapid, early, and accurate diagnostic method for the detection of P. shigelloides as an emerging infectious disease in China. Several methods such as culture studies and biochemical assays have been developed for detection and identification of P. shigelloides. Despite their effectiveness and accuracy, these assays are time consuming, usually requiring up to 5 days to complete. The isolation of P. shigelloides from clinical samples has often been unsuccessful owing to the fastidious nature of the organism and the low level of transient bacteremia associated with the disease process. Rapid, specific, and sensitive nucleic acid amplification tests (NAATs) such as standard and real-time PCR have been developed to detect P. shigelloides by targeting genes encoding for major virulence factors [5], [13]–[14]. The major limitation to the widespread use of these assays is the fact that a sophisticated thermal cycler is an indispensable requirement of such tests, thereby limiting their wide applicability. Recently, a novel NAAT technology termed loop-mediated isothermal amplification (LAMP) has attracted a great deal of attention as a rapid, accurate, and cost-effective method for detection of pathogens in clinical diagnostics [15], [16]. LAMP employs 4–6 specially designed primers and a strand-displacing Bst DNA polymerase (isolated from Bacillus stearothermophilus) to amplify up to 109 target DNA copies under isothermal conditions (60°C–65°C) within an hour [15], making LAMP a potentially rapid and simple diagnostic tool for detection of P. shigelloides infection. In this study, we aimed to develop a rapid, sensitive, and highly specific LAMP assay to detect P. shigelloides and evaluate the assay performance with pathogen-simulated human stool.

Materials and Methods

Ethics statement

Feces samples were acquired with the written informed consent from a healthy donor. This study was reviewed and approved by the ethics committee of the National Institute for Communicable Disease Control and Prevention, China CDC, according to the medical research regulations of the Ministry of Health, China.

Bacterial strains and culture conditions

A total of 52 strains (20 P. shigelloides and 32 non-P. shigelloides strains, as described in Table 1) was used for specificity testing. The bacterial load of the strains used for specificity evaluation was 105 pg/µL, which is high enough to avoid the false-negative amplification. Strain ATCC 51903 was used for the assay optimization , sensitivity evaluation, and simulating human stool samples. P. shigelloides and Enterobacteriaceae were cultured at 37°C overnight on brain heart infusion agar (BHI; BD Diagnostic Systems, Sparks, MD, USA). Non-Enterobacteriaceae strains were grown on blood agar, except for Vibrio strains, for which trypticase soy agar (TSA) supplemented with 2% NaCl was used. Campylobacter strains were grown under microaerophilic conditions (85% N2, 10% CO2, and 5% O2).
Table 1

Strains used in this study.

Latin nameStrainStrains number
Plesiomonas shigelloides ATCC519031
Isolated strains19
Enteropathogenic E. coli Isolated strain1
Enterotoxigenic E. coli Isolated strain1
Enteroinvasive E. coli Isolated strain1
Enterohemorrhagic E. coli EDL9331
Enteroaggregative E. coli Isolated strain1
Salmonella enteric ATCC140281
Shigella flexneri Isolated strain1
Shigella sonnei ATCC259311
Salmonella typhi H981251
Klebsiella pneumoniae ATCC7006031
Proteus vulgaris Isolated strain1
Aeromonas veronii 1.22051
Clostridium perfringens Isolated strain1
Enterobacter cloacae Isolated strain1
Serratia marcescens Isolated strain1
Vibrio parahaemolyticus ATCC178021
Staphylococcus aureus ATCC65381
Streptococcus pneumoniae Isolated strain1
Streptococcus pyogenes Isolated strain1
Streptococcus sanguis Isolated strain1
Streptococcus salivarius Isolated strain1
Streptococcus bovis Isolated strain1
Enterococcus faecalis ATCC356671
Yersinia enterocolitica ATCC237151
Pseudomonas aeruginosa ATCC154421
Aeromonas hydrophila ATCC79661
Listeria monocytogenes 540032
Enterobacter sakazakii ATCC513291
Campylobacter jejuni ATCC332911
Vibrio minicus Isolated strain1
Vibrio vulnificus Isolated strain1
Vibrio fluvialis Isolated strain1

LAMP primers and reaction conditions

A set of 6 primers targeted toward the hugA gene of the species P. shigelloides were designed using PrimerExplorer V4 software (Eiken Chemical Co. Ltd., Tokyo, Japan) based on the conserved sequences determined by the alignment of the hugA gene sequences obtained from GenBank. The primers shown in Table 2 were synthesized by Sangon Biotech (Shanghai, China). The primer sequences and their positions in the expression site of the hugA gene are shown in Fig. 1. All LAMP reactions were performed with the Loopamp Kit (Eiken Chemical Co. Ltd., Tokyo, Japan) in a 25-µL mixture containing 1.6 µM FIP and BIP primers (each), 0.8 µM LF and LB primers (each), 0.2 µM F3 and B3 primers (each), 20 mM Tris-HCl (pH 8.8), 10 mM KCl, 8 mM MgSO4, 10 mM (NH4)2SO4, 0.1% Tween 20, 0.8 M betaine, 1.4 mM deoxynucleoside triphosphates (dNTPs; each), and 1 µL of Bst DNA polymerase (8 U/µL). The reaction mixture was incubated in a real-time turbidimeter LA320 (Teramecs, Tokyo, Japan) at 65°C for 60 min, followed by 80°C for 5 min to terminate the reaction. Positive and negative samples were distinguished from one another by a turbidity cutoff value of 0.1. After amplification, the LAMP products were detected by electrophoresis on 2% agarose gels with ethidium bromide staining or were determined by visual inspection after adding 1 µL of 1,000× SYBR green I.
Table 2

LAMP and qPCR primers used in this study to detect P. shigelloides.

Assay typePrimer/Probe nameSequence (5′-3′)Position
hugA-LAMPF3 AACACGTTGCAGCCCATC 3776–3973
B3 ACTTTACCGCCGAAGACAAG 3958–3977
FIP CGTTACGACGAAGCGTTCCGTGAAGTGAGTACCGGTGGTGT 3846–3867, 3806–3824
BIP GTCAGCCAATCAGTCGCCGCAATATCGCCGGCTCCGAG 3878–3897, 3940–3957
LF ACCGAGCATGGAAGAGATGT 3825–3844
LB GCGACAGGTGATCTTCGCTAC 3918–3938
hugA-qPCRF GGAATATCGGCCTGTACAT 4022–4040
R TATGGCGGCGATATTTA 4121–4137
ProbeFAM-CCCCAGACTTTGCTGCGACCATCGG-BHQ-14046–4070
Figure 1

Names and locations of target sequences used as primers for the expression site of hugA LAMP.

Reference plasmid

To determine the sensitivity of the LAMP assay, a recombinant plasmid containing the target sequence of the hugA gene from the P. shigelloides strain (ATCC 51903) was constructed as follows: 1) A pair of primers was designed to span the sequences between the F3 and B3 primers; forward primer hugA-F (5′-GCGGTCTCCGGTTTCAAAT-3′) and reverse primer hugA-R (5′-GTTACCGGGTCTGCGTTATG-3′); 2) the PCR products (259 bp) were cloned into the pEASY-T1 vector using the pEASY-T1 Cloning Kit (Transgen, Beijing, China); 3) the recombinant plasmid was quantified with a NanoPhotometer (Implen, Munich, Germany) and was serially diluted (to concentrations of 1×106, 105, 104, 103, 102, 101, and 100 copies/µL) in order to evaluate the limit of detection and the reproducibility of the LAMP assay.

Evaluation of the sensitivity, specificity, and reproducibility of the LAMP assay

To compare the sensitivities of the LAMP assay and quantitative PCR (qPCR), the serially diluted reference plasmids (at concentrations of 1×106, 105, 104, 103, 102, 101, and 100 copies/µL) containing the target DNA were used to define the limit of detection. The qPCR assay was performed with the primers and probe in Table 2. qPCR amplification was performed in a 20-µL reaction volume containing 0.25 µM primer (each), 0.18 µM probe, 1× Premix (Takara Bio, Inc., Otsu, Japan) Ex Taq™, and 2 µL of DNA template. The assays were conducted using the PCR settings of pre-denaturation at 95°C for 30 s, 40 cycles of denaturation at 94°C for 5 s, and extension at 60°C for 34 s in an ABI PRISM system (Applied Biosystems, Carlsbad, CA, US). Fluorescence readings were acquired using the 6-carboxyfluorescein (FAM) channel. Genomic DNA of the 32 non-P. shigelloides strains were detected by LAMP to determine the specificity of the hugA LAMP assay. All detection assays were performed in triplicate. A set of 3 reference plasmids with varying concentrations (106, 104, and 102 copies/µL) was amplified in two ways (10 times on 1 day and once on each of 10 days) to evaluate the reproducibility of the LAMP assay. The intra-assay coefficient of variation (CVi) and inter-assay coefficient of variation (CVo) were analyzed at the time of peak precipitation, as measured by turbidity on a real-time turbidimeter. Statistical analyses were conducted using SAS software version 9.1.

LAMP application in simulated human stools

Human stool specimens were obtained from a healthy donor and immediately processed. We have screened the human stool specimens by culture assay and PCR, no P. shigelloides strain was detected and no positive amplification of P. shigelloides DNA was observed. To determine the detection limit of LAMP in human stool, serial 10-fold dilutions of a mid-log-phase culture of P. shigelloides grown in BHI were prepared in phosphate-buffered saline (PBS) and quantified using the standard plating method, resulting in spiking levels between 5×107 and 5×101 CFU/g stool. Aliquots (0.2 g) of the stools were removed for DNA extraction with a QIAamp DNA stool mini kit (QIAGEN, Venlo, Netherlands). This experiment was independently repeated 3 times, and the supernatants (2 µL) were used for both LAMP and qPCR. In addition, the capability of the LAMP assay to detect low levels of P. shigelloides in human stool was evaluated. For this application, simulated human stool samples were spiked with P. shigelloides cultures at 2 levels: 1 to 2 and 10 to 20 CFU/0.5 g. The samples were homogenized with buffered peptone water (BPW; BD Diagnostic Systems) supplemented with 50 µg/mL ampicillin (Sigma-Aldrich, St. Louis, MO, USA), followed by incubation at 37°C for up to 10 h. Aliquots (1 mL) of the enrichment broth were removed at 4, 6, 8, and 10 h, and processed similarly by QIAamp DNA stool mini kit (QIAGEN). Two microliters of the sample DNA extracts were subjected to both LAMP and qPCR assays, which were repeated twice for each sample.

Results

Specificity of the LAMP assay

The specificity of the LAMP assay targeting hugA gene was tested with 52 bacterial strains (Table 1). Positive amplifications were observed in 20 P. shigelloides strains within a 60-min incubation period. By contrast, 32 non-P. shigelloides strains were not amplified after a 60-min incubation period. This result indicates that no false-positive amplifications were observed with these heterologous species in the LAMP assay.

Sensitivity of LAMP assay

The limit of detection of LAMP (Fig. 2A) and qPCR for the hugA gene were 20 and 200 copies/reaction, respectively. This result indicates that the LAMP assay is more sensitive than qPCR for detecting P. shigelloides DNA. The LAMP products could also be detected by electrophoresis (Fig. 2C) and visual inspection after adding 1 µL of 1,000× SYBR green I (Fig. 2D).
Figure 2

Real-time sensitivity and detection limit of hugA-LAMP.

(A) Real-time sensitivity of hugA-LAMP as monitored by the measurement of turbidity (optimal density at 650 nm). A turbidity of >0.1 was considered to be positive for hugA-LAMP. The detection limit was 20 copies/reaction. (B) The relation between the threshold time (Tt) of each sample and the log copies/reaction. The standard curve was drawn on the basis of 3 independent repeats and the linear relationship R2 = 0.9787. (C) Sensitivities of electrophoretic analysis of hugA-LAMP amplified products. Lane M: DL2000 marker; lane 1: 2×106 copies/reaction; lane 2: 2×105 copies/reaction; lane 3: 2×104 copies/reaction; lane 4: 2×103 copies/reaction; lane 5: 2×102 copies/reaction; lane 6: 2×101 copies/reaction; lane 7: 2×100 copies/reaction; lane 8: no template. (D) SYBR green I fluorescent dye-mediated monitoring of hugA-LAMP assay amplification. The original orange color of the SYBR Green I changed to green in case of positive amplification, whereas the original orange color was retained for a negative control with no amplification.

Real-time sensitivity and detection limit of hugA-LAMP.

(A) Real-time sensitivity of hugA-LAMP as monitored by the measurement of turbidity (optimal density at 650 nm). A turbidity of >0.1 was considered to be positive for hugA-LAMP. The detection limit was 20 copies/reaction. (B) The relation between the threshold time (Tt) of each sample and the log copies/reaction. The standard curve was drawn on the basis of 3 independent repeats and the linear relationship R2 = 0.9787. (C) Sensitivities of electrophoretic analysis of hugA-LAMP amplified products. Lane M: DL2000 marker; lane 1: 2×106 copies/reaction; lane 2: 2×105 copies/reaction; lane 3: 2×104 copies/reaction; lane 4: 2×103 copies/reaction; lane 5: 2×102 copies/reaction; lane 6: 2×101 copies/reaction; lane 7: 2×100 copies/reaction; lane 8: no template. (D) SYBR green I fluorescent dye-mediated monitoring of hugA-LAMP assay amplification. The original orange color of the SYBR Green I changed to green in case of positive amplification, whereas the original orange color was retained for a negative control with no amplification.

Reproducibility of LAMP assay

The CVi was assessed by testing 3 reference plasmids with varying concentrations (106, 104, and 102 copies/µL), 10 times in a single run, whereas the CVo was assessed by testing the same plasmids 10 times in 10 separate runs. The CVi ranged from 1.21% to 1.54%, while the CVo ranged from 2.17% to 3.23%.

Evaluation of LAMP assay in simulated human stool

The detection limit of LAMP in simulated human stool was also examined. The LAMP assays detected the presence of P. shigelloides strains down to as little as 5×103 CFU/g. By comparison, the qPCR assays had a detection limit of 5×104 CFU/g for hugA gene in simulated human stool samples (data not shown). Table 3 summarizes LAMP and qPCR results in human stool samples spiked with 2 low levels (1 to 2 and 10 to 20 CFU/0.5 g) of P. shigelloides strains after various enrichment periods. A typical LAMP judgment graph generated for human stool enrichment samples is shown in Fig. 3. Regardless of spiking levels, none of the 4-h-enrichment samples tested positive for P. shigelloides by either LAMP or qPCR. We observed positive results with LAMP at 6 h with significantly higher threshold time (Tt) values, while for samples enriched for 8, 10, 12, and 24 h, lower and stable Tt values were observed. A similar trend of detection was observed for qPCR (Table 3). In addition, qPCR results were presented by cycles, which were approximately 1 min/cycle. Therefore, an additional 20–40 min of amplification time was needed for qPCR when testing the same enrichment sample.
Table 3

Comparison of LAMP and qPCR assays in human stool samples spiked with low levels of P. shigelloides.

Cell level (no. of CFU/0.5 g)LAMP Tt (min) after enrichmentqPCR CT (cycles) after enrichment
4 h6 h8 h10 h12 h24 h4 h6 h8 h10 h12 h24 h
1–2Not available30.327.125.222.722.4Not available36.533.230.829.629.1
10–20Not available28.525.323.821.521.3Not available33.729.127.726.325.8
Figure 3

A typical LAMP amplification graph generated when testing human stool samples spiked with the low level of P. shigelloides strain after various enrichment periods (4, 6, 8, 10, 12, and 24 h).

In this graph, the human stool sample was spiked with 1.3 CFU of Strain ATCC 51903.

A typical LAMP amplification graph generated when testing human stool samples spiked with the low level of P. shigelloides strain after various enrichment periods (4, 6, 8, 10, 12, and 24 h).

In this graph, the human stool sample was spiked with 1.3 CFU of Strain ATCC 51903.

Discussion

Some reports have suggested that P. shigelloides may cause enteric diseases in normal hosts [5], [17]. Moreover, septicemia, cellulitis, meningitis, and cholecystitis due to P. shigelloides have also been documented among immunocompromised patients or patients with other underlying conditions [8]–[10]. The mortality rate associated with Plesiomonas-induced septicemia is high [18]. Individuals with serious infections are faced with the lack of a rapid and sensitive diagnostic method and inappropriate antimicrobial therapy, and therefore, they, often, cannot receive timely treatment, leading to diseases and fatal outcomes. It is well known that the bacteriological methods available for the isolation and identification of P. shigelloides are tedious and lengthy. Modified PCR techniques such as nested PCR and real-time PCR are complicated and require a high-precision thermal cycler, and therefore, they are not adapted to diagnosing P. shigelloides in basic clinical and field laboratories in rural areas. In contrast, the LAMP assay reported in this study is advantageous because of the following 3 features: rapid reaction, simple operation, and easy detection. The LAMP assay does not require sophisticated and expensive equipment, maintaining a constant temperature of 60°C–65°C for 1 h is sufficient for the reaction [16]. These features demonstrate that the LAMP assay is suitable for the detection of P. shigelloides in basic clinical and field laboratories in rural areas. Although the pathogenesis of P. shigelloides-associated gastroenteritis has not yet been elucidated, a number of potential virulence factors have been described [19], [20]. Acquisition of iron is known to be involved in the virulence of a variety of bacterial pathogens [21], [22]. Heme is the most abundant source of iron in the body, and many pathogenic bacteria possess heme transport systems. The hugA gene, one of the characterized genes encoded in the heme iron utilization system of P. shigelloides, encodes an outer membrane receptor that is required for heme iron utilization. In this study, all hugA gene sequences of P. shigelloides recorded in the GeneBank were aligned, and the LAMP primers were designed on the basis of the conserved regions. We tested 32 non-P. shigelloides strains to evaluate the specificity of the hugA LAMP assay for the bacteria, with the results showing that the specificity of the LAMP assay was 100%. To the best of our knowledge, this is the first study applying the novel LAMP technology for the detection of P. shigelloides in human stool. Previously, spiked samples were usually enriched overnight without characterizing the effects of different enrichment times on the detection outcomes [23], [24]. In this study, P. shigelloides strain ATCC 51903 was used in experiments with simulated human stool samples, with the LAMP assays having a detection limit of 5×103 CFU/g stool. Positive detection occurred after a 6-h period of enrichment, and consistently thereafter, for the human stool samples spiked with 2 low levels (1 to 2 and 10 to 20 CFU/0.5 g) of ATCC 51903. We observed that the LAMP assay performed better than qPCR with respect to detection limit and assay speed in spiked human stool. In general, molecular level-based detection methods such as PCR and LAMP are subjected to a variety of inhibitors present in clinical samples. Some researchers have reported that the Bst polymerase in LAMP is less sensitive to the presence of inhibitors than the Taq polymerase used in classic PCR [25], [26]. Our results showed that the LAMP assay is more accurate and sensitive than qPCR methods using simulated human stool samples, and proved markedly faster than qPCR by at least 20 min, thereby significantly shortening the total assay time. In conclusion, the LAMP assay was successfully validated in this study for rapidity, sensitivity, specificity, and robustness; thus, this assay may serve as an effective means for screening P. shigelloides in clinical samples. We proved that the LAMP assay demonstrated superior performance to qPCR in simulated human stool samples, and may facilitate rapid and reliable diagnosis of P. shigelloides infections in basic clinical and field laboratories in rural areas.
  25 in total

1.  Comparison of detection methods for Escherichia coli O157 in beef livers and carcasses.

Authors:  Kayoko Ohtsuka; Masayuki Tanaka; Takayasu Ohtsuka; Kosuke Takatori; Yukiko Hara-Kudo
Journal:  Foodborne Pathog Dis       Date:  2010-08-12       Impact factor: 3.171

2.  Tolerance of loop-mediated isothermal amplification to a culture medium and biological substances.

Authors:  Hisatoshi Kaneko; Takashi Kawana; Eiko Fukushima; Tatsuo Suzutani
Journal:  J Biochem Biophys Methods       Date:  2006-08-30

3.  Salmonella spp., Vibrio spp., Clostridium perfringens, and Plesiomonas shigelloides in marine and freshwater invertebrates from coastal California ecosystems.

Authors:  W A Miller; M A Miller; I A Gardner; E R Atwill; B A Byrne; S Jang; M Harris; J Ames; D Jessup; D Paradies; K Worcester; A Melli; P A Conrad
Journal:  Microb Ecol       Date:  2006-08-08       Impact factor: 4.552

Review 4.  Plesiomonas shigelloides sepsis and meningoencephalitis in a surviving neonate.

Authors:  Osman Ozdemir; Sinan Sari; Serdar Terzioglu; Aysegul Zenciroglu
Journal:  J Microbiol Immunol Infect       Date:  2010-08       Impact factor: 4.399

5.  Septic shock caused by Plesiomonas shigelloides in a patient with sickle beta-zero thalassemia.

Authors:  Maria Auxiliadora-Martins; Fernando Bellissimo-Rodrigues; Jaciara Machado Viana; Gil Cezar Alkmin Teixeira; Edson Antônio Nicolini; Kátia Simone Muniz Cordeiro; Giovana Colozza; Roberto Martinez; Olindo Assis Martins-Filho; Anibal Basile-Filho
Journal:  Heart Lung       Date:  2009-09-11       Impact factor: 2.210

6.  Plesiomonas shigelloides hugZ encodes an iron-regulated heme binding protein required for heme iron utilization.

Authors:  Athenia L Oldham; Trisha A Wood; Douglas P Henderson
Journal:  Can J Microbiol       Date:  2008-02       Impact factor: 2.419

7.  Enhancement of recombinant hemoglobin production in Escherichia coli BL21(DE3) containing the Plesiomonas shigelloides heme transport system.

Authors:  D M Villarreal; C L Phillips; A M Kelley; S Villarreal; A Villaloboz; P Hernandez; J S Olson; D P Henderson
Journal:  Appl Environ Microbiol       Date:  2008-08-01       Impact factor: 4.792

8.  A rapid, simple, and sensitive loop-mediated isothermal amplification method to detect toxigenic Vibrio cholerae in rectal swab samples.

Authors:  Kazuhisa Okada; Siriporn Chantaroj; Tooru Taniguchi; Yasuhiko Suzuki; Amonrattana Roobthaisong; Orapim Puiprom; Takeshi Honda; Pathom Sawanpanyalert
Journal:  Diagn Microbiol Infect Dis       Date:  2009-10-07       Impact factor: 2.803

9.  Plesiomonas shigelloides pneumonia.

Authors:  F Schneider; N Lang; R Reibke; H J Michaely; W Hiddemann; H Ostermann
Journal:  Med Mal Infect       Date:  2009-01-23       Impact factor: 2.152

Review 10.  Loop-mediated isothermal amplification (LAMP): a rapid, accurate, and cost-effective diagnostic method for infectious diseases.

Authors:  Yasuyoshi Mori; Tsugunori Notomi
Journal:  J Infect Chemother       Date:  2009-04-25       Impact factor: 2.211

View more
  10 in total

Review 1.  Plesiomonas shigelloides Revisited.

Authors:  J Michael Janda; Sharon L Abbott; Christopher J McIver
Journal:  Clin Microbiol Rev       Date:  2016-04       Impact factor: 26.132

2.  Development and Evaluation of a Loop-Mediated Isothermal Amplification Method for Rapid Detection of Aspergillus fumigatus.

Authors:  Qing Tang; Shuguang Tian; Nong Yu; Xi Zhang; Xiaodong Jia; Hongyan Zhai; Qun Sun; Li Han
Journal:  J Clin Microbiol       Date:  2016-01-20       Impact factor: 5.948

3.  Comparison of conventional PCR, multiplex PCR, and loop-mediated isothermal amplification assays for rapid detection of Arcobacter species.

Authors:  Xiaoyu Wang; Dong Joo Seo; Min Hwa Lee; Changsun Choi
Journal:  J Clin Microbiol       Date:  2013-12-11       Impact factor: 5.948

4.  Rapid and sensitive detection of Plesiomonas shigelloides by cross‑priming amplification of the hugA gene.

Authors:  Shuang Meng; Yi Wang; Yan Wang; Changyun Ye
Journal:  Mol Med Rep       Date:  2016-11-14       Impact factor: 2.952

5.  Rapid and Accurate Diagnosis of the Respiratory Disease Pertussis on a Point-of-Care Biochip.

Authors:  Maowei Dou; Natalie Macias; Feng Shen; Jennifer Dien Bard; Delfina C Domínguez; Xiujun Li
Journal:  EClinicalMedicine       Date:  2019-03-05

6.  Genome Sequence of Plesiomonas shigelloides Strain 302-73 (Serotype O1).

Authors:  Núria Piqué; Eleonora Aquilini; Tyler Alioto; David Miñana-Galbis; Juan M Tomás
Journal:  Genome Announc       Date:  2013-06-27

7.  Real-time fluorescence loop mediated isothermal amplification for the detection of Acinetobacter baumannii.

Authors:  Qinqin Wang; Yanbin Zhou; Shaoli Li; Chao Zhuo; Siqi Xu; Lixia Huang; Ling Yang; Kang Liao
Journal:  PLoS One       Date:  2013-07-02       Impact factor: 3.240

8.  Loop-mediated isothermal amplification for Rickettsia typhi (the causal agent of murine typhus): problems with diagnosis at the limit of detection.

Authors:  Sabine Dittrich; Josée Castonguay-Vanier; Catrin E Moore; Narongchai Thongyoo; Paul N Newton; Daniel H Paris
Journal:  J Clin Microbiol       Date:  2013-12-26       Impact factor: 5.948

9.  Development and Diagnostic Evaluation of Loop-Mediated Isothermal Amplification Using a New Gene Target for Rapid Detection of Helicobacter pylori.

Authors:  Somaye Bakhtiari; Amirhooshang Alvandi; Hamid Pajavand; Jafar Navabi; Farid Najafi; Ramin Abiri
Journal:  Jundishapur J Microbiol       Date:  2016-02-15       Impact factor: 0.747

10.  Complete Genome Sequence of Multidrug-Resistant Plesiomonas shigelloides Strain MS-17-188.

Authors:  Hossam Abdelhamed; Ozan Ozdemir; Hasan C Tekedar; Mark A Arick; Chuan-Yu Hsu; Attila Karsi; Mark L Lawrence
Journal:  Genome Announc       Date:  2018-05-03
  10 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.