Literature DB >> 21303535

Improving Salmonella vector with rec mutation to stabilize the DNA cargoes.

Xiangmin Zhang1, Soo-Young Wanda, Karen Brenneman, Wei Kong, Xin Zhang, Kenneth Roland, Roy Curtiss.   

Abstract

BACKGROUND: Salmonella has been employed to deliver therapeutic molecules against cancer and infectious diseases. As the carrier for target gene(s), the cargo plasmid should be stable in the bacterial vector. Plasmid recombination has been reduced in E. coli by mutating several genes including the recA, recE, recF and recJ. However, to our knowledge, there have been no published studies of the effect of these or any other genes that play a role in plasmid recombination in Salmonella enterica.
RESULTS: The effect of recA, recF and recJ deletions on DNA recombination was examined in three serotypes of Salmonella enterica. We found that (1) intraplasmid recombination between direct duplications was RecF-independent in Typhimurium and Paratyphi A, but could be significantly reduced in Typhi by a ΔrecA or ΔrecF mutation; (2) in all three Salmonella serotypes, both ΔrecA and ΔrecF mutations reduced intraplasmid recombination when a 1041 bp intervening sequence was present between the duplications; (3) ΔrecA and ΔrecF mutations resulted in lower frequencies of interplasmid recombination in Typhimurium and Paratyphi A, but not in Typhi; (4) in some cases, a ΔrecJ mutation could reduce plasmid recombination but was less effective than ΔrecA and ΔrecF mutations. We also examined chromosome-related recombination. The frequencies of intrachromosomal recombination and plasmid integration into the chromosome were 2 and 3 logs lower than plasmid recombination frequencies in Rec+ strains. A ΔrecA mutation reduced both intrachromosomal recombination and plasmid integration frequencies.
CONCLUSIONS: The ΔrecA and ΔrecF mutations can reduce plasmid recombination frequencies in Salmonella enterica, but the effect can vary between serovars. This information will be useful for developing Salmonella delivery vectors able to stably maintain plasmid cargoes for vaccine development and gene therapy.

Entities:  

Mesh:

Substances:

Year:  2011        PMID: 21303535      PMCID: PMC3047425          DOI: 10.1186/1471-2180-11-31

Source DB:  PubMed          Journal:  BMC Microbiol        ISSN: 1471-2180            Impact factor:   3.605


Background

Attenuated Salmonella are being developed as vaccines to protect against typhoid fever [1-3]. There are also endeavors employing Salmonella as delivery vectors for therapeutic molecules. One strategy utilizes attenuated Salmonella, which expresses a gene or gene fragment encoding a protective antigen as vaccine against bacterial pathogens [4-6]. The heterologous genes can be expressed from the Salmonella chromosome, or, more often, from a multi-copy plasmid [7,8]. Another strategy exploits Salmonella as a delivery vector of DNA vaccine against viral pathogens [4,5,9]. The later strategy is also used to deliver DNA encoding tumor antigen or cytokine for therapeutic applications in oncology [10,11]. In addition, Salmonella is used to deliver small interfering RNAs (siRNA) [12], ribozymes [13] and large DNA molecules encoding a viral genome [14]. For instance, in vivo delivery of an artificial bacterial chromosome (BAC) carrying the viral genome of the murine cytomegalovrirus (MCMV) by Salmonella Typhimurium led to a productive virus infection in mice and resulted in elevated titers of specific antibodies against lethal MCMV challenge [14]. Most vaccine designs utilize Salmonella delivery vectors carrying a single plasmid for expression of a single antigen or of a fusion protein carrying epitopes from more than one antigen [15]. To induce broader immunity against a particular pathogen or various pathogens, one might need to express multiple antigens from a single plasmid carrying different antigen cassettes or from multiple plasmids in a single cell, each expressing one or more relevant antigens. Co-delivery of plasmids encoding tumor antigens and cytokines by Salmonella has been successfully demonstrated to improve protective immunity against cancer [16]. In the case where multiple plasmids are carried in the same Salmonella vector strain, there are most likely regions of homology between the plasmids, since the widely used pUC- and pBR-based plasmids have origins of replication that are nearly identical and both share regions of homology with the p15A ori. Additionally, commonly used promoter sequences, transcriptonal terminators and other expression plasmid components may also be present on plasmids coexisting in the same bacterial cell. The presence of these similar or identical DNA sequences would serve to facilitate undesirable interplasmid recombination. In some cases the bacterial vector may intentionally harbor multiple copies of the same DNA sequence, which may lead to plasmid instability. Recently, we encountered such a situation during the development of a bacterial based influenza vaccine. We constructed a single plasmid carrying eight head-to-tail connected influenza cDNA cassettes [17]. The plasmid was intended for delivery into host cells by an attenuated Salmonella strain. The multiple repetitive sequences residing in the plasmid make its stability within the attenuated Salmonella an important concern because any intraplasmid recombination event results in deletion of one or more influenza gene cassettes. Recent work in our laboratory has focused on developing new strategies for attenuated Salmonella vaccine strains, with features including regulated delayed in vivo attenuation [18,19], regulated delayed in vivo antigen synthesis [18,20-22], and programmed delayed in vivo cell lysis [23,24]. For all of these systems, one or more chromosomal and/or plasmid genes are placed under the control of the araC PBAD promoter. Eventually, our goal is to combine all of these features into a single Salmonella vaccine vector strain. Such a strain will therefore carry multiple chromosomal and plasmid copies of araC PBAD, providing sites for potential recombination, which could lead to unwanted chromosomal or plasmid rearrangements. However, to our knowledge, there have been no published studies specifically designed to evaluate plasmid recombination in Salmonella enterica. Deletions of several Escherichia coli genes are known to reduce the frequency of plasmid recombination, including the recA, recE, recF and recJ genes [25-30]. The recA gene encodes the general recombinase RecA, involved in nearly all forms of recombination in the cell [31]. The RecE, RecF and RecJ proteins play a role in plasmid recombination and recombination repair [32,33]. The RecA, RecF and RecJ proteins are highly homologous between E. coli and S. enterica, therefore they may play similar roles in DNA recombination. Despite these possible similarities, the recombination systems in the two organisms differ somewhat, as S. enterica does not encode recE [34]. Based on these concerns, we decided to determine the effect of rec gene deletions on intraplasmid recombination, interplasmid recombination, intrachromosomal recombination and plasmid integration in S. enterica. In this work, we examine the effect of ΔrecA, ΔrecF and ΔrecJ mutations on DNA recombination frequencies in three serovars of Salmonella enterica currently relevant to vaccine development. Our results show that the effect of these mutations on recombination can vary among Salmonella serovars and with previously published results in E. coli.

Results

Plasmid construction

We constructed a series of plasmids (Figure 1 and Table 1) encoding various truncated tetA genes to assay plasmid recombination frequencies using the strategies similar to those described previously [28,35]. Restoration of a functional tetA gene via intra- or intermolecular recombination resulted in a change of the bacterial phenotype from tetracycline sensitive to tetracycline resistant, and served as a marker allowing us to measure the frequency of recombination events (Figure 2).
Figure 1

Illustration of plasmids carrying intact or truncated . Plasmids are not drawn to scale. (A) Plasmid pACYC184 carries an intact tetA gene (1191 bp), which is the source of all truncated tetA genes used in this study. Plasmid pYA4463 carries two copies of truncated tetA genes, truncated at the 5' or 3' ends as indicated, which results in a 466-bp direct tandem duplication (shown as open arrows). Plasmid pYA4590 has two similar copies of truncated tetA genes, resulting in 602 bp of repetitive sequence (shown as open arrows) separated by 1041-bp kan cassette. (B) Plasmid pYA4464 has a 3'tet truncated gene. Plasmid pYA4465 has a 5'tet truncated gene. There are 751 bp of common sequences (shown as open arrows) between the two truncated tetA genes. (C) Plasmid pYA4463 dimer is the intermolecular recombination product of two pYA4463 molecules. Plasmid pYA4590 dimer is the intermolecular recombination product of two pYA4590 molecules. Plasmid pYA4464-pYA4465 is the intermolecular recombination product of pYA4464 and pYA4465.

Table 1

Plasmids used in this study

PlasmidRelevant characteristic(s)*Reference or source
pACYC184cat, tetA, p15A ori[59]
pBAD-HisAamp, pBR oriInvitrogen
pKD46λ Red recombinase expression plasmid[60]
p15A-PB2-kancat, kan, p15A oriThis study
pYA4463pACYC184, adjacent 5'tet and 3'tetThis study
pYA4464pACYC184, 3'tetThis study
pYA4465pBAD-HisA; 5'tetThis study
pYA4590pACYC184, 5'tet-kan-3'tetThis study
pYA4373cat-sacB[54]
pRE112oriT, oriV, sacB, cat[61]
pYA3886pRE112, ΔrecF126This study
pYA4783pYA3886, ΔrecF1074This study
pYA3887pRE112, ΔrecJ1315This study
pYA4680pRE112, ΔrecA62This study
pYA4518pYA4464, cat, p15A ori, GFP geneThis study
pYA4518-cysGTwo cysG fragmentsThis study
pYA4689pYA4518-cysG, 5'tet-kan-3'tetThis study
pYA4690pYA4518-cysG, 5'tet-kanThis study
pYA5001aacC1, pSC101 ori, T vectorThis study
pYA5002pYA5001, recA cassette from Typhimurium χ3761This study
pYA5004pYA5001, recA cassette from Typhi Ty2 χ3769This study
pYA5005pYA5001, recF gene from Typhimurium χ3761This study
pYA5006pYA5001, recF gene from Typhi Ty2 χ3769This study

* cat: chloramphenicol resistance gene; tetA: tetracycline resistance gene; amp: ampicillin resistance gene; kan: kanamycin resistance gene; 3'tet: 3' portion of the tetA gene; 5'tet: 5' portion of the tetA gene together with its promoter; aacC1: 3-N-aminoglycoside acetyltransferase.

Figure 2

Strategies for measuring DNA recombination. (A) Truncated tetA genes. Two truncated tetA genes were derived from an intact tetA gene and its promoter (P). 5'tet, includes the tetA promoter and the 5' portion of tetA gene. 3'tet, consists of the 3' portion of the tetA gene. The overlapping region (between 5'tet and 3'tet) varies from 466 to 789 bp depending on the system. Homologous recombination can occur between the two truncated tetA genes at the overlapping region, leading to the formation of a functional tetA gene. (B) Intermolecular recombination. Each DNA molecule carries either 5'tet or 3'tet. A single crossover between the two molecules occurs at the regions of homology, and leads to a functional tetA gene. (C) Intramolecular recombination. The two truncated tetA genes were placed on one molecule in the same orientation. A single crossover between the regions of homology leads to a functional tetA gene.

Illustration of plasmids carrying intact or truncated . Plasmids are not drawn to scale. (A) Plasmid pACYC184 carries an intact tetA gene (1191 bp), which is the source of all truncated tetA genes used in this study. Plasmid pYA4463 carries two copies of truncated tetA genes, truncated at the 5' or 3' ends as indicated, which results in a 466-bp direct tandem duplication (shown as open arrows). Plasmid pYA4590 has two similar copies of truncated tetA genes, resulting in 602 bp of repetitive sequence (shown as open arrows) separated by 1041-bp kan cassette. (B) Plasmid pYA4464 has a 3'tet truncated gene. Plasmid pYA4465 has a 5'tet truncated gene. There are 751 bp of common sequences (shown as open arrows) between the two truncated tetA genes. (C) Plasmid pYA4463 dimer is the intermolecular recombination product of two pYA4463 molecules. Plasmid pYA4590 dimer is the intermolecular recombination product of two pYA4590 molecules. Plasmid pYA4464-pYA4465 is the intermolecular recombination product of pYA4464 and pYA4465. Plasmids used in this study * cat: chloramphenicol resistance gene; tetA: tetracycline resistance gene; amp: ampicillin resistance gene; kan: kanamycin resistance gene; 3'tet: 3' portion of the tetA gene; 5'tet: 5' portion of the tetA gene together with its promoter; aacC1: 3-N-aminoglycoside acetyltransferase. Strategies for measuring DNA recombination. (A) Truncated tetA genes. Two truncated tetA genes were derived from an intact tetA gene and its promoter (P). 5'tet, includes the tetA promoter and the 5' portion of tetA gene. 3'tet, consists of the 3' portion of the tetA gene. The overlapping region (between 5'tet and 3'tet) varies from 466 to 789 bp depending on the system. Homologous recombination can occur between the two truncated tetA genes at the overlapping region, leading to the formation of a functional tetA gene. (B) Intermolecular recombination. Each DNA molecule carries either 5'tet or 3'tet. A single crossover between the two molecules occurs at the regions of homology, and leads to a functional tetA gene. (C) Intramolecular recombination. The two truncated tetA genes were placed on one molecule in the same orientation. A single crossover between the regions of homology leads to a functional tetA gene. Plasmids pYA4463 and pYA4590 were constructed to test intraplasmid recombination (Figure 1 panel A). Plasmid pYA4463 carries two truncated tetA genes (5' end and 3'end), which have 466-bp of tandemly repeated sequence. An intramolecular recombination event can delete one of the repeats resulting in an intact tetA gene, thereby recreating the structure of plasmid pACYC184 (Figure 1 panel A). Theoretically, intermolecular recombination may occur between two pYA4463 molecules to form a plasmid dimer with a functional tetA gene (Figure 1 panel C). Plasmid pYA4590 contains a 602-bp tetA sequence duplication separated by a 1041-bp kan cassette. The intramolecular recombination product is equivalent to pACYC184. The intermolecular recombination product is a dimer plasmid containing an intact tetA gene (Figure 1 panel C). Plasmids pYA4464 and pYA4465 carry the 3'tet gene and 5'tet gene, respectively (Figure 1). The Rec+ Salmonella strain χ3761 carrying either plasmid individually was sensitive to tetracycline. There is 751-bp of tetA DNA in common between the two truncated tetA genes. Recombination between the two plasmids creates a hybrid plasmid containing an intact tetA gene (Figure 1 panel C).

Intraplasmid recombination products

To verify the recombination products, plasmid DNA was prepared from tetracycline resistant (TcR) single colonies derived from χ3761(pYA4463), χ3761(pYA4590) and χ3761(pYA4464, pYA4465). Plasmids extracted from TcR clones of χ3761(pYA4463) were digested with XbaI and SalI. Theoretically, XbaI/SalI digestion of pYA4463 will yield two fragments (3524 bp and 1187 bp), pACYC184 will yield two fragments (3524 bp and 721 bp) and pYA4463 dimer will yield four fragments (3524 bp, 3524 bp, 1653 bp and 721 bp). The results (Figure 3A) showed that digestion of all 16 TcR clones yielded a 721-bp band, indicating either a pYA4463 dimer or a plasmid equivalent to pACYC184. Three clones (lane 1, 5 and 10) yielded the pYA4463 dimer-specific 1653-bp band. Therefore, we conclude that the other 13 clones recombined to form the pACYC184-like structure. Of note, several clones (2, 13-16) also yielded the 1187-bp pYA4463-specific band, suggesting that the original plasmid (pYA4463) and its recombination product (pACYC184-like) could coexist in the same bacterial cell.
Figure 3

Verification of plasmid recombination product by agarose gel separation. (A) Plasmid DNA was isolated from TcR clones derived from χ3761(pYA4463) and digested by XbaI and SalI. (B) Plasmid DNA was isolated from TcR clones of χ3761(pYA4590) and digested by KpnI and EcoRI. (C) Plasmid DNA was isolated from TcR or TcS clones of χ3761(pYA4464, pYA4465). The purified plasmids were digested with NcoI and BglII.

Verification of plasmid recombination product by agarose gel separation. (A) Plasmid DNA was isolated from TcR clones derived from χ3761(pYA4463) and digested by XbaI and SalI. (B) Plasmid DNA was isolated from TcR clones of χ3761(pYA4590) and digested by KpnI and EcoRI. (C) Plasmid DNA was isolated from TcR or TcS clones of χ3761(pYA4464, pYA4465). The purified plasmids were digested with NcoI and BglII. Plasmids extracted from TcR clones of χ3761(pYA4590) were digested with KpnI and EcoRI. Theoretically, plasmid pYA4590 will be digested into two fragments (3414 bp and 2474 bp), plasmid pACYC184 will be linearized (4245 bp) and the pYA4590 plasmid dimer will be digested into four fragments (4245 bp, 3414 bp, 2474 bp and 1643 bp). Examination of the restricted DNA (Figure 3B) showed that only one clone (lane 12) had the pYA4590 dimer-specific 1643-bp band. The most prominent band in the other lanes was a 4245-bp band expected for pACYC184-like recombination products. Nine clones contained a mixture of pACYC184 and pYA4590 (lane 1, 3-5, 8, 9, 14-16).

Interplasmid recombination products

Plasmids extracted from TcR clones of χ3761(pYA4464, pYA4465) were digested with NcoI and BglII. Both pYA4464 and pYA4465 are linearized into a DNA fragment about 4 kb. Therefore, in cells containing each or both monomeric plasmids, the digested product will be a single band. The pYA4464-pYA4465 hybrid will be cut into two fragments (5510 bp and 2481 bp). All four of the TcR clones we isolated and examined showed recombination product specific bands and the 4-kb band expected when each plasmid exists separately in the cell. Four tetracycline sensitive (TcS) isolates were examined and only a single band was observed, as expected (Figure 3C). These results suggest that interplasmid recombination occurred in the TcR cells and that both dimer and individual monomers corresponding to at least one of the two starting plasmids can coexist in the same bacterial cell. We performed a similar experiment in S. Typhi strain Ty2(pYA4464, pYA4465) and obtained identical results (data not shown).

Construction of rec deletion strains

We constructed a series of strains for these studies carrying deletions in either recA, recF or recJ in S. Typhimurium UK-1, S. Typhi Ty2 and S. Paratyphi A (Table 2). We also constructed ΔrecAΔ recF and ΔrecJ Δ recF double mutants in S. Typhimurium. Deletion of recA, recF and recJ results in an increase in sensitivity to UV irradiation [36,37]. To verify the presence of these deletions phenotypically in our strains, the UV sensitivity of the S. Typhimurium mutant strains was measured. The ΔrecF and ΔrecJ mutants showed significantly lower surviving fractions than the wild type strain after the same exposure dose (Figure 4). By contrast, after five seconds of UV exposure (16 J/m2) to 2.2 × 109 CFU of the ΔrecA62 mutant (χ9833), we were unable to recover any surviving cells (not shown). UV resistance similar to the wild-type strain χ3761 was restored to S. Typhimurium ΔrecA and ΔrecF mutants strains after introduction of recA plasmid (pYA5002) or either recF plasmid (pYA5005/pYA5006), respectively. Transformation of either mutant strain with vector plasmid pYA5001 did not restore UV resistance (Figure 4 and data not shown for recA mutant).
Table 2

The bacterial strains used in this study

StrainGenotype* [parental strain]Reference or source
S. Typhimurium UK-1
 χ3761wild type[62]
 χ9833ΔrecA62 [χ3761]This study
 χ9070ΔrecF126 [χ3761]This study
 χ9072ΔrecJ1315 [χ3761]This study
 χ9081ΔrecJ1315 ΔrecF126 [χ9072]This study
 χ9931cysG494::(5'tet-kan-3'tet) [χ3761]This study
 χ9932ΔrecF126 cysG494::(5'tet-kan-3'tet) [χ9070]This study
 χ9933ΔrecJ1315 cysG494::(5'tet-kan-3'tet) [χ9072]This study
 χ9934ΔrecA62 cysG494::(5'tet-kan-3'tet) [χ9833]This study
 χ9935cysG493::(5'tet-kan) [χ3761]This study
 χ9936ΔrecF126 cysG493::(5'tet-kan) [χ9070]This study
 χ9937ΔrecJ1315 cysG493::(5'tet-kan) [χ9072]This study
 χ9938ΔrecA62 cysG493::(5'tet-kan) [χ9833]This study
 χ9939ΔrecF126 Δ recA62 [χ9070]This study
S. Typhi Ty2
 χ3769wild type[63]
 χ11053ΔrecF126 [χ3769]This study
 χ11134ΔrecF1074 [χ3769]This study
 χ11159ΔrecA62 [χ3769]This study
 χ11194ΔrecJ1315 [χ3769]This study
S. Typhi ISP1820
 χ3744wild typeD.M. Hone
 χ11133ΔrecF1074 [χ3744]This study
S. Paratyphi A
 χ8387Plasmid pSPA1 was cured from wt isolate ATCC 9281This study
 χ11243ΔrecA62 [χ8387]This study
 χ11244ΔrecF126 [χ8387]This study
 χ11245ΔrecJ1315 [χ8387]This study
E. coli K-12
 EPI300F- mcrA Δ (mrr-hsdRMS-mcrBC) Φ80dlacZ Δ M15 Δ lacX74 recA1 endA1 araD139 Δ (ara, leu)7697 galU galK λ- rpsL nupG trfA dhfrEpicentre
 χ7213 (MGN-617)thi-1 thr-1 leuB6 glnV44 fhuA21 lacY1 recA1 RP4-2-Tc::Muλpir ΔasdA4 Δzhf-2::Tn10[55]

* kan: kanamycin resistance gene; 5'tet: 5' portion of the tetA gene together with its promoter; 3'tet: 3' portion of the tetA gene.

Figure 4

UV sensitivity of . Log phase cultures of S. Typhimurium were diluted and spread on LB agar. Multiple dilutions were exposed to 254 nm UV in a dark room at each designated dose. Then the plates were wrapped with aluminum foil and placed at 37°C overnight. Surviving fractions were calculated and shown except ΔrecA strains χ9833 and χ9833(pYA5001), for which no survivors were recovered at any UV dose. wt: χ3761; ΔrecF: χ9070; ΔrecJ: χ9072; ΔrecA(RecA+): χ9833(pYA5002); ΔrecF(vector): χ9070(pYA5001); ΔrecF(Typhimurium RecF+): χ9070(pYA5005); ΔrecF(Typhi RecF+): χ9070(pYA5006). Survival of Rec+ strains [χ3761, χ9833(pYA5002), χ9070(pYA5005) and χ9070(pYA5006)] was significantly greater than survival of the Rec- strains [χ9070, χ9072 and χ9070(pYA5001)] at the UV doses indicated (P ≤ 0.002; *).

The bacterial strains used in this study * kan: kanamycin resistance gene; 5'tet: 5' portion of the tetA gene together with its promoter; 3'tet: 3' portion of the tetA gene. UV sensitivity of . Log phase cultures of S. Typhimurium were diluted and spread on LB agar. Multiple dilutions were exposed to 254 nm UV in a dark room at each designated dose. Then the plates were wrapped with aluminum foil and placed at 37°C overnight. Surviving fractions were calculated and shown except ΔrecA strains χ9833 and χ9833(pYA5001), for which no survivors were recovered at any UV dose. wt: χ3761; ΔrecF: χ9070; ΔrecJ: χ9072; ΔrecA(RecA+): χ9833(pYA5002); ΔrecF(vector): χ9070(pYA5001); ΔrecF(Typhimurium RecF+): χ9070(pYA5005); ΔrecF(Typhi RecF+): χ9070(pYA5006). Survival of Rec+ strains [χ3761, χ9833(pYA5002), χ9070(pYA5005) and χ9070(pYA5006)] was significantly greater than survival of the Rec- strains [χ9070, χ9072 and χ9070(pYA5001)] at the UV doses indicated (P ≤ 0.002; *).

Effect of rec deletions on intraplasmid recombination

To examine the influence of ΔrecA, ΔrecF and ΔrecJ mutations on intraplasmid recombination frequencies, plasmid pYA4463 (tandem duplication) or pYA4590 (tandem duplication with intervening sequence) were introduced into Salmonella rec mutants and their parental strains and analyzed as described in the Methods section. The recombination frequency of plasmid pYA4463 was approximately 1.5-5.0 × 10-3 in Rec+ Typhimurium, Typhi and Paratyphi A (Table 3). In S. Typhimurium and Paratyphi A, most of the rec deletions had no effect on the intraplasmid recombination frequency of plasmid pYA4463 except that a small, but statistically significant decrease in recombination was observed in the ΔrecA mutant of Paratyphi A. However, in both S. Typhi strains, both ΔrecF mutations resulted in approximately 10-fold decrease in recombination frequency (P < 0.01), while the ΔrecA and ΔrecJ mutations resulted in a 2-3-fold reduction (P < 0.01). In the complementation test, the recombination frequency of plasmid pYA4463 in S. Typhi χ11053 was restored to 2.52 ± 0.18 × 10-3 and 1.71 ± 0.68 × 10-3 by introduction of plasmid pYA5005 encoding S. Typhimurium recF gene and pYA5006 encoding the S. Typhi recF gene, respectively (Table 3).
Table 3

Plasmid recombination frequency (Mean ± STD, × 10-3)

Strainrec deletionpYA4463apYA4590bpYA4464+pYA4465c
S. Typhimurium
χ3761None1.55 ± 0.312.40 ± 0.542.88 ± 0.85
χ9833ΔrecA621.07 ± 0.240.22 ± 0.07**0.27 ± 0.07**
χ9070ΔrecF1261.14 ± 0.150.52 ± 0.07**0.33 ± 0.09**
χ9072ΔrecJ13151.87 ± 0.442.37 ± 0.211.10 ± 0.20**
χ9081ΔrecJ1315 ΔrecF126NAdNA0.35 ± 0.08**
χ9939ΔrecF126 ΔrecA62NA0.41 ± 0.09**0.35 ± 0.08**
χ9833(pYA5002)ΔrecA62 (RecA+)NA2.50 ± 0.42NA
χ9070(pYA5005)ΔrecF126 (RecF+)NA2.00 ± 0.24NA
S. Typhi Ty2
χ3769None4.69 ± 0.2611.59 ± 2.614.20 ± 1.44
χ11159ΔrecA621.32 ± 0.27**0.60 ± 0.19**3.37 ± 0.96
χ11053ΔrecF1260.51 ± 0.06**0.57 ± 0.09**6.19 ± 2.71
χ11134ΔrecF10740.45 ± 0.05**0.52 ± 0.17**16.28 ± 2.64**
χ11194ΔrecJ13151.69 ± 0.26**4.88 ± 1.56**2.31 ± 0.90
χ11053(pYA5005)ΔrecF126 (RecF+)2.52 ± 0.18NANA
χ11053(pYA5006)ΔrecF126 (RecF+)1.71 ± 0.68NANA
χ11159(pYA5002)ΔrecA62 (RecA+)NA14.35 ± 2.44NA
χ11053(pYA5006)ΔrecF126 (RecF+)NA2.86 ± 0.59NA
S. Typhi ISP1820
χ3744None4.93 ± 0.6713.10 ± 1.234.22 ± 0.25
χ11133ΔrecF10740.65 ± 0.26**0.71 ± 0.06**5.38 ± 0.58
S. Paratyphi A
χ8387None2.70 ± 0.393.32 ± 0.611.03 ± 0.15
χ11243ΔrecA621.91 ± 0.69**0.55 ± 0.20**0.13 ± 0.03**
χ11244ΔrecF1265.00 ± 0.701.16 ± 0.21**0.34 ± 0.04**
χ11245ΔrecJ13152.56 ± 0.411.83 ± 0.99**0.64 ± 0.15**

aIntraplasmid recombination without intervening sequence (5'tet-3'tet).

b Intraplasmid recombination with a 1041-bp intervening sequence (5'tet-kan-3'tet).

c Interplasmid recombination.

d Not assayed.

** P < 0.01, relative to the parental rec+ strain.

Plasmid recombination frequency (Mean ± STD, × 10-3) aIntraplasmid recombination without intervening sequence (5'tet-3'tet). b Intraplasmid recombination with a 1041-bp intervening sequence (5'tet-kan-3'tet). c Interplasmid recombination. d Not assayed. ** P < 0.01, relative to the parental rec+ strain. The results with plasmid pYA4590 were also variable among strains. The recombination frequency in Rec+ S. Typhimurium and S. Paratyphi A strains was approximately 2-3 × 10-3 and in both S. Typhi strains, the frequency was 3-fold higher, at 1.16 × 10-2 (Ty2) and 1.31 × 10-2 (ISP1820). In S. Typhimurium and S. Typhi Ty2, the Δ recA and ΔrecF mutations reduced the recombination frequency of plasmid pYA4590 by 5-20-fold (P < 0.01; Table 3). The results were similar for S. Paratyphi A, though the ΔrecF mutation only led to 3-fold lower plasmid pYA4590 recombination (P < 0.01). The ΔrecJ mutation had no effect in S. Typhimurium and resulted in a 2-3-fold decrease in recombination in both S. Typhi Ty2 and S. Paratyphi A. Combining the ΔrecA ΔrecF mutations in S. Typhimurium led to a recombination frequency similar to the frequencies observed for both mutations individually, indicating no additive effect. In the complementation test, plasmid pYA5002, which encodes S. Typhimurium recA, was transformed into S. Typhimurium ΔrecA mutant χ9833(pYA4590) and S. Typhi ΔrecA mutant χ11159(pYA4590). Their respective recombination frequencies were 2.50 ± 0.42 × 10-3 and 14.35 ± 2.44 × 10-3, which were comparable to the corresponding wild type strains (P > 0.05) (Table 3). The recF-encoding plasmids pYA5005 and pYA5006 were transformed into recF mutant strains χ9070(pYA4590) and χ11053(pYA4590), respectively. The respective recombination frequencies were increased to 2.00 ± 0.24 × 10-3 and 2.86 ± 0.59 × 10-3.

Effect of rec deletions on interplasmid recombination

To evaluate interplasmid recombination, plasmids pYA4464 and pYA4465 were co-electroporated into the wild-type and rec deletion strains. Electroporants from each test strain were grown in LB broth containing both ampicillin and chloramphenicol to maintain selection for both plasmids. The frequency of recombination was determined as described in the Methods section. The interplasmid recombination frequency was 1-4 × 10-3 for Rec+ S. Typhimurium, S. Typhi and S. Paratyphi A strains (Table 3). For Typhimurium and Paratyphi A, the ΔrecA and each ΔrecF mutation reduced the interplasmid recombination frequency by about 3-10-fold (P < 0.01). In contrast, the ΔrecA mutation had no effect on interplasmid recombination in S. Typhi Ty2. The ΔrecF mutations did not reduce interplasmid recombination in either of the Typhi strains. Surprisingly, introduction of the ΔrecF1074 mutation into S. Typhi Ty2 resulted in significantly higher interplasmid recombination (P < 0.01). Note that we performed this analysis in eight independent experiments and observed a higher recombination frequency of interplasmid recombination each time. The ΔrecJ mutation had no significant effect in S. Typhi, and a small (< 3-fold) but significant effect in S. Typhimurium and S. Paratyphi A. The recombination frequencies were also determined in S. Typhimurium strains ΔrecA ΔrecF and ΔrecF ΔrecJ double deletions. No additive effect between the two mutations was observed with respect to each single mutation.

Effect of rec deletions on chromosome related recombination

To measure intrachomosomal recombination frequencies, we introduced the pYA4590-derived DNA sequence containing two truncated tetA genes (5'tet-kan-3'tet) into the S. Typhimurium chromosome at cysG. The two truncated tetA genes had 602 bp of overlapping sequence. Intrachromosomal recombination deletes the kanamycin resistance cassette and restores one intact copy of the tetA gene (Figure 2C). Deletion of recA resulted in a 5-fold reduced recombination frequency compared to the Rec+ strain χ9931 (P < 0.01), while the recF or recJ deletions had no effect, indicating that RecF and RecJ are not involved in this process (Table 4).
Table 4

Chromosome related recombination in S. Typhimuriuma

rec deletionIntrachromosomal recombinationPlasmid integration


StrainFrequency (10-5)StrainFrequency (10-6)
Noneχ99316.02 ± 0.38χ99355.59 ± 0.94
ΔrecF126χ99327.05 ± 1.40χ99362.13 ± 0.60**
ΔrecJ1315χ99339.18 ± 2.18χ99374.89 ± 0.41
ΔrecA62χ99341.29 ± 0.51**χ9938b<0.00071**

a Mean ± STD from 3-5 assays were shown in the table.

b Upon introduction of pKD46 (30°C, 0.2% arabinose), the frequency was 6.41 ± 0.85 × 10-6 (P = 0.425).

** P < 0.01, relative to the parental rec+ strain.

Chromosome related recombination in S. Typhimuriuma a Mean ± STD from 3-5 assays were shown in the table. b Upon introduction of pKD46 (30°C, 0.2% arabinose), the frequency was 6.41 ± 0.85 × 10-6 (P = 0.425). ** P < 0.01, relative to the parental rec+ strain. To examine plasmid integration, the 5'tet gene was introduced into the S. Typhimurium chromosome at cysG. The resulting strains were transformed with plasmid pYA4464 (3'tet) (Figure 1B). The 789 bp of overlapping sequence between 5'tet on the chromosome and the 3'tet on the plasmid could result in plasmid integration into the chromosome, generating an intact tetA gene (Figure 2B). Deletion of recA had a profound effect, reducing the integration frequency to less than 7 × 10-10, which was below the limits of detection in this assay (P < 0.01), indicating a strict requirement for RecA in this process. Introduction of plasmid pKD46, which encodes the λ Red recombinase, into χ9938 (ΔrecA) carrying pYA4464 restored the integration frequency to the level of the Rec+ strain χ9935. Deletion of recF reduced the frequency of integration less than 3-fold (P < 0.01; Table 4) and the ΔrecJ deletion had no effect.

Effect of rec deletions on the virulence of S. Typhimurium

BALB/c mice were orally inoculated with the highly virulent S. Typhimurium strain χ3761 and its rec mutant derivatives. The LD50s of χ3761, χ9070 (ΔrecF) and χ9072 (ΔrecJ) were similar, 3.2 × 104, 6.8 × 104 and 1.5 × 105 CFU, respectively (Table 5). The LD50 of the ΔrecF ΔrecJ double mutant was approximately 100-fold higher than χ3761, at 2.2 × 106 CFU. All mice inoculated with 1.3 × 109 CFU of the ΔrecA mutant survived, indicating that the LD50 was > 1.3 × 109 CFU. Two months following the initial inoculation with the Δ recA mutant strain, surviving mice were challenged with either 1.5 × 108 or 1.5 × 109 CFU of wild-type strain χ3761. All mice survived the challenge, indicating that Δ recA mutant strain χ9833 was both attenuated and immunogenic.
Table 5

Virulence of S. Typhimurium rec mutants in BALB/c mice (oral inoculation)

Strainrec deletionDose (CFU)Survivor/totalLD50 (CFU)
χ3761None1.5 × 1060/43.2 × 104
1.5 × 1051/4
1.5 × 1043/4
1.5 × 1034/4
χ9070ΔrecF1261.0 × 1070/46.8 × 104
1.0 × 1061/4
1.0 × 1051/4
1.0 × 1044/4
χ9072ΔrecJ13151.0 × 1070/41.5 × 105
1.0 × 1060/4
1.0 × 1053/4
1.0 × 1043/4
χ9081ΔrecJ1315 Δ recF1261.0 × 1071/42.2 × 106
1.0 × 1063/4
1.0 × 1054/4
1.0 × 1043/4
χ9833ΔrecA621.3 × 10910/10>1.3 × 109
Virulence of S. Typhimurium rec mutants in BALB/c mice (oral inoculation)

Discussion

We began our studies using information gathered in E. coli as a reference point. In E. coli, recA-dependent homologous recombination relies on the RecBCD pathway, the RecFOR pathway (originally designated the RecF pathway) and the RecE pathway [38]. The RecBCD pathway is important in conjugational and transductional recombination [39], and may also be involved in the recombination of plasmids containing one or more Chi sites [40]. Recombination in small plasmids lacking a Chi sequence is primarily catalyzed by the RecFOR pathway [41]. RecF, RecO, and RecR bind to gaps of ssDNA and displace the single-strand DNA binding proteins to allow RecA to bind [42,43]. The RecJ ssDNA exonuclease acts in concert with RecFOR to enlarge the ssDNA region when needed. Strand exchange is then catalyzed by RecA [44]. Because of their prominent role in plasmid recombination in E. coli, we analyzed the effect of mutations in recF, recJ and recA on plasmid recombination in Salmonella. Attenuated S. Typhi strains have been developed as antigen delivery vectors for human vaccine use. Due to the host restriction phenotype of S. Typhi, preliminary work is typically done in S. Typhimurium using mice as the model system to work out attenuation and antigen expression strategies. Recently, we have also been investigating attenuated derivatives of the host-restricted strain S. Paratyphi A as a human vaccine vector. Therefore, it was of interest to evaluate and compare the effects of rec mutations in these three Salmonella serovars. We selected S. Typhi strain Ty2 as exemplary of this serovar because most of the vaccines tested in clinical trials to date have been derived from this strain [45]. S. Typhi strain ISP1820 has also been evaluated in clinical trials [46,47] and we therefore included it in some of our analyses. We found that, for some DNA substrates, the effects of ΔrecA and ΔrecF deletion mutations differed among Salmonella enterica serotypes. In particular, we found that deleting recA, recF or recJ in S. Typhi Ty2 and deleting recF in strain ISP1820 had significant effects (3-10 fold) on the recombination frequency of our direct repeat substrate, pYA4463 (Table 3). No or very limited effect (< 2 fold) was observed for our S. Typhimurium and S. Paratyphi A strains, consistent with results reported for E. coli indicating that recombination of this type of substrate is recA-independent [35]. In contrast, the ΔrecA and ΔrecF mutations resulted in lower interplasmid recombination in Typhimurium and Paratyphi A but not in Typhi strains. Deletion of recJ led to a reduction in intraplasmid recombination frequencies in S. Typhi, while no effect was seen in S. Typhimurium. The ΔrecJ mutation also affected plasmid recombination frequencies for two of the three substrates tested in S. Paratyphi A. Taken together, these results suggest that the recombination system in S. Typhi, or at least in strains Ty2 and ISP1820, is not identical to the recombination system in S. Typhimurium and S. Paratyphi A. To investigate the mechanism responsible for the observed differences, we analyzed the genome sequences of S. Typhimurium UK-1 (Luo, Kong, Golden and Curtiss, unpublished whole genome sequence), S. Paratyphi A (NC_006511) [48] and S. Typhi Ty2 (NC_004631) [49]. No paralogs of the recA, recF and recJ genes were found in the three strains. The S. Typhimurium UK-1 has RecA, RecO and RecR protein sequences identical to Typhi Ty2, and RecF and RecJ protein sequences with over 99% identity. Plasmids expressing Typhimurium recF or Typhi recF complemented the ΔrecF126 mutation in Typhi, as evidenced by the UV sensitivity profile (Figure 4) and intraplasmid recombination of pYA4463 (Table 3). Therefore, the basis for these differences are not clear and indicates that there may be other genes or gene products involved. A more detailed analysis of this phenomenon is under investigation. Plasmid recombination frequencies were higher in our Salmonella strains than those reported in E. coli. We observed intra- and interplasmid recombination frequencies on the order of 1 × 10-3 in Rec+ Salmonella, whereas measurements made in E. coli strain AB1157 using a similar plasmid system (equivalent to our substrates pYA4590 and pYA4464 + pYA4465) revealed a basal frequency around 10-fold lower, approximately 1 × 10-4 for both types of substrates [26]. Interestingly, the effect of a recF mutation in E. coli was to reduce the recombination frequency of intra- and interplasmid recombination approximately 30-fold, to roughly the same frequencies we observed for S. Typhimurium (Table 3). However, consistent with the results in E. coli, the effects of recA, recF, and recA recF mutations were similar, indicating that the mutations are epistatic. RecF has been shown previously to play a role in recombinational repair of chromosomal DNA in response to DNA damaging agents [50], including a major role in homologous recombination between direct repeats in the chromosome of S. Typhimurium. In our study, we did not observe any effect of recF on intrachromosomal recombination, although it did have an effect on the frequency of plasmid integration (Table 4). This discrepancy can be explained by the fact that we did not use DNA damaging agents in our study. These agents lead to single stranded stretches of DNA that represent substrates for recF (and recA). Our observation that recF did affect plasmid integration may reflect the presence of stretches of ssDNA in the plasmid, presumably due to supercoiling effects. To induce strong primary and memory immune responses, Salmonella delivery vectors should be sufficiently invasive and persistent to allow antigen expression in targeting organs, while maintaining a high degree of safety. This requires the use of mutations that attenuate the Salmonella vector without impairing its antigen delivery ability. Many attenuating mutations impair invasion and colonization ability. In our study, we confirmed a previous report that recF is not required for S. Typhimurium virulence in mice [51], indicating that the recF mutant remains invasive and replicates well in colonized organs. Therefore, including a ΔrecF mutation in a Salmonella vaccine strain is unlikely to affect its immunogenicity. Our results with the S. Typhimurium ΔrecA strain are consistent with two previous, independent studies showing that recA mutations reduce Salmonella virulence [51,52]. To evaluate the potential effect of ΔrecA mutation on immunogenicity, mice inoculated with the recA mutant were challenged with a lethal dose of virulent wild-type S. Typhimurium. All the challenged mice survived, indicating that a ΔrecA mutant retains immunogenicity and therefore may be suitable for use in a vaccine. However, since it does not affect virulence, inclusion of a ΔrecF mutation into a Salmonella vector that has been attenuated by other means to reduce the frequency of intra- and interplasmid recombination, may be more desirable than a ΔrecA mutation. Studies are currently underway to investigate these possibilities. Our data show that ΔrecA and ΔrecF mutations resulted in reduced frequencies of intraplasmid recombination in all Salmonella strains tested, which included three serovars, when there was an intervening sequence between the direct duplications (Table 3). Our results also show that it is likely that deletions in recA, recF or recJ will not be useful for reducing interplasmid recombination in S. Typhi vaccine strains, since we did not observe any reduction in interplasmid recombination frequency. This result was disappointing, since the majority of human trials with live Salmonella vaccines have focused on S. Typhi. In the case of S. Typhi, it appears that the best approach to preventing interplasmid recombination will be in the careful design of each plasmid, avoiding any stretches of homology. However, for vaccines based on S. Typhimurium or S. Paratyphi A, introduction of a ΔrecF mutation into attenuated Salmonella vaccine strains carrying multiple plasmids is a useful approach to reduce unwanted plasmid/plasmid or plasmid/chromosome recombination without further attenuating the strain or negatively influencing its immunogenicity. The ΔrecA mutation had a similar or more pronounced effect on reducing various classes of recombination and it clearly had an effect on virulence. We did not examine the effect of a ΔrecA mutation on the immunogenicity of a vectored antigen. Based on its effect on virulence, it may affect the immunogenicity of the vectored antigen in some attenuation backgrounds and therefore may not be applicable for all attenuation strategies.

Conclusions

In this study we showed that ΔrecA and ΔrecF mutations reduce intraplasmid recombination in S. Typhimurium, S. Typhi and S. Paratyphi while there is an intervening sequence between the duplicated sequences. The ΔrecA and ΔrecF mutations reduce interplasmid recombination in S. Typhimurium and S. Paratyphi but not in S. Typhi. The ΔrecF mutations also sharply reduce intraplasmid recombination between direct duplications in S. Typhi. Since ΔrecA mutation results in an avirulent Salmonella strain, the ΔrecF mutation is ideal for reducing plasmid recombination in Salmonella delivery vectors without impairing the virulence. The intrachromosomal recombination and plasmid integration are 2-3 orders lower than plasmid recombination, therefore are less concerned. These information help develop Salmonella delivery vectors able to stably maintain plasmid cargoes for vaccine development and gene therapy.

Methods

Bacterial strains and media

E. coli K-12 strain EPI300™ was used for cloning and stable maintenance of plasmids. All Salmonella strains used in this work were derived from Salmonella enterica serovar Typhimurium wild-type (wt) strain χ3761 (UK-1), serovar Typhi strains Ty2 and ISP1820 or serovar Paratyphi A strain χ8387. Their origin and relevant genotypes are presented in Table 2. Bacteria were grown in LB broth [53]. All plasmids used in this study and their relevant characteristics are presented in Table 1. Primers used for plasmid construction are shown in Table 6. All enzymes were obtained from New England Biolabs or Promega.
Table 6

Primers used in this study

PrimerSequenceaDirectionb
P1tatttctagatttcagtgcaatF
P2ttaggtaccgcgaacgccagcaagacgR
P3taaggtaccccggaattgccagctgggF
P4ttaggatcctccgcgcacatttccccgR
P5taacccgggaattctcatgtttgacF
P6ttaagatctccatgccggcgataatR
P7tgcttcaacagtacgaattcactatccggttcaataccaagttgcatgacgcatgcctgcagggcgcgF
P8gttttgctgaatggcggcttcgttttgcccgccccaccatcacctgatgattatttgttaactgttaattgtcR
P9ggcaacaatttctacaaaacacttgatactgtatgagcatacagtataattgcttcaacagtacgaaF
P10gagaaatgccaaaagggccgcataaatgcagcccttgatggtaatttaacgttttgctgaatggcggcR
P11taaactagtacgacagcagagtcctgtaccgF
P12ttaggtacctgaagcttgtcatgcaacttggtattgaacR
P13taaggtaccggatcctcatcaggtgatggtggggcggF
P14ttatctagatttgcgaacggcctgttcacgtR
P15gatagcacgtgctatcttgtgcF
P16tcgtcgcagacgctgttcgccgR
P17ctagtctagacgtcagtgagaatcagctcaaaF
P18caaggtaccatattagtacattcgtccaggR
P19cgcggtaccagcgctgaacacgttatagacatF
P20acatgcatgcgaatagtcacgacgatatctttR
P21ctagtctagacgtcagtgagaatcagctcaaaatcF
P22cggggtaccatcaactcataaccagggcgttatcR
P23cgactttatctttacctcgaagctggtggatF
P24gttacggacacggagttatcggcgtgaataR
P25ctagtctagaagattataacgcgctgggF
P26cggggtaccgcgtattatttaccactggtcR
P27cgcggtacctaatcggggcgatttaacaacF
P28acatgcatgccttcgagcgatgaacgctctR
P29gtctataaagcgccggatgagaaacatgtcF
P30tcgacgatcgcttcgagcgatgaacgctctR
P31taaaagcttgaccgcgactgtctgatcgtF
P32tcaagatctctcgggcgcggagttgcccggcR
P33taaagatcttgactgcagtgaaaaagcagtttgccacgatF
P34ttagagctcagaaaggaataccggcatgacaR
P35taaagatctcgatataagttgtaattctcF
P36ttactgcaggcgaggtgccgccggcttccR
P37ttactgcagtccgcgcacatttccccgR
P38ggggtaatgtcgtggaccatttgcF
P39ccgcggtaatccccggcactaccgR
P40gcgctacaaaccctgtggcaacaatF
P41gctgtgatcgcggacagcaagaatacR
P42ttctcaacataaaaaagtttgtgtaatactgaggatgcggcgtcacagF
P43gttacggacacggagttatcggcgtgaataR

a The underlined sequences are enzyme sites mentioned in the text.

b Forward (F) or reverse (R) primers.

Primers used in this study a The underlined sequences are enzyme sites mentioned in the text. b Forward (F) or reverse (R) primers. To construct plasmid pYA4463 (Figure 1 panel A), a XbaI-HincII fragment containing the tetA promoter and 568 bp of the 5' end of tetA, was excised from pACYC184 and ligated into XbaI-EcoRV digested pACYC184. To generate plasmid pYA4590 (Figure 1 panel A), the 5' end of tetA gene together with its promoter was amplified from pACYC184 with primers P1 and P2, which contain engineered XbaI and KpnI restriction sites, respectively. The resulting PCR fragment was digested with XbaI and KpnI. The kan gene was amplified from plasmid p15A-PB2-kan, a pACYC184 derivative carrying a influenza virus PB2 gene and a kan cassette, with primers P3 and P4, which were engineered to contain KpnI and BamHI sites, respectively. The resulting PCR fragment was digested with KpnI and BamHI. The two digested PCR fragments were ligated into pACYC184 digested with XbaI and BamHI. The resulting plasmid, pYA4590, contains the tetA promoter and 891 bp of the 5' end of tetA, a 1041-bp fragment encoding kan and its promoter followed by 902 bp of the 3'end of tetA. To construct plasmid pYA4464 (Figure 1 panel B), plasmid pACYC184 was digested with XbaI and EcoRV to remove the 5' 102 bp of the tetA gene and the tetA promoter. The cohesive ends were filled using the Klenow large fragment of DNA polymerase and the linear plasmid was self-ligated to yield plasmid pYA4464. To construct plasmid pYA4465 (Figure 1 panel B), the 5' 853 bp of tetA together with its promoter was amplified from pACYC184 using primers P5 and P6, which were engineered with SmaI and BglII sites, respectively. The resulting PCR fragment was digested with SmaI and BglII, and ligated to EcoRV and BglII digested pBAD-HisA.

Creation of rec deletions

The recA62 deletion, which deletes 1062 bp, encompassing the entire recA open reading frame, introduced into the bacterial chromosome using either λ Red recombinase-mediated recombination [54], or conjugation with E. coli strain χ7213(pYA4680) followed by selection/counterselection with chloramphenicol and sucrose, respectively [55]. The cat-sacB cassette was amplified from plasmid pYA4373 by PCR with primers P7 and P8 to add flanking sequence. The PCR product was further amplified with primer P9 and P10 to extend the flanking sequence. Those two steps of amplification resulted in the cat-sacB cassette flanked by 100 bp of recA flanking sequences at both ends. The PCR product was purified with QIAquick Gel Extraction Kit (QIAGEN) and electroporated into Salmonella strains carrying plasmid pKD46 to facilitate replacement of the recA gene with the cat-sacB cassette. Electroporants containing the cat-sacB cassette were selected on LB plates containing 12.5 μg chloramphenicol ml-1. From S. Typhimurium chromosome, a 500-bp sequence upstream recA gene was amplified with primers P11 and primer P12 and a 500-bp sequence downstream recA gene was amplified with primers P13 and P14. Primers P12 and P13 were engineered with a KpnI site. The two PCR fragments were digested with KpnI, ligated and amplified with primers P11 and P14. The resulting PCR product was digested with isocaudarner SpeI and XbaI and ligated into XbaI-digested pRE112 to yield plasmid pYA4680. In addition, undigested, agarose-gel purified PCR product was electroporated into the cat-sacB Salmonella strains carrying plasmid pKD46 and spread onto LB plates containing 5% sucrose to select for deletion of the cat-sacB cassette. Chloramphenicol-sensitive isolates were verified as ΔrecA62 by PCR using primers P15 and P16 (ΔrecA62: 1360 bp; wt: 2412 bp). S. Typhimurium strains χ9833 and χ9939 were constructed by this method (Table 2). For construction of a ΔrecA62 mutant of S. Typhi, wild-type strain Ty2 was mated with E. coli strain χ7213(pYA4680). Transconjugants were selected on LB plates containing chloramphenicol, followed by counterselection on sucrose plates as described above. The resulting ΔrecA62 strain was designated χ11159. The S. Paratyphi A strain χ11243 was generated from wild-type strain χ8387 using the same strategy. The ΔrecF deletion strains were constructed using suicide vectors pYA3886 and pYA4783. From the S. Typhimurium chromosome, a 397-bp sequence upstream of the recF gene was amplified with primers P17 and P18, which were engineered with XbaI and KpnI sites, respectively. The downstream 296-bp sequence (including 78 bp from the 3' ORF of recF) was amplified with primers P19 and P20 containing KpnI and SphI sites, respectively. The two fragments were digested and inserted into XbaI-SphI digested pRE112, resulting in plasmid pYA3886. The corresponding deletion was designated ΔrecF126. Strains χ9070, χ9081 and χ11244 were generated by conjugation using E. coli strain χ7213(pYA3886). Phage P22HTint mediated transduction was used to construct Typhi strain χ11053 [56]. The ΔrecF126 deleted 996 bp from the 5'end of recF in serovars Typhimurium and Paratyphi. The upstream flanking sequence of S. Typhi is different with the other serotypes. To construct a serovar Typhi-specific ΔrecF mutation, we constructed a new suicide vector. The recF upstream flanking sequence in plasmid pYA3886 was replaced with the corresponding DNA sequence (447 bp) from S. Typhi Ty2. Primers P21 and P22 were used for this modification. The resulting plasmid was designated as pYA4783. The Typhi-specific ΔrecF1074 mutation was introduced into S. Typhi strains ISP1820 and Ty2 by conjugation with E. coli strain χ7213(pYA4783) to yield strains χ11133 and χ11134, respectively. Primers P23 and P24 were used to verify the recF126 and recF1074 deletions. Similar strategies were used to construct the Δ recJ1315 deletion with suicide vector pYA3887. From the S. Typhimurium chromosome, 330 bp upstream of the recJ gene was amplified with primers P25 and P26, which were engineered with XbaI and KpnI sites, respectively. The 299-bp downstream sequence was amplified with primers P27 and P28, engineered with KpnI and SphI sites, respectively. The two fragments were digested and ligated with XbaI-SphI digested pRE112. The resulting plasmid was designated pYA3887 and the corresponding deletion was named ΔrecJ1315. Strains χ9072 and χ11245 were generated by conjugating the parental strains with E. coli strain χ7213(pYA3887). Strain χ11194 was constructed by phage P22HTint mediated transduction. The ΔrecJ1315 mutation is a deletion of the entire recJ gene (1734 bp). Primers P29 and P30 were used to verify the recJ1315 deletion (ΔrecJ1315: 736 bp; wt: 2461 bp). To test chromosome-related recombination, the 5'tet and 3'tet fragments were inserted into the cysG gene of each S. Typhimurium strain using the λ Red system. The 460-bp fragment of the cysG gene was amplified using primers P31 and P32 that were engineered with HindIII and BglII sites, respectively. The PCR product was digested with HindIII and BglII. A 480 bp adjoining fragment of cysG was amplified with primers P33 and P34. Primer P33 was engineered with BglII and PstI sites and primer P34 was engineered with a SacI site. The PCR product was digested with BglII and SacI. The two digested PCR fragments were ligated into HindIII and SacI digested pYA4518, deleting green fluorescent protein (GFP) gene. The resulting plasmid pYA4518-cysG has BssHII and PstI sites between the two cysG-fragments. This plasmid was digested with BssHII, followed by treatment with the Klenow large fragment. The linear plasmid was further digested with PstI for insertion of truncated tetA genes. The 5'tet-kan-3'tet cassette was amplified from pYA4590 with primers P35 and P36. Primer P36 was engineered with a PstI site. The PCR product was digested with PstI and inserted between the cysG fragments in pYA4518-cysG to yield plasmid pYA4689. The 5'tet-kan cassette was amplified from pYA4590 with primers P35 and P37. Primer P37 was engineered with a PstI site. The PCR product was digested with PstI and inserted into treated pYA4518-cysG to obtain plasmid pYA4690. The 5'tet-kan-3'tet cassette, together with cysG flanking sequences, was amplified from pYA4689 using primers P31 and P34. The PCR product was electroporated into strains χ3761(pKD46), χ9070(pKD46), χ9072(pKD46) and χ9833(pKD46) with selection on LB plates containing 25 μg/ml chloramphenicol. After growth at 37°C to cure plasmid pKD46, the resulting strains containing chromosomal copies of the 5'tet-kan-3'tet cassette in cysG were designated χ9931 (Rec+), χ9932 (ΔrecF), χ9933 (ΔrecJ) and χ9934 (ΔrecA), respectively. Primers P38 and P39 were used to verify insertion in the cysG gene. The 5'tet-kan cassette together with cysG flanking sequences was amplified from pYA4690 with primers P31 and P34. Using the same strategy, the PCR product was electroporated into pKD46 transformants of strains χ3761, χ9070, χ9072 and χ9833 to yield strains χ9935 (Rec+), χ9936 (ΔrecF), χ9937 (ΔrecJ) and χ9938 (ΔrecA), respectively, each containing the 5'tet-kan cassette inserted into cysG. These strains were transformed with plasmid pYA4464 to test plasmid integration based on the 789-bp of tetA sequence common to both the plasmid and the bacterial chromosome.

Analysis of recombination frequency

To examine plasmid recombination and plasmid integration, plasmid(s) containing truncated tetA genes were introduced into Salmonella strains with or without rec mutations. The resulting strains were inoculated into 3 ml of LB broth supplemented with 100 μg/ml ampicillin and/or 25 μg/ml chloramphenicol, as needed. After 8 h growth at 37°C, bacteria were serially diluted in 10-fold steps. 100 μl of the 10-2, 10-3 or 10-4 dilution were spread onto LB-agar plates supplemented with 10 μg tetracycline ml-1 and 100 μl of the 10-5, 10-6 or 10-7 dilutions were spread onto LB-agar plates with or without the addition of antibiotics, as needed. Plates were incubated overnight at 37°C. The ratio of tetracycline resistant colonies to total colonies was calculated as the recombination frequency. The average mean frequency was calculated using the frequencies obtained from 3-10 assays for each strain. Following one-way ANOVA, the Dunnett's test was used to compare multiple groups against the control. The Student's t-test was used to analyze two independent samples.

Complementation of rec mutation

Plasmid pYA5001 has a pSC101 ori, a gentamicin resistance marker and a prokaryotic green fluorescent protein (GFP) gene cassette flanked by two AhdI sites. A linearized T vector for cloning PCR products can be obtained by removing the GFP cassette by AhdI digestion. The recA genes from S. Typhimurium and S. Typhi were amplified using their respective chromosomal DNAs as template with primers P40 and P41. The recF genes were amplified similarly using primers P42 and P43. The forward primer P42 was engineered to include the S. Typhimurium lpp promoter sequence ttctcaacataaaaaagtttgtgtaatact (the -35 and -10 boxes are underlined). Amplified DNA fragment were treated with Taq DNA polymerase in the presence of dATP to add 3' A overhangs. Then the treated PCR products were cloned into pYA5001-derived T vector to yield recA plasmids pYA5002 (Typhimurium) and pYA5004 (Typhi), and recF plasmids pYA5005 (Typhimurium) and pYA5006 (Typhi). The recA plasmids, recF plasmids or empty vector plasmid pYA5001 were transformed into S. Typhimurium recA or recF mutants, respectively for complementation studies. The recA and recF plasmids were also introduced into Salmonella strains carrying pYA4590 or pYA4463 to complement the rec mutation and measure the plasmid recombination frequency.

UV sensitivity test

Quantitative UV killing curves were measured as described previously [57]. Briefly, cells were grown in 3 ml of LB broth at 37°C with vigorous shaking to mid-log phase. The cells were then 10 fold serially diluted in buffered saline with gelatin (BSG) and spread on LB agar plates. Multiple dilutions were exposed to 254 nm UV in a dark room at each designated dose. Then the plates were wrapped with aluminum foil and placed at 37°C overnight. The 10-6 dilutions were not exposed to UV to determine the total bacterial cell numbers present in the culture. Surviving fractions were calculated as the CFU remaining after UV exposure/total CFU present.

Virulence determination of the rec mutants

Eight-week old BALB/c female mice were purchased from Charles River Laboratories (Wilmington, MA). Mice were held in quarantine for 1 week before use in experiments. Food and water were deprived 6 h before administration of bacteria. Each mouse was orally inoculated with 20 μl of Salmonella suspended in buffered saline with gelatin (BSG) by pipet feeding. Food and water were returned 30 min after inoculation. All mice were observed for a month to record mortality. The 50% lethal dose (LD50) was determined via the Reed and Muench method [58]. Surviving mice were challenged orally with wild-type Salmonella χ3761 two months after the first inoculation.

Competing interests

The authors declare that they have no competing interests.

Authors' contributions

RC, XMZ and WK conceived and designed the study. XMZ, SYW and KB constructed plasmids and Salmonella strains. XMZ performed all DNA recombination assays. XMZ, WK and XZ carried out the animal experiment. XMZ and KR performed UV killing experiment and wrote the manuscript. All authors read and approved the final manuscript.
  60 in total

1.  RecBCD and RecFOR dependent induction of chromosomal deletions by sodium selenite in Salmonella.

Authors:  Javier Espinosa-Aguirre; Claudia Barajas-Lemus; Sandra Hernández-Ojeda; Tzipe Govezensky; Julieta Rubio; Rafael Camacho-Carranza
Journal:  Mutat Res       Date:  2009-03-09       Impact factor: 2.433

Review 2.  Mechanisms of recombination: lessons from E. coli.

Authors:  Nicole S Persky; Susan T Lovett
Journal:  Crit Rev Biochem Mol Biol       Date:  2008 Nov-Dec       Impact factor: 8.250

3.  Highly efficient method for introducing successive multiple scarless gene deletions and markerless gene insertions into the Yersinia pestis chromosome.

Authors:  Wei Sun; Shifeng Wang; Roy Curtiss
Journal:  Appl Environ Microbiol       Date:  2008-05-16       Impact factor: 4.792

4.  One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products.

Authors:  K A Datsenko; B L Wanner
Journal:  Proc Natl Acad Sci U S A       Date:  2000-06-06       Impact factor: 11.205

5.  Immunogenicity of recombinant attenuated Salmonella enterica serovar Typhimurium vaccine strains carrying a gene that encodes Eimeria tenella antigen SO7.

Authors:  Vjollca Konjufca; Mark Jenkins; Shifeng Wang; Maria Dolores Juarez-Rodriguez; Roy Curtiss
Journal:  Infect Immun       Date:  2008-09-22       Impact factor: 3.441

6.  Salmonella-mediated delivery of RNase P-based ribozymes for inhibition of viral gene expression and replication in human cells.

Authors:  Yong Bai; Hongjian Li; Gia-Phong Vu; Hao Gong; Sean Umamoto; Tianhong Zhou; Sangwei Lu; Fenyong Liu
Journal:  Proc Natl Acad Sci U S A       Date:  2010-04-01       Impact factor: 11.205

Review 7.  Salmonella as live trojan horse for vaccine development and cancer gene therapy.

Authors:  María Moreno; M Gabriela Kramer; Lucía Yim; José A Chabalgoity
Journal:  Curr Gene Ther       Date:  2010-02       Impact factor: 4.391

8.  Salmonella enterica serovar typhimurium strains with regulated delayed attenuation in vivo.

Authors:  Roy Curtiss; Soo-Young Wanda; Bronwyn M Gunn; Xin Zhang; Steven A Tinge; Vidya Ananthnarayan; Hua Mo; Shifeng Wang; Wei Kong
Journal:  Infect Immun       Date:  2008-12-22       Impact factor: 3.441

9.  A one-plasmid system to generate influenza virus in cultured chicken cells for potential use in influenza vaccine.

Authors:  Xiangmin Zhang; Wei Kong; Shamaila Ashraf; Roy Curtiss
Journal:  J Virol       Date:  2009-07-08       Impact factor: 5.103

10.  Evaluation of new generation Salmonella enterica serovar Typhimurium vaccines with regulated delayed attenuation to induce immune responses against PspA.

Authors:  Yuhua Li; Shifeng Wang; Giorgio Scarpellini; Bronwyn Gunn; Wei Xin; Soo-Young Wanda; Kenneth L Roland; Roy Curtiss
Journal:  Proc Natl Acad Sci U S A       Date:  2008-12-29       Impact factor: 11.205

View more
  10 in total

Review 1.  New technologies in developing recombinant attenuated Salmonella vaccine vectors.

Authors:  Shifeng Wang; Qingke Kong; Roy Curtiss
Journal:  Microb Pathog       Date:  2012-11-08       Impact factor: 3.738

2.  A biologically conjugated polysaccharide vaccine delivered by attenuated Salmonella Typhimurium provides protection against challenge of avian pathogenic Escherichia coli O1 infection.

Authors:  Yue Han; Qing Liu; Jie Yi; Kang Liang; Yunan Wei; Qingke Kong
Journal:  Pathog Dis       Date:  2017-11-30       Impact factor: 3.166

3.  The Asd(+)-DadB(+) dual-plasmid system offers a novel means to deliver multiple protective antigens by a recombinant attenuated Salmonella vaccine.

Authors:  Wei Xin; Soo-Young Wanda; Xiangmin Zhang; Javier Santander; Giorgio Scarpellini; Karen Ellis; Praveen Alamuri; Roy Curtiss
Journal:  Infect Immun       Date:  2012-08-06       Impact factor: 3.441

4.  Efficient generation of influenza virus with a mouse RNA polymerase I-driven all-in-one plasmid.

Authors:  Xiangmin Zhang; Roy Curtiss
Journal:  Virol J       Date:  2015-06-22       Impact factor: 4.099

5.  Generation of influenza virus from avian cells infected by Salmonella carrying the viral genome.

Authors:  Xiangmin Zhang; Wei Kong; Soo-Young Wanda; Wei Xin; Praveen Alamuri; Roy Curtiss
Journal:  PLoS One       Date:  2015-03-05       Impact factor: 3.240

6.  The food-borne pathogen Campylobacter jejuni depends on the AddAB DNA repair system to defend against bile in the intestinal environment.

Authors:  Christopher R Gourley; Nicholas M Negretti; Michael E Konkel
Journal:  Sci Rep       Date:  2017-10-31       Impact factor: 4.379

7.  A Strategy for the Rapid Development of a Safe Vibrio cholerae Candidate Vaccine Strain.

Authors:  Dmitry S Karpov; Anna V Goncharenko; Evgenii V Usachev; Daria V Vasina; Elizaveta V Divisenko; Yaroslava M Chalenko; Andrei A Pochtovyi; Roman S Ovchinnikov; Valentin V Makarov; Sergei M Yudin; Artem P Tkachuk; Vladimir A Gushchin
Journal:  Int J Mol Sci       Date:  2021-10-28       Impact factor: 5.923

8.  Multicopy integration of mini-Tn7 transposons into selected chromosomal sites of a Salmonella vaccine strain.

Authors:  Karen Roos; Esther Werner; Holger Loessner
Journal:  Microb Biotechnol       Date:  2014-12-09       Impact factor: 5.813

Review 9.  Live-Attenuated Bacterial Vectors: Tools for Vaccine and Therapeutic Agent Delivery.

Authors:  Ivan Y C Lin; Thi Thu Hao Van; Peter M Smooker
Journal:  Vaccines (Basel)       Date:  2015-11-10

10.  Overexpression of NTRK1 Promotes Differentiation of Neural Stem Cells into Cholinergic Neurons.

Authors:  Limin Wang; Feng He; Zhuoyuan Zhong; Ruiyan Lv; Songhua Xiao; Zhonglin Liu
Journal:  Biomed Res Int       Date:  2015-10-05       Impact factor: 3.411

  10 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.