Characterization of four VNTR loci on human chromosome 6.

We have determined DNA sequences of four VNTR loci; three in the peritelomeric region of Chromosome (Chr) 6q and one at 6p21. Heterozygosities of these loci among 80 CEPH parents are 78% (D6S139), 69% (D6S149), 76% (D6S161), and 94% (D6S193), respectively. The consensus sequences of repeating units at these VNTR loci are GAGCGGCAGGGGCAGCGGGGCCTGGCCAGAGAG-(34 bp) at D6S139, CCAGGCTGGTTCACAGGCTGTGGGGTGTGATGGGTGATG (39 bp) at D6S149, GGATGGGGTTGGAGGAACTACAGAGCGGTGGTGAAGAGGA (40 bp) at D6S161, and GAGGAGGTGGGGGCCT (16 bp) at D6S193. The GC content of the consensus sequences is 62% as high as reported previously. Furthermore, we have established a PCR assay for D6S193 locus and this will be useful for individual identification or for a study of loss of heterozygosity on the long arm of Chr 6 in malignant tumors.